DNASU Plasmid Repository • 480.965.5697 | Email

RAF1 (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  RAF1
Gene Name:  v-raf-1 murine leukemia viral oncogene homolog 1
Original Clone ID: FLH136194.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1947nts         Open reading frame : 1 to 1947
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 2288
Start on reference sequence 342
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : RAF1
Symbol Nomenclature : RAF1
SYNONYM : CRAF; NS5; Raf-1; c-Raf
Designation : Oncogene RAF1|RAF proto-oncogene serine/threonine-protein kinase|proto-oncogene c-RAF|raf proto-oncogene serine/threonine protein kinase
Full Nomenclature : v-raf-1 murine leukemia viral oncogene homolog 1
GENEID : 5894
HGNC : 9829
MIM : 164760
Vega : OTTHUMG00000129789
Target GenBank: BC018119


Reference Sequence Alignment












XM_005265357.1      ------------------------------------------------------------

XM_005265357.1      ----------------------CTCAGCACAGATATTCTACACCTCACGCCTTCACCTTT























NCI : BCR signaling pathway
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : Ceramide signaling pathway
NCI : Class I PI3K signaling events mediated by Akt
NCI : Downstream signaling in naïve CD8+ T cells
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : IGF1 pathway
NCI : IL2-mediated signaling events
NCI : Internalization of ErbB1
NCI : Nongenotropic Androgen signaling
NCI : PDGFR-beta signaling pathway
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Regulation of retinoblastoma protein
NCI : SHP2 signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by focal adhesion kinase
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : mTOR signaling pathway
NCI : p38 signaling mediated by MAPKAP kinases
Panther : Angiogenesis
Panther : Angiotensin II-stimulated signaling through G proteins and beta-arrestin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Reactome : ARMS-mediated activation
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Frs2-mediated activation
Reactome : GP1b-IX-V activation signalling
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin-2 signaling
Reactome : Ion channel transport
Reactome : MEK activation
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Platelet activation, signaling and aggregation
Reactome : Post NMDA receptor activation events
Reactome : Prolonged ERK activation events
Reactome : RAF activation
Reactome : RAF phosphorylates MEK
Reactome : RAF/MAP kinase cascade
Reactome : Rap1 signalling
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : Stimuli-sensing channels
Reactome : Transmembrane transport of small molecules
Reactome : Transmission across Chemical Synapses
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : EPO Receptor Signaling
WikiPathway : FSH signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Senescence and Autophagy
WikiPathway : Serotonin Receptor 2 and ELK-SRF/GATA4 signaling
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : angiogenesis overview


Cloning Information : 136194
HIP Master Clone ID : 87353
Original Clone ID : FLH136194.01L


TAX_ID : 9606
Species Specific ID: 5894


Chromosome : 3
Map Location : 3p25
Ensembl : ENSG00000132155


Labome : Raf-1-antibody