DNASU Plasmid Repository • 480.965.5697 | Email

PLK (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PLK1
Gene Name:  polo-like kinase 1
Sequence             
Original Clone ID: FLH136215.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038133

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1812nts         Open reading frame : 1 to 1812
Reference Sequence Alignment

ATGAGTGCTGCAGTGACTGCAGGGAAGCTGGCACGGGCACCGGCCGACCCTGGGAAAGCC
GGGGTCCCCGGAGTTGCAGCTCCCGGAGCTCCGGCGGCGGCTCCACCGGCGAAAGAGATC
CCGGAGGTCCTAGTGGACCCACGCAGCCGGCGGCGCTATGTGCGGGGCCGCTTTTTGGGC
AAGGGCGGCTTTGCCAAGTGCTTCGAGATCTCGGACGCGGACACCAAGGAGGTGTTCGCG
GGCAAGATTGTGCCTAAGTCTCTGCTGCTCAAGCCGCACCAGAGGGAGAAGATGTCCATG
GAAATATCCATTCACCGCAGCCTCGCCCACCAGCACGTCGTAGGATTCCACGGCTTTTTC
GAGGACAACGACTTCGTGTTCGTGGTGTTGGAGCTCTGCCGCCGGAGGTCTCTCCTGGAG
CTGCACAAGAGGAGGAAAGCCCTGACTGAGCCTGAGGCCCGATACTACCTACGGCAAATT
GTGCTTGGCTGCCAGTACCTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGC
AACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAA
GTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCC
GAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATC
ATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTAC
CTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCC
CTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCTT
AATGACGAGTTCTTTACTTCTGGCTATATCCCTGCCCGTCTCCCCATCACCTGCCTGACC
ATTCCACCAAGGTTTTCGATTGCTCCCAGCAGCCTGGACCCCAGCAACCGGAAGCCCCTC
ACAGTCCTCAATAAAGGCTTGGAGAACCCCCTGCCTGAGCGTCCCCGGGAAAAAGAAGAA
CCAGTGGTTCGAGAGACAGGTGAGGTGGTCGACTGCCACCTCAGTGACATGCTGCAGCAG
CTGCACAGTGTCAATGCCTCCAAGCCCTCGGAGCGTGGGCTGGTCAGGCAAGAGGAGGCT
GAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAG
TACGGCCTTGGGTATCAGCTCTGTGATAACAGCGTGGGGGTGCTCTTCAATGACTCAACA
CGCCTCATCCTCTACAATGATGGTGACAGCCTGCAGTACATAGAGCGTGACGGCACTGAG
TCCTACCTCACCGTGAGTTCCCATCCCAACTCCTTGATGAAGAAGATCACCCTCCTTAAA
TATTTCCGCAATTACATGAGCGAGCACTTGCTGAAGGCAGGTGCCAACATCACGCCGCGC
GAAGGTGATGAGCTCGCCCGGCTGCCCTACCTACGGACCTGGTTCCGCACCCGCAGCGCC
ATCATCCTGCACCTCAGCAACGGCAGCGTGCAGATCAACTTCTTCCAGGATCACACCAAG
CTCATCTTGTGCCCACTGATGGCAGCCGTGACCTACATCGACGAGAAGCGGGACTTCCGC
ACATACCGCCTGAGTCTCCTGGAGGAGTACGGCTGCTGCAAGGAGCTGGCCAGCCGGCTC
CGCTACGCCCGCACTATGGTGGACAAGCTGCTGAGCTCACGCTCGGCCAGCAACCGTCTC
AAGGCCTCCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1843
Start on reference sequence 32
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PLK1
Symbol Nomenclature : PLK1
SYNONYM : PLK; STPK13
Designation : PLK-1|cell cycle regulated protein kinase|polo (Drosophia)-like kinase|polo like kinase|serine/threonine-protein kinase 13|serine/threonine-protein kinase PLK1
Full Nomenclature : polo-like kinase 1
GENEID : 5347
HGNC : 9077
MIM : 602098
Vega : OTTHUMG00000096984
Target GenBank: BC003002

 

Reference Sequence Alignment

  

HsCD00038133      ATGAGTGCTGCAGTGACTGCAGGGAAGCTGGCACGGGCACCGGCCGACCCTGGGAAAGCC
NM_005030.3       ATGAGTGCTGCAGTGACTGCAGGGAAGCTGGCACGGGCACCGGCCGACCCTGGGAAAGCC
                  ************************************************************

HsCD00038133      GGGGTCCCCGGAGTTGCAGCTCCCGGAGCTCCGGCGGCGGCTCCACCGGCGAAAGAGATC
NM_005030.3       GGGGTCCCCGGAGTTGCAGCTCCCGGAGCTCCGGCGGCGGCTCCACCGGCGAAAGAGATC
                  ************************************************************

HsCD00038133      CCGGAGGTCCTAGTGGACCCACGCAGCCGGCGGCGCTATGTGCGGGGCCGCTTTTTGGGC
NM_005030.3       CCGGAGGTCCTAGTGGACCCACGCAGCCGGCGGCGCTATGTGCGGGGCCGCTTTTTGGGC
                  ************************************************************

HsCD00038133      AAGGGCGGCTTTGCCAAGTGCTTCGAGATCTCGGACGCGGACACCAAGGAGGTGTTCGCG
NM_005030.3       AAGGGCGGCTTTGCCAAGTGCTTCGAGATCTCGGACGCGGACACCAAGGAGGTGTTCGCG
                  ************************************************************

HsCD00038133      GGCAAGATTGTGCCTAAGTCTCTGCTGCTCAAGCCGCACCAGAGGGAGAAGATGTCCATG
NM_005030.3       GGCAAGATTGTGCCTAAGTCTCTGCTGCTCAAGCCGCACCAGAGGGAGAAGATGTCCATG
                  ************************************************************

HsCD00038133      GAAATATCCATTCACCGCAGCCTCGCCCACCAGCACGTCGTAGGATTCCACGGCTTTTTC
NM_005030.3       GAAATATCCATTCACCGCAGCCTCGCCCACCAGCACGTCGTAGGATTCCACGGCTTTTTC
                  ************************************************************

HsCD00038133      GAGGACAACGACTTCGTGTTCGTGGTGTTGGAGCTCTGCCGCCGGAGGTCTCTCCTGGAG
NM_005030.3       GAGGACAACGACTTCGTGTTCGTGGTGTTGGAGCTCTGCCGCCGGAGGTCTCTCCTGGAG
                  ************************************************************

HsCD00038133      CTGCACAAGAGGAGGAAAGCCCTGACTGAGCCTGAGGCCCGATACTACCTACGGCAAATT
NM_005030.3       CTGCACAAGAGGAGGAAAGCCCTGACTGAGCCTGAGGCCCGATACTACCTACGGCAAATT
                  ************************************************************

HsCD00038133      GTGCTTGGCTGCCAGTACCTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGC
NM_005030.3       GTGCTTGGCTGCCAGTACCTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGC
                  ************************************************************

HsCD00038133      AACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAA
NM_005030.3       AACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAA
                  ************************************************************

HsCD00038133      GTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCC
NM_005030.3       GTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCC
                  ************************************************************

HsCD00038133      GAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATC
NM_005030.3       GAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATC
                  ************************************************************

HsCD00038133      ATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTAC
NM_005030.3       ATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTAC
                  ************************************************************

HsCD00038133      CTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCC
NM_005030.3       CTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCC
                  ************************************************************

HsCD00038133      CTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCTT
NM_005030.3       CTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCTT
                  ************************************************************

HsCD00038133      AATGACGAGTTCTTTACTTCTGGCTATATCCCTGCCCGTCTCCCCATCACCTGCCTGACC
NM_005030.3       AATGACGAGTTCTTTACTTCTGGCTATATCCCTGCCCGTCTCCCCATCACCTGCCTGACC
                  ************************************************************

HsCD00038133      ATTCCACCAAGGTTTTCGATTGCTCCCAGCAGCCTGGACCCCAGCAACCGGAAGCCCCTC
NM_005030.3       ATTCCACCAAGGTTTTCGATTGCTCCCAGCAGCCTGGACCCCAGCAACCGGAAGCCCCTC
                  ************************************************************

HsCD00038133      ACAGTCCTCAATAAAGGCTTGGAGAACCCCCTGCCTGAGCGTCCCCGGGAAAAAGAAGAA
NM_005030.3       ACAGTCCTCAATAAAGGCTTGGAGAACCCCCTGCCTGAGCGTCCCCGGGAAAAAGAAGAA
                  ************************************************************

HsCD00038133      CCAGTGGTTCGAGAGACAGGTGAGGTGGTCGACTGCCACCTCAGTGACATGCTGCAGCAG
NM_005030.3       CCAGTGGTTCGAGAGACAGGTGAGGTGGTCGACTGCCACCTCAGTGACATGCTGCAGCAG
                  ************************************************************

HsCD00038133      CTGCACAGTGTCAATGCCTCCAAGCCCTCGGAGCGTGGGCTGGTCAGGCAAGAGGAGGCT
NM_005030.3       CTGCACAGTGTCAATGCCTCCAAGCCCTCGGAGCGTGGGCTGGTCAGGCAAGAGGAGGCT
                  ************************************************************

HsCD00038133      GAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAG
NM_005030.3       GAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAG
                  ************************************************************

HsCD00038133      TACGGCCTTGGGTATCAGCTCTGTGATAACAGCGTGGGGGTGCTCTTCAATGACTCAACA
NM_005030.3       TACGGCCTTGGGTATCAGCTCTGTGATAACAGCGTGGGGGTGCTCTTCAATGACTCAACA
                  ************************************************************

HsCD00038133      CGCCTCATCCTCTACAATGATGGTGACAGCCTGCAGTACATAGAGCGTGACGGCACTGAG
NM_005030.3       CGCCTCATCCTCTACAATGATGGTGACAGCCTGCAGTACATAGAGCGTGACGGCACTGAG
                  ************************************************************

HsCD00038133      TCCTACCTCACCGTGAGTTCCCATCCCAACTCCTTGATGAAGAAGATCACCCTCCTTAAA
NM_005030.3       TCCTACCTCACCGTGAGTTCCCATCCCAACTCCTTGATGAAGAAGATCACCCTCCTTAAA
                  ************************************************************

HsCD00038133      TATTTCCGCAATTACATGAGCGAGCACTTGCTGAAGGCAGGTGCCAACATCACGCCGCGC
NM_005030.3       TATTTCCGCAATTACATGAGCGAGCACTTGCTGAAGGCAGGTGCCAACATCACGCCGCGC
                  ************************************************************

HsCD00038133      GAAGGTGATGAGCTCGCCCGGCTGCCCTACCTACGGACCTGGTTCCGCACCCGCAGCGCC
NM_005030.3       GAAGGTGATGAGCTCGCCCGGCTGCCCTACCTACGGACCTGGTTCCGCACCCGCAGCGCC
                  ************************************************************

HsCD00038133      ATCATCCTGCACCTCAGCAACGGCAGCGTGCAGATCAACTTCTTCCAGGATCACACCAAG
NM_005030.3       ATCATCCTGCACCTCAGCAACGGCAGCGTGCAGATCAACTTCTTCCAGGATCACACCAAG
                  ************************************************************

HsCD00038133      CTCATCTTGTGCCCACTGATGGCAGCCGTGACCTACATCGACGAGAAGCGGGACTTCCGC
NM_005030.3       CTCATCTTGTGCCCACTGATGGCAGCCGTGACCTACATCGACGAGAAGCGGGACTTCCGC
                  ************************************************************

HsCD00038133      ACATACCGCCTGAGTCTCCTGGAGGAGTACGGCTGCTGCAAGGAGCTGGCCAGCCGGCTC
NM_005030.3       ACATACCGCCTGAGTCTCCTGGAGGAGTACGGCTGCTGCAAGGAGCTGGCCAGCCGGCTC
                  ************************************************************

HsCD00038133      CGCTACGCCCGCACTATGGTGGACAAGCTGCTGAGCTCACGCTCGGCCAGCAACCGTCTC
NM_005030.3       CGCTACGCCCGCACTATGGTGGACAAGCTGCTGAGCTCACGCTCGGCCAGCAACCGTCTC
                  ************************************************************

HsCD00038133      AAGGCCTCCTTG
NM_005030.3       AAGGCCTCCTAA
                  **********:.

Pathways

NCI : ATR signaling pathway
NCI : FOXM1 transcription factor network
NCI : FoxO family signaling
NCI : PLK1 signaling events
NCI : Polo-like kinase signaling events in the cell cycle
NCI : Validated transcriptional targets of TAp63 isoforms
NCI : p73 transcription factor network
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of NIMA Kinases NEK9, NEK6, NEK7
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Centrosome maturation
Reactome : Condensation of Prophase Chromosomes
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : G2/M Transition
Reactome : Golgi Cisternae Pericentriolar Stack Reorganization
Reactome : Loss of Nlp from mitotic centrosomes
Reactome : Loss of proteins required for interphase microtubule organizationÿ from the centrosome
Reactome : M Phase
Reactome : Mitotic Anaphase
Reactome : Mitotic G2-G2/M phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Metaphase/Anaphase Transition
Reactome : Mitotic Prometaphase
Reactome : Mitotic Prophase
Reactome : Mitotic Telophase/Cytokinesis
Reactome : Nuclear Envelope Breakdown
Reactome : Phosphorylation of Emi1
Reactome : Phosphorylation of the APC/C
Reactome : Polo-like kinase mediated events
Reactome : Recruitment of mitotic centrosome proteins and complexes
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Regulation of mitotic cell cycle
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : Separation of Sister Chromatids
WikiPathway : Cell cycle
WikiPathway : Epithelium TarBase
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TNF alpha Signaling Pathway

Clone

Cloning Information : 136215
HIP Master Clone ID : 87374
Original Clone ID : FLH136215.01L

Organism


TAX_ID : 9606
Species Specific ID: 5347

Genome

Chromosome : 16
Map Location : 16p12.2
Ensembl : ENSG00000166851

Reagents

Labome : Plk1-antibody