DNASU Plasmid Repository • 480.965.5697 | Email

AKT1 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AKT1
Gene Name:  v-akt murine thymoma viral oncogene homolog 1
Sequence             
Original Clone ID: FLH136235.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038153

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1443nts         Open reading frame : 1 to 1443
Reference Sequence Alignment

ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAG
ACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTGGCTACAAGGAG
CGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGC
CAGCTGATGAAGACGGAGCGGCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGG
ACCACTGTCATCGAACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACA
ACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTC
CGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAG
CCCAAGCACCGCGTGACCATGAACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACT
TTCGGCAAGGTGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATC
CTCAAGAAGGAAGTCATCGTGGCCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGC
GTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCCTGAAGTACTCTTTCCAGACCCAC
GACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCC
CGGGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCC
CTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTC
ATGCTGGACAAGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATC
AAGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTG
CTGGAGGACAATGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTAC
GAGATGATGTGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGCTC
ATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTT
TCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAG
GAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAG
CTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAG
GAGTTCACGGCCCAGATGATCACCATCACACCACCTGACCAAGATGACAGCATGGAGTGT
GTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCC
TTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1727
Start on reference sequence 285
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : AKT1
Symbol Nomenclature : AKT1
SYNONYM : AKT; CWS6; PKB; PKB-ALPHA; PRKBA; RAC; RAC-ALPHA
Designation : PKB alpha|RAC-PK-alpha|RAC-alpha serine/threonine-protein kinase|protein kinase B alpha|proto-oncogene c-Akt|rac protein kinase alpha
Full Nomenclature : v-akt murine thymoma viral oncogene homolog 1
GENEID : 207
HGNC : 391
MIM : 164730
Vega : OTTHUMG00000170795
Target GenBank: BC000479

 

Reference Sequence Alignment

  

HsCD00038153        ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAG
NM_001014432.1      ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAG
NM_001014431.1      ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAG
XM_005267401.1      ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAG
NM_005163.2         ATGAGCGACGTGGCTATTGTGAAGGAGGGTTGGCTGCACAAACGAGGGGAGTACATCAAG
                    ************************************************************

HsCD00038153        ACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTGGCTACAAGGAG
NM_001014432.1      ACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTGGCTACAAGGAG
NM_001014431.1      ACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTGGCTACAAGGAG
XM_005267401.1      ACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTGGCTACAAGGAG
NM_005163.2         ACCTGGCGGCCACGCTACTTCCTCCTCAAGAATGATGGCACCTTCATTGGCTACAAGGAG
                    ************************************************************

HsCD00038153        CGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGC
NM_001014432.1      CGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGC
NM_001014431.1      CGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGC
XM_005267401.1      CGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGC
NM_005163.2         CGGCCGCAGGATGTGGACCAACGTGAGGCTCCCCTCAACAACTTCTCTGTGGCGCAGTGC
                    ************************************************************

HsCD00038153        CAGCTGATGAAGACGGAGCGGCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGG
NM_001014432.1      CAGCTGATGAAGACGGAGCGGCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGG
NM_001014431.1      CAGCTGATGAAGACGGAGCGGCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGG
XM_005267401.1      CAGCTGATGAAGACGGAGCGGCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGG
NM_005163.2         CAGCTGATGAAGACGGAGCGGCCCCGGCCCAACACCTTCATCATCCGCTGCCTGCAGTGG
                    ************************************************************

HsCD00038153        ACCACTGTCATCGAACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACA
NM_001014432.1      ACCACTGTCATCGAACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACA
NM_001014431.1      ACCACTGTCATCGAACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACA
XM_005267401.1      ACCACTGTCATCGAACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACA
NM_005163.2         ACCACTGTCATCGAACGCACCTTCCATGTGGAGACTCCTGAGGAGCGGGAGGAGTGGACA
                    ************************************************************

HsCD00038153        ACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTC
NM_001014432.1      ACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTC
NM_001014431.1      ACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTC
XM_005267401.1      ACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTC
NM_005163.2         ACCGCCATCCAGACTGTGGCTGACGGCCTCAAGAAGCAGGAGGAGGAGGAGATGGACTTC
                    ************************************************************

HsCD00038153        CGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAG
NM_001014432.1      CGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAG
NM_001014431.1      CGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAG
XM_005267401.1      CGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAG
NM_005163.2         CGGTCGGGCTCACCCAGTGACAACTCAGGGGCTGAAGAGATGGAGGTGTCCCTGGCCAAG
                    ************************************************************

HsCD00038153        CCCAAGCACCGCGTGACCATGAACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACT
NM_001014432.1      CCCAAGCACCGCGTGACCATGAACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACT
NM_001014431.1      CCCAAGCACCGCGTGACCATGAACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACT
XM_005267401.1      CCCAAGCACCGCGTGACCATGAACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACT
NM_005163.2         CCCAAGCACCGCGTGACCATGAACGAGTTTGAGTACCTGAAGCTGCTGGGCAAGGGCACT
                    ************************************************************

HsCD00038153        TTCGGCAAGGTGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATC
NM_001014432.1      TTCGGCAAGGTGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATC
NM_001014431.1      TTCGGCAAGGTGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATC
XM_005267401.1      TTCGGCAAGGTGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATC
NM_005163.2         TTCGGCAAGGTGATCCTGGTGAAGGAGAAGGCCACAGGCCGCTACTACGCCATGAAGATC
                    ************************************************************

HsCD00038153        CTCAAGAAGGAAGTCATCGTGGCCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGC
NM_001014432.1      CTCAAGAAGGAAGTCATCGTGGCCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGC
NM_001014431.1      CTCAAGAAGGAAGTCATCGTGGCCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGC
XM_005267401.1      CTCAAGAAGGAAGTCATCGTGGCCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGC
NM_005163.2         CTCAAGAAGGAAGTCATCGTGGCCAAGGACGAGGTGGCCCACACACTCACCGAGAACCGC
                    ************************************************************

HsCD00038153        GTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCCTGAAGTACTCTTTCCAGACCCAC
NM_001014432.1      GTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCCTGAAGTACTCTTTCCAGACCCAC
NM_001014431.1      GTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCCTGAAGTACTCTTTCCAGACCCAC
XM_005267401.1      GTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCCTGAAGTACTCTTTCCAGACCCAC
NM_005163.2         GTCCTGCAGAACTCCAGGCACCCCTTCCTCACAGCCCTGAAGTACTCTTTCCAGACCCAC
                    ************************************************************

HsCD00038153        GACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCC
NM_001014432.1      GACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCC
NM_001014431.1      GACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCC
XM_005267401.1      GACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCC
NM_005163.2         GACCGCCTCTGCTTTGTCATGGAGTACGCCAACGGGGGCGAGCTGTTCTTCCACCTGTCC
                    ************************************************************

HsCD00038153        CGGGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCC
NM_001014432.1      CGGGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCC
NM_001014431.1      CGGGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCC
XM_005267401.1      CGGGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCC
NM_005163.2         CGGGAGCGTGTGTTCTCCGAGGACCGGGCCCGCTTCTATGGCGCTGAGATTGTGTCAGCC
                    ************************************************************

HsCD00038153        CTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTC
NM_001014432.1      CTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTC
NM_001014431.1      CTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTC
XM_005267401.1      CTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTC
NM_005163.2         CTGGACTACCTGCACTCGGAGAAGAACGTGGTGTACCGGGACCTCAAGCTGGAGAACCTC
                    ************************************************************

HsCD00038153        ATGCTGGACAAGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATC
NM_001014432.1      ATGCTGGACAAGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATC
NM_001014431.1      ATGCTGGACAAGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATC
XM_005267401.1      ATGCTGGACAAGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATC
NM_005163.2         ATGCTGGACAAGGACGGGCACATTAAGATCACAGACTTCGGGCTGTGCAAGGAGGGGATC
                    ************************************************************

HsCD00038153        AAGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTG
NM_001014432.1      AAGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTG
NM_001014431.1      AAGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTG
XM_005267401.1      AAGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTG
NM_005163.2         AAGGACGGTGCCACCATGAAGACCTTTTGCGGCACACCTGAGTACCTGGCCCCCGAGGTG
                    ************************************************************

HsCD00038153        CTGGAGGACAATGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTAC
NM_001014432.1      CTGGAGGACAATGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTAC
NM_001014431.1      CTGGAGGACAATGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTAC
XM_005267401.1      CTGGAGGACAATGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTAC
NM_005163.2         CTGGAGGACAATGACTACGGCCGTGCAGTGGACTGGTGGGGGCTGGGCGTGGTCATGTAC
                    ************************************************************

HsCD00038153        GAGATGATGTGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGCTC
NM_001014432.1      GAGATGATGTGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGCTC
NM_001014431.1      GAGATGATGTGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGCTC
XM_005267401.1      GAGATGATGTGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGCTC
NM_005163.2         GAGATGATGTGCGGTCGCCTGCCCTTCTACAACCAGGACCATGAGAAGCTTTTTGAGCTC
                    ************************************************************

HsCD00038153        ATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTT
NM_001014432.1      ATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTT
NM_001014431.1      ATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTT
XM_005267401.1      ATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTT
NM_005163.2         ATCCTCATGGAGGAGATCCGCTTCCCGCGCACGCTTGGTCCCGAGGCCAAGTCCTTGCTT
                    ************************************************************

HsCD00038153        TCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAG
NM_001014432.1      TCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAG
NM_001014431.1      TCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAG
XM_005267401.1      TCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAG
NM_005163.2         TCAGGGCTGCTCAAGAAGGACCCCAAGCAGAGGCTTGGCGGGGGCTCCGAGGACGCCAAG
                    ************************************************************

HsCD00038153        GAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAG
NM_001014432.1      GAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAG
NM_001014431.1      GAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAG
XM_005267401.1      GAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAG
NM_005163.2         GAGATCATGCAGCATCGCTTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAG
                    ************************************************************

HsCD00038153        CTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAG
NM_001014432.1      CTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAG
NM_001014431.1      CTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAG
XM_005267401.1      CTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAG
NM_005163.2         CTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATGAG
                    ************************************************************

HsCD00038153        GAGTTCACGGCCCAGATGATCACCATCACACCACCTGACCAAGATGACAGCATGGAGTGT
NM_001014432.1      GAGTTCACGGCCCAGATGATCACCATCACACCACCTGACCAAGATGACAGCATGGAGTGT
NM_001014431.1      GAGTTCACGGCCCAGATGATCACCATCACACCACCTGACCAAGATGACAGCATGGAGTGT
XM_005267401.1      GAGTTCACGGCCCAGATGATCACCATCACACCACCTGACCAAGATGACAGCATGGAGTGT
NM_005163.2         GAGTTCACGGCCCAGATGATCACCATCACACCACCTGACCAAGATGACAGCATGGAGTGT
                    ************************************************************

HsCD00038153        GTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCC
NM_001014432.1      GTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCC
NM_001014431.1      GTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCC
XM_005267401.1      GTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCC
NM_005163.2         GTGGACAGCGAGCGCAGGCCCCACTTCCCCCAGTTCTCCTACTCGGCCAGCGGCACGGCC
                    ************************************************************

HsCD00038153        TTG
NM_001014432.1      TGA
NM_001014431.1      TGA
XM_005267401.1      TGA
NM_005163.2         TGA
                    * .

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Aurora A signaling
NCI : BCR signaling pathway
NCI : CD40/CD40L signaling
NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Caspase Cascade in Apoptosis
NCI : Ceramide signaling pathway
NCI : Class I PI3K signaling events mediated by Akt
NCI : Coregulation of Androgen receptor activity
NCI : E-cadherin signaling in keratinocytes
NCI : E-cadherin signaling in the nascent adherens junction
NCI : Endothelins
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : FAS (CD95) signaling pathway
NCI : FGF signaling pathway
NCI : FOXA2 and FOXA3 transcription factor networks
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : FoxO family signaling
NCI : Glucocorticoid receptor regulatory network
NCI : HIF-1-alpha transcription factor network
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : IFN-gamma pathway
NCI : IGF1 pathway
NCI : IL2 signaling events mediated by PI3K
NCI : IL4-mediated signaling events
NCI : IL6-mediated signaling events
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : Insulin Pathway
NCI : Insulin-mediated glucose transport
NCI : Integrin-linked kinase signaling
NCI : Integrins in angiogenesis
NCI : LPA receptor mediated events
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Nongenotropic Androgen signaling
NCI : Plasma membrane estrogen receptor signaling
NCI : Reelin signaling pathway
NCI : Regulation of Telomerase
NCI : Regulation of nuclear SMAD2/3 signaling
NCI : Retinoic acid receptors-mediated signaling
NCI : S1P3 pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by the Hedgehog family
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : Thromboxane A2 receptor signaling
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : VEGFR1 specific signals
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : a6b1 and a6b4 Integrin signaling
NCI : amb2 Integrin signaling
NCI : mTOR signaling pathway
NCI : p53 pathway
NCI : p75(NTR)-mediated signaling
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Huntington disease
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Interleukin signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway by glucose deprivation
Panther : p53 pathway feedback loops 2
Reactome : AKT phosphorylates targets in the cytosol
Reactome : AKT phosphorylates targets in the nucleus
Reactome : AKT-mediated inactivation of FOXO1A
Reactome : Activation of BAD and translocation to mitochondria
Reactome : Activation of BH3-only proteins
Reactome : Adaptive Immune System
Reactome : Apoptosis
Reactome : Butyrate Response Factor 1 (BRF1) destabilizes mRNA
Reactome : CD28 co-stimulation
Reactome : CD28 dependent PI3K/Akt signaling
Reactome : CTLA4 inhibitory signaling
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downregulation of ERBB2:ERBB3 signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : G beta:gamma signalling through PI3Kgamma
Reactome : G-protein beta:gamma signalling
Reactome : GAB1 signalosome
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Gene Expression
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Integrin alphaIIb beta3 signaling
Reactome : Intrinsic Pathway for Apoptosis
Reactome : KSRP destabilizes mRNA
Reactome : Membrane Trafficking
Reactome : Metabolism
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Metabolism of nitric oxide
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of the PI3K/AKT network
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of beta-cell development
Reactome : Regulation of gene expression in beta cells
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Wnt
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : TCF dependent signaling in response to WNT
Reactome : Tetrahydrobiopterin (BH4) synthesis, recycling, salvage and regulation
Reactome : Translocation of GLUT4 to the plasma membrane
Reactome : deactivation of the beta-catenin transactivating complex
Reactome : eNOS activation
Reactome : eNOS activation and regulation
WikiPathway : AMPK signaling
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Angiogenesis
WikiPathway : Apoptosis
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : EPO Receptor Signaling
WikiPathway : Endochondral Ossification
WikiPathway : Estrogen signaling pathway
WikiPathway : FSH signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-1 signaling pathway
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Notch Signaling Pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Signal Transduction of S1P Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : TFs Regulate miRNAs related to cardiac hypertrophy
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TOR signaling
WikiPathway : TSH signaling pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : angiogenesis overview

Clone

Cloning Information : 136235
HIP Master Clone ID : 87394
Original Clone ID : FLH136235.01L

Organism


TAX_ID : 9606
Species Specific ID: 207

Genome

Chromosome : 14
Map Location : 14q32.32
Ensembl : ENSG00000142208

Reagents

Labome : Akt-antibody