DNASU Plasmid Repository • 480.965.5697 | Email

PIK3CG (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3CG
Gene Name:  phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
Sequence             
Original Clone ID: FLH178135.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038199

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3309nts        
Open reading frame : 1 to 3309
Reference Sequence Alignment

ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
GAAGAGTGGCCGCTGGTGGACGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGTGCCCTTGCCAGATTT
CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
TCAGCCTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 3362
Start on reference sequence 54
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3CG
Symbol Nomenclature : PIK3CG
SYNONYM : PI3CG; PI3K; PI3Kgamma; PIK3; p110gamma; p120-PI3K
Designation : 1-phosphatidylinositol 3-kinase|PI3-kinase subunit gamma|phosphatidylinositol 3 kinase gamma, p110 gamma|phosphatidylinositol 3-kinase catalytic 110-kD gamma|phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit gamma isoform|phosphatidylinositol-4,5-bisphosphate 3-kinase 110 kDa catalytic subunit gamma|phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma isoform|phosphoinositide-3-kinase gamma catalytic subunit|ptdIns-3-kinase subunit gamma|ptdIns-3-kinase subunit p110-gamma|serine/threonine protein kinase PIK3CG
Full Nomenclature : phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma
GENEID : 5294
HGNC : 8978
MIM : 601232
Vega : OTTHUMG00000157641
Target GenBank: BC035683

 

Reference Sequence Alignment

  

HsCD00038199        ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
NM_001282426.1      ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
NM_002649.3         ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
XM_005250443.1      ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
NM_001282427.1      ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGC
                    ************************************************************

HsCD00038199        CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
NM_001282426.1      CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
NM_002649.3         CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
XM_005250443.1      CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
NM_001282427.1      CGGAGGATGAAGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATC
                    ************************************************************

HsCD00038199        GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
NM_001282426.1      GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
NM_002649.3         GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
XM_005250443.1      GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
NM_001282427.1      GAGTTCGTGCTGCCCACCAGCCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCAC
                    ************************************************************

HsCD00038199        GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
NM_001282426.1      GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
NM_002649.3         GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
XM_005250443.1      GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
NM_001282427.1      GTGGCCGGCCACGGCAACGTGGAGCAGATGAAGGCCCAGGTGTGGCTGCGAGCGCTGGAG
                    ************************************************************

HsCD00038199        ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
NM_001282426.1      ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
NM_002649.3         ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
XM_005250443.1      ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
NM_001282427.1      ACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGCATCACTTCCTCCTGCTCTAT
                    ************************************************************

HsCD00038199        CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
NM_001282426.1      CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
NM_002649.3         CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
XM_005250443.1      CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
NM_001282427.1      CAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCAGACTCTGGAC
                    ************************************************************

HsCD00038199        TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
NM_001282426.1      TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
NM_002649.3         TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
XM_005250443.1      TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
NM_001282427.1      TGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
                    ************************************************************

HsCD00038199        CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
NM_001282426.1      CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
NM_002649.3         CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
XM_005250443.1      CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
NM_001282427.1      CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTAT
                    ************************************************************

HsCD00038199        GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
NM_001282426.1      GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
NM_002649.3         GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
XM_005250443.1      GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
NM_001282427.1      GACGTCACTGACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTG
                    ************************************************************

HsCD00038199        GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
NM_001282426.1      GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
NM_002649.3         GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
XM_005250443.1      GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
NM_001282427.1      GTGACCCCGCGCATGGCGGAGGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCG
                    ************************************************************

HsCD00038199        TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
NM_001282426.1      TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
NM_002649.3         TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
XM_005250443.1      TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
NM_001282427.1      TGGGTGACGTCCAAGCCCCTCCCGGAGTACCTGTGGAAGAAGATTGCCAACAACTGCATC
                    ************************************************************

HsCD00038199        TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
NM_001282426.1      TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
NM_002649.3         TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
XM_005250443.1      TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
NM_001282427.1      TTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTAAGGTCTCACCCGACGACACC
                    ************************************************************

HsCD00038199        CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
NM_001282426.1      CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
NM_002649.3         CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
XM_005250443.1      CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
NM_001282427.1      CCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATCTCTGATGGAT
                    ************************************************************

HsCD00038199        ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
NM_001282426.1      ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
NM_002649.3         ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
XM_005250443.1      ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
NM_001282427.1      ATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
                    ************************************************************

HsCD00038199        CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
NM_001282426.1      CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
NM_002649.3         CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
XM_005250443.1      CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
NM_001282427.1      CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGA
                    ************************************************************

HsCD00038199        GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
NM_001282426.1      GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
NM_002649.3         GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
XM_005250443.1      GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
NM_001282427.1      GAAGAGATTCACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAG
                    ************************************************************

HsCD00038199        GAAGAGTGGCCGCTGGTGGACGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
NM_001282426.1      GAAGAGTGGCCACTGGTGGATGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
NM_002649.3         GAAGAGTGGCCACTGGTGGATGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
XM_005250443.1      GAAGAGTGGCCACTGGTGGATGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
NM_001282427.1      GAAGAGTGGCCACTGGTGGATGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACC
                    ***********.******** ***************************************

HsCD00038199        ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
NM_001282426.1      ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
NM_002649.3         ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
XM_005250443.1      ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
NM_001282427.1      ATCCACGGCAAGGACCACGAGAGTGTGTTCACCGTGTCCCTGTGGGACTGCGACCGCAAG
                    ************************************************************

HsCD00038199        TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
NM_001282426.1      TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
NM_002649.3         TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
XM_005250443.1      TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
NM_001282427.1      TTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGCCTCGGAACACCGACCTCACA
                    ************************************************************

HsCD00038199        GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
NM_001282426.1      GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
NM_002649.3         GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
XM_005250443.1      GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
NM_001282427.1      GTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAGGAGAACCAGC
                    ************************************************************

HsCD00038199        CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
NM_001282426.1      CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
NM_002649.3         CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
XM_005250443.1      CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
NM_001282427.1      CCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
                    ************************************************************

HsCD00038199        AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
NM_001282426.1      AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
NM_002649.3         AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
XM_005250443.1      AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
NM_001282427.1      AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCA
                    ************************************************************

HsCD00038199        CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
NM_001282426.1      CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
NM_002649.3         CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
XM_005250443.1      CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
NM_001282427.1      CTGTCCAGCAAGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTT
                    ************************************************************

HsCD00038199        CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
NM_001282426.1      CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
NM_002649.3         CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
XM_005250443.1      CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
NM_001282427.1      CTCTATTATGTGAACCTGCTGCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATAC
                    ************************************************************

HsCD00038199        GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
NM_001282426.1      GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
NM_002649.3         GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
XM_005250443.1      GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
NM_001282427.1      GTCCTCCACATGTGGCAGATATCTGGGAAGGGAGAAGACCAAGGAAGCTTCAATGCTGAC
                    ************************************************************

HsCD00038199        AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
NM_001282426.1      AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
NM_002649.3         AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
XM_005250443.1      AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
NM_001282427.1      AAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAATGTCCATCTCCATTCTTCTG
                    ************************************************************

HsCD00038199        GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
NM_001282426.1      GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
NM_002649.3         GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
XM_005250443.1      GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
NM_001282427.1      GACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGACCCGGAAGGG
                    ************************************************************

HsCD00038199        GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
NM_001282426.1      GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
NM_002649.3         GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
XM_005250443.1      GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
NM_001282427.1      GACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
                    ************************************************************

HsCD00038199        ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
NM_001282426.1      ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
NM_002649.3         ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
XM_005250443.1      ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
NM_001282427.1      ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATAC
                    ************************************************************

HsCD00038199        GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
NM_001282426.1      GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
NM_002649.3         GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
XM_005250443.1      GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
NM_001282427.1      GAAAGCCTTAAGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAG
                    ************************************************************

HsCD00038199        CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
NM_001282426.1      CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
NM_002649.3         CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
XM_005250443.1      CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
NM_001282427.1      CAAGAAATTGTGGCCAAAACATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGT
                    ************************************************************

HsCD00038199        GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
NM_001282426.1      GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
NM_002649.3         GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
XM_005250443.1      GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
NM_001282427.1      GCTTTGGATGTTGGGTTAACAATGCAGCTCCTGGACTGCAACTTCTCAGATGAAAATGTA
                    ************************************************************

HsCD00038199        AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
NM_001282426.1      AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
NM_002649.3         AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
XM_005250443.1      AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
NM_001282427.1      AGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACGATGATGTTCTGCATTACCTT
                    ************************************************************

HsCD00038199        CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGTGCCCTTGCCAGATTT
NM_001282426.1      CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCTTGCCAGATTT
NM_002649.3         CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCTTGCCAGATTT
XM_005250443.1      CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCTTGCCAGATTT
NM_001282427.1      CTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCTTGCCAGATTT
                    ******************************************** ***************

HsCD00038199        CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
NM_001282426.1      CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
NM_002649.3         CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
XM_005250443.1      CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
NM_001282427.1      CTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
                    ************************************************************

HsCD00038199        AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
NM_001282426.1      AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
NM_002649.3         AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
XM_005250443.1      AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
NM_001282427.1      AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTAT
                    ************************************************************

HsCD00038199        CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
NM_001282426.1      CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
NM_002649.3         CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
XM_005250443.1      CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
NM_001282427.1      CTGAGGGGCTGTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAG
                    ************************************************************

HsCD00038199        ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
NM_001282426.1      ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
NM_002649.3         ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
XM_005250443.1      ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
NM_001282427.1      ATGTTACAAAAAGTCACCCTTGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGT
                    ************************************************************

HsCD00038199        TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
NM_001282426.1      TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
NM_002649.3         TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
XM_005250443.1      TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
NM_001282427.1      TCCCAAGTTATTTCACAACTTAAACAAAAGCTTGAAAACCTGCAGAATTCTCAACTCCCC
                    ************************************************************

HsCD00038199        GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
NM_001282426.1      GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
NM_002649.3         GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
XM_005250443.1      GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
NM_001282427.1      GAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAGGAGCGCTGGCAATTGAAAAA
                    ************************************************************

HsCD00038199        TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
NM_001282426.1      TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
NM_002649.3         TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
XM_005250443.1      TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
NM_001282427.1      TGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATGTGCCGATCCT
                    ************************************************************

HsCD00038199        ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
NM_001282426.1      ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
NM_002649.3         ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
XM_005250443.1      ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
NM_001282427.1      ACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
                    ************************************************************

HsCD00038199        GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
NM_001282426.1      GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
NM_002649.3         GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
XM_005250443.1      GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
NM_001282427.1      GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTG
                    ************************************************************

HsCD00038199        GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
NM_001282426.1      GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
NM_002649.3         GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
XM_005250443.1      GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
NM_001282427.1      GATCTATGCCTCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAG
                    ************************************************************

HsCD00038199        ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
NM_001282426.1      ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
NM_002649.3         ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
XM_005250443.1      ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
NM_001282427.1      ATTGTGAAAGACGCCACGACAATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGA
                    ************************************************************

HsCD00038199        GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
NM_001282426.1      GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
NM_002649.3         GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
XM_005250443.1      GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
NM_001282427.1      GCATTTAAAGATGAAGTCCTGAATCACTGGCTCAAAGAAAAATCCCCTACTGAAGAAAAG
                    ************************************************************

HsCD00038199        TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
NM_001282426.1      TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
NM_002649.3         TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
XM_005250443.1      TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
NM_001282427.1      TTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAGGCTACTGTGTGGCAACCTTT
                    ************************************************************

HsCD00038199        GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
NM_001282426.1      GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
NM_002649.3         GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
XM_005250443.1      GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
NM_001282427.1      GTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGACAGGAAACCTA
                    ************************************************************

HsCD00038199        TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
NM_001282426.1      TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
NM_002649.3         TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
XM_005250443.1      TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
NM_001282427.1      TTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
                    ************************************************************

HsCD00038199        GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
NM_001282426.1      GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
NM_002649.3         GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
XM_005250443.1      GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
NM_001282427.1      GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAG
                    ************************************************************

HsCD00038199        AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
NM_001282426.1      AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
NM_002649.3         AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
XM_005250443.1      AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
NM_001282427.1      AAGACAAGCCCACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTT
                    ************************************************************

HsCD00038199        CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
NM_001282426.1      CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
NM_002649.3         CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
XM_005250443.1      CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
NM_001282427.1      CGTCATCACACAAACCTACTGATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCC
                    ************************************************************

HsCD00038199        CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
NM_001282426.1      CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
NM_002649.3         CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
XM_005250443.1      CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
NM_001282427.1      CAGTTAACAAGCAAAGAAGACATTGAATATATCCGGGATGCCCTCACAGTGGGGAAAAAT
                    ************************************************************

HsCD00038199        GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
NM_001282426.1      GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
NM_002649.3         GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
XM_005250443.1      GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
NM_001282427.1      GAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAGTTTGCAGAGACAAAGGATGG
                    ************************************************************

HsCD00038199        ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
NM_001282426.1      ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
NM_002649.3         ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
XM_005250443.1      ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
NM_001282427.1      ACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGGAGAGAAACAT
                    ************************************************************

HsCD00038199        TCAGCCTTG
NM_001282426.1      TCAGCCTAA
NM_002649.3         TCAGCCTAA
XM_005250443.1      TCAGCCTAA
NM_001282427.1      TCAGCCTAA
                    *******:.

Pathways

NCI : Class I PI3K signaling events
NCI : Class IB PI3K non-lipid kinase events
NCI : CXCR4-mediated signaling events
NCI : EPHA forward signaling
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : PDGFR-beta signaling pathway
NCI : Thromboxane A2 receptor signaling
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : Axon guidance mediated by netrin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Panther : PDGF signaling pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Reactome : G beta:gamma signalling through PI3Kgamma
Reactome : G-protein beta:gamma signalling
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Phospholipid metabolism
Reactome : PI Metabolism
Reactome : Platelet activation, signaling and aggregation
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Synthesis of PIPs at the plasma membrane
WikiPathway : AMPK signaling
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EPO Receptor Signaling
WikiPathway : Focal Adhesion
WikiPathway : IL-5 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 178135
HIP Master Clone ID : 134966
Original Clone ID : FLH178135.01L

Organism


TAX_ID : 9606
Species Specific ID: 5294

Genome

Chromosome : 7
Map Location : 7q22.3
Ensembl : ENSG00000105851

Reagents

Labome : PIK3CG-antibody