DNASU Plasmid Repository • 480.965.5697 | Email

CAMK2G (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CAMK2G
Gene Name:  calcium/calmodulin-dependent protein kinase II gamma
Sequence             
Original Clone ID: FLH178145.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038207

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1584nts         Open reading frame : 1 to 1584
Reference Sequence Alignment

ATGGCCACCACCGCCACCTGCACACGTTTCACCGACGACTACCAGCTCTTCGAGGAGCTT
GGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGAAGAAAACCCCCACGCAGGAGTAC
GCAGCAAAAATCATCAATACCAAGAAATTGTCTGCCCGGGATCACCAGAAACTAGAACGT
GAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATGACAGTATT
TCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGCTGTTTGAA
GACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATACATCAGATT
CTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGAAGCCTGAG
AACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATTTTGGCCTA
GCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCCCAGGTTAC
TTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCTGGGCCTGC
GGGGTCATCCTGTATATCCTCCTGGTGGGCTATCCTCCCTTCTGGGATGAGGATCAGCAC
AAGCTGTATCAGCAGATCAAGGCTGGAGCCTATGATTTCCCATCACCAGAATGGGACACG
GTAACTCCTGAAGCCAAGAACTTGATCAACCAGATGCTGACCATAAACCCAGCAAAGCGC
ATCACGGCTGACCAGGCTCTCAAGCACCCGTGGGTCTGTCAACGATCCACGGTGGCATCC
ATGATGCATCGTCAGGAGACTGTGGAGTGTTTGCGCAAGTTCAATGCCCGGAGAAAACTG
AAGGGTGCCATCCTCACGACCATGCTTGTCTCCAGGAACTTCTCAGTTGGCAGGCAGAGC
TCCGCCCCCGCCTCGCCTGCCGCGAGCGCCGCCGGCCTGGCCGGGCAAGCTGCCAAAAGC
CTATTGAACAAGAAGTCGGATGGCGGTGTCAAGAAAAGGAAGTCGAGTTCCAGCGTGCAC
CTAATGGAGCCACAAACCACTGTGGTACACAACGCTACAGATGGGATCAAGGGCTCCACA
GAGAGCTGCAACACCACCACAGAAGATGAGGACCTCAAAGTGCGAAAACAGGAGATCATT
AAGATTACAGAACAGCTGATTGAAGCCATCAACAATGGGGACTTTGAGGCCTACACGAAG
ATTTGTGATCCAGGCCTCACTTCCTTTGAGCCTGAGGCCCTTGGTAACCTCGTGGAGGGG
ATGGATTTCCATAAGTTTTACTTTGAGAATCTCCTGTCAAAGAACAGCAAGCCTATCCAT
ACCACCATCCTAAACCCACACGTCCACGTGATTGGGGAGGACGCAGCGTGCATCGCCTAC
ATCCGCCTCACCCAGTACATCGACGGGCAGGGTCGGCCTCGCACCAGCCAGTCAGAAGAG
ACCCGGGTCTGGCACCGTCGGGATGGCAAGTGGCTCAATGTCCACTATCACTGCTCAGGG
GCCCCTGCCGCACCGCTGCAGTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1705
Start on reference sequence 122
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CAMK2G
Symbol Nomenclature : CAMK2G
SYNONYM : CAMK; CAMK-II; CAMKG
Designation : caMK-II subunit gamma|calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma|calcium/calmodulin-dependent protein kinase type II subunit gamma
Full Nomenclature : calcium/calmodulin-dependent protein kinase II gamma
GENEID : 818
Locus Tag : RP11-574K11.6
HGNC : 1463
MIM : 602123
Vega : OTTHUMG00000018492
Target GenBank: BC034044

 

Reference Sequence Alignment

  

HsCD00038207        ATGGCCACCACCGCCACCTGCACACGTTTCACCGACGACTACCAGCTCTTCGAGGAGCTT
NM_001220.4         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
XM_005270205.1      ATGGCCACCACCGCCACCTGCACCCGTTTCACCGACGACTACCAGCTCTTCGAGGAGCTT
XM_005270199.1      ATGGCCACCACCGCCACCTGCACCCGTTTCACCGACGACTACCAGCTCTTCGAGGAGCTT
NM_172173.2         ATGGCCACCACCGCCACCTGCACCCGTTTCACCGACGACTACCAGCTCTTCGAGGAGCTT
NM_001204492.1      ATGGCCACCACCGCCACCTGCACCCGTTTCACCGACGACTACCAGCTCTTCGAGGAGCTT
XM_005270197.1      ATGGCCACCACCGCCACCTGCACCCGTTTCACCGACGACTACCAGCTCTTCGAGGAGCTT
NM_001222.3         ATGGCCACCACCGCCACCTGCACCCGTTTCACCGACGACTACCAGCTCTTCGAGGAGCTT
NM_172169.2         ATGGCCACCACCGCCACCTGCACCCGTTTCACCGACGACTACCAGCTCTTCGAGGAGCTT
XM_005270203.1      ATGGCCACCACCGCCACCTGCACCCGTTTCACCGACGACTACCAGCTCTTCGAGGAGCTT
NM_172170.4         ATGGCCACCACCGCCACCTGCACCCGTTTCACCGACGACTACCAGCTCTTCGAGGAGCTT
                    *********** *  ********.** *********** **********:****** .**

HsCD00038207        GGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGAAGAAAACCCCCACGCAGGAGTAC
NM_001220.4         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
XM_005270205.1      GGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGAAGAAAACCTCCACGCAGGAGTAC
XM_005270199.1      GGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGAAGAAAACCTCCACGCAGGAGTAC
NM_172173.2         GGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGAAGAAAACCTCCACGCAGGAGTAC
NM_001204492.1      GGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGAAGAAAACCTCCACGCAGGAGTAC
XM_005270197.1      GGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGAAGAAAACCTCCACGCAGGAGTAC
NM_001222.3         GGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGAAGAAAACCTCCACGCAGGAGTAC
NM_172169.2         GGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGAAGAAAACCTCCACGCAGGAGTAC
XM_005270203.1      GGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGAAGAAAACCTCCACGCAGGAGTAC
NM_172170.4         GGCAAGGGTGCTTTCTCTGTGGTCCGCAGGTGTGTGAAGAAAACCTCCACGCAGGAGTAC
                    ******** *****************..* ***** ***.:.: * **.  ** ***** 

HsCD00038207        GCAGCAAAAATCATCAATACCAAGAAATTGTCTGCCCGGGATCACCAGAAACTAGAACGT
NM_001220.4         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
XM_005270205.1      GCAGCAAAAATCATCAATACCAAGAAGTTGTCTGCCCGGGATCACCAGAAACTAGAACGT
XM_005270199.1      GCAGCAAAAATCATCAATACCAAGAAGTTGTCTGCCCGGGATCACCAGAAACTAGAACGT
NM_172173.2         GCAGCAAAAATCATCAATACCAAGAAGTTGTCTGCCCGGGATCACCAGAAACTAGAACGT
NM_001204492.1      GCAGCAAAAATCATCAATACCAAGAAGTTGTCTGCCCGGGATCACCAGAAACTAGAACGT
XM_005270197.1      GCAGCAAAAATCATCAATACCAAGAAGTTGTCTGCCCGGGATCACCAGAAACTAGAACGT
NM_001222.3         GCAGCAAAAATCATCAATACCAAGAAGTTGTCTGCCCGGGATCACCAGAAACTAGAACGT
NM_172169.2         GCAGCAAAAATCATCAATACCAAGAAGTTGTCTGCCCGGGATCACCAGAAACTAGAACGT
XM_005270203.1      GCAGCAAAAATCATCAATACCAAGAAGTTGTCTGCCCGGGATCACCAGAAACTAGAACGT
NM_172170.4         GCAGCAAAAATCATCAATACCAAGAAGTTGTCTGCCCGGGATCACCAGAAACTAGAACGT
                    *****.**.******** ********. ****:***.*.***********.**.**..*:

HsCD00038207        GAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATGACAGTATT
NM_001220.4         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
XM_005270205.1      GAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATGACAGTATT
XM_005270199.1      GAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATGACAGTATT
NM_172173.2         GAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATGACAGTATT
NM_001204492.1      GAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATGACAGTATT
XM_005270197.1      GAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATGACAGTATT
NM_001222.3         GAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATGACAGTATT
NM_172169.2         GAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATGACAGTATT
XM_005270203.1      GAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATGACAGTATT
NM_172170.4         GAGGCTCGGATATGTCGACTTCTGAAACATCCAAACATCGTGCGCCTCCATGACAGTATT
                    ***********.** **.********.*** *.*********** ***** ***** ** 

HsCD00038207        TCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGCTGTTTGAA
NM_001220.4         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
XM_005270205.1      TCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGCTGTTTGAA
XM_005270199.1      TCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGCTGTTTGAA
NM_172173.2         TCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGCTGTTTGAA
NM_001204492.1      TCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGCTGTTTGAA
XM_005270197.1      TCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGCTGTTTGAA
NM_001222.3         TCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGCTGTTTGAA
NM_172169.2         TCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGCTGTTTGAA
XM_005270203.1      TCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGCTGTTTGAA
NM_172170.4         TCTGAAGAAGGGTTTCACTACCTCGTGTTTGACCTTGTTACCGGCGGGGAGCTGTTTGAA
                    ** **.**.** ** ******** ** ** ** ** ** ** ** ******** ******

HsCD00038207        GACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATACATCAGATT
NM_001220.4         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
XM_005270205.1      GACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATACATCAGATT
XM_005270199.1      GACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATACATCAGATT
NM_172173.2         GACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATACATCAGATT
NM_001204492.1      GACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATACATCAGATT
XM_005270197.1      GACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATACATCAGATT
NM_001222.3         GACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATACATCAGATT
NM_172169.2         GACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATACATCAGATT
XM_005270203.1      GACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATACATCAGATT
NM_172170.4         GACATTGTGGCCAGAGAGTACTACAGTGAAGCAGATGCCAGCCACTGTATACATCAGATT
                    *********** ************** **.**:******** ********.** ***** 

HsCD00038207        CTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGAAGCCTGAG
NM_001220.4         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
XM_005270205.1      CTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGAAGCCTGAG
XM_005270199.1      CTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGAAGCCTGAG
NM_172173.2         CTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGAAGCCTGAG
NM_001204492.1      CTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGAAGCCTGAG
XM_005270197.1      CTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGAAGCCTGAG
NM_001222.3         CTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGAAGCCTGAG
NM_172169.2         CTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGAAGCCTGAG
XM_005270203.1      CTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGAAGCCTGAG
NM_172170.4         CTGGAGAGTGTTAACCACATCCACCAGCATGACATCGTCCACAGGGACCTGAAGCCTGAG
                    ******.  ***.:*** :  *****..: *. .**********.***** ***** ***

HsCD00038207        AACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATTTTGGCCTA
NM_001220.4         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
XM_005270205.1      AACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATTTTGGCCTA
XM_005270199.1      AACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATTTTGGCCTA
NM_172173.2         AACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATTTTGGCCTA
NM_001204492.1      AACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATTTTGGCCTA
XM_005270197.1      AACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATTTTGGCCTA
NM_001222.3         AACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATTTTGGCCTA
NM_172169.2         AACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATTTTGGCCTA
XM_005270203.1      AACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATTTTGGCCTA
NM_172170.4         AACCTGCTGCTGGCGAGTAAATGCAAGGGTGCCGCCGTCAAGCTGGCTGATTTTGGCCTA
                    ******** ***** ** **.*****.** ** **.** ********:** ** ******

HsCD00038207        GCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCCCAGGTTAC
NM_001220.4         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
XM_005270205.1      GCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCCCAGGTTAC
XM_005270199.1      GCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCCCAGGTTAC
NM_172173.2         GCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCCCAGGTTAC
NM_001204492.1      GCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCCCAGGTTAC
XM_005270197.1      GCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCCCAGGTTAC
NM_001222.3         GCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCCCAGGTTAC
NM_172169.2         GCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCCCAGGTTAC
XM_005270203.1      GCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCCCAGGTTAC
NM_172170.4         GCCATCGAAGTACAGGGAGAGCAGCAGGCTTGGTTTGGTTTTGCTGGCACCCCAGGTTAC
                    ** *****.**.*****.** ********:*********** ********.***** ***

HsCD00038207        TTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCTGGGCCTGC
NM_001220.4         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
XM_005270205.1      TTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCTGGGCCTGC
XM_005270199.1      TTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCTGGGCCTGC
NM_172173.2         TTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCTGGGCCTGC
NM_001204492.1      TTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCTGGGCCTGC
XM_005270197.1      TTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCTGGGCCTGC
NM_001222.3         TTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCTGGGCCTGC
NM_172169.2         TTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCTGGGCCTGC
XM_005270203.1      TTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCTGGGCCTGC
NM_172170.4         TTGTCCCCTGAGGTCTTGAGGAAAGATCCCTATGGAAAACCTGTGGATATCTGGGCCTGC
                     ************** * .* *****  * *****.**.******** ********.** 

HsCD00038207        GGGGTCATCCTGTATATCCTCCTGGTGGGCTATCCTCCCTTCTGGGATGAGGATCAGCAC
NM_001220.4         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
XM_005270205.1      GGGGTCATCCTGTATATCCTCCTGGTGGGCTATCCTCCCTTCTGGGATGAGGATCAGCAC
XM_005270199.1      GGGGTCATCCTGTATATCCTCCTGGTGGGCTATCCTCCCTTCTGGGATGAGGATCAGCAC
NM_172173.2         GGGGTCATCCTGTATATCCTCCTGGTGGGCTATCCTCCCTTCTGGGATGAGGATCAGCAC
NM_001204492.1      GGGGTCATCCTGTATATCCTCCTGGTGGGCTATCCTCCCTTCTGGGATGAGGATCAGCAC
XM_005270197.1      GGGGTCATCCTGTATATCCTCCTGGTGGGCTATCCTCCCTTCTGGGATGAGGATCAGCAC
NM_001222.3         GGGGTCATCCTGTATATCCTCCTGGTGGGCTATCCTCCCTTCTGGGATGAGGATCAGCAC
NM_172169.2         GGGGTCATCCTGTATATCCTCCTGGTGGGCTATCCTCCCTTCTGGGATGAGGATCAGCAC
XM_005270203.1      GGGGTCATCCTGTATATCCTCCTGGTGGGCTATCCTCCCTTCTGGGATGAGGATCAGCAC
NM_172170.4         GGGGTCATCCTGTATATCCTCCTGGTGGGCTATCCTCCCTTCTGGGATGAGGATCAGCAC
                    ***** ******** ***** ** ******** **:*********** ***** ******

HsCD00038207        AAGCTGTATCAGCAGATCAAGGCTGGAGCCTATGATTTCCCATCACCAGAATGGGACACG
NM_001220.4         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
XM_005270205.1      AAGCTGTATCAGCAGATCAAGGCTGGAGCCTATGATTTCCCATCACCAGAATGGGACACG
XM_005270199.1      AAGCTGTATCAGCAGATCAAGGCTGGAGCCTATGATTTCCCATCACCAGAATGGGACACG
NM_172173.2         AAGCTGTATCAGCAGATCAAGGCTGGAGCCTATGATTTCCCATCACCAGAATGGGACACG
NM_001204492.1      AAGCTGTATCAGCAGATCAAGGCTGGAGCCTATGATTTCCCATCACCAGAATGGGACACG
XM_005270197.1      AAGCTGTATCAGCAGATCAAGGCTGGAGCCTATGATTTCCCATCACCAGAATGGGACACG
NM_001222.3         AAGCTGTATCAGCAGATCAAGGCTGGAGCCTATGATTTCCCATCACCAGAATGGGACACG
NM_172169.2         AAGCTGTATCAGCAGATCAAGGCTGGAGCCTATGATTTCCCATCACCAGAATGGGACACG
XM_005270203.1      AAGCTGTATCAGCAGATCAAGGCTGGAGCCTATGATTTCCCATCACCAGAATGGGACACG
NM_172170.4         AAGCTGTATCAGCAGATCAAGGCTGGAGCCTATGATTTCCCATCACCAGAATGGGACACG
                    ******** *****************:******** *****.**.**:**.******** 

HsCD00038207        GTAACTCCTGAAGCCAAGAACTTGATCAACCAGATGCTGACCATAAACCCAGCAAAGCGC
NM_001220.4         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
XM_005270205.1      GTAACTCCTGAAGCCAAGAACTTGATCAACCAGATGCTGACCATAAACCCAGCAAAGCGC
XM_005270199.1      GTAACTCCTGAAGCCAAGAACTTGATCAACCAGATGCTGACCATAAACCCAGCAAAGCGC
NM_172173.2         GTAACTCCTGAAGCCAAGAACTTGATCAACCAGATGCTGACCATAAACCCAGCAAAGCGC
NM_001204492.1      GTAACTCCTGAAGCCAAGAACTTGATCAACCAGATGCTGACCATAAACCCAGCAAAGCGC
XM_005270197.1      GTAACTCCTGAAGCCAAGAACTTGATCAACCAGATGCTGACCATAAACCCAGCAAAGCGC
NM_001222.3         GTAACTCCTGAAGCCAAGAACTTGATCAACCAGATGCTGACCATAAACCCAGCAAAGCGC
NM_172169.2         GTAACTCCTGAAGCCAAGAACTTGATCAACCAGATGCTGACCATAAACCCAGCAAAGCGC
XM_005270203.1      GTAACTCCTGAAGCCAAGAACTTGATCAACCAGATGCTGACCATAAACCCAGCAAAGCGC
NM_172170.4         GTAACTCCTGAAGCCAAGAACTTGATCAACCAGATGCTGACCATAAACCCAGCAAAGCGC
                    **.**************.*** * ********************.*****:**.******

HsCD00038207        ATCACGGCTGACCAGGCTCTCAAGCACCCGTGGGTCTGTCAACGATCCACGGTGGCATCC
NM_001220.4         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
XM_005270205.1      ATCACGGCTGACCAGGCTCTCAAGCACCCGTGGGTCTGTCAACGATCCACGGTGGCATCC
XM_005270199.1      ATCACGGCTGACCAGGCTCTCAAGCACCCGTGGGTCTGTCAACGATCCACGGTGGCATCC
NM_172173.2         ATCACGGCTGACCAGGCTCTCAAGCACCCGTGGGTCTGTCAACGATCCACGGTGGCATCC
NM_001204492.1      ATCACGGCTGACCAGGCTCTCAAGCACCCGTGGGTCTGTCAACGATCCACGGTGGCATCC
XM_005270197.1      ATCACGGCTGACCAGGCTCTCAAGCACCCGTGGGTCTGTCAACGATCCACGGTGGCATCC
NM_001222.3         ATCACGGCTGACCAGGCTCTCAAGCACCCGTGGGTCTGTCAACGATCCACGGTGGCATCC
NM_172169.2         ATCACGGCTGACCAGGCTCTCAAGCACCCGTGGGTCTGTCAACGATCCACGGTGGCATCC
XM_005270203.1      ATCACGGCTGACCAGGCTCTCAAGCACCCGTGGGTCTGTCAACGATCCACGGTGGCATCC
NM_172170.4         ATCACGGCTGACCAGGCTCTCAAGCACCCGTGGGTCTGTCAACGATCCACGGTGGCATCC
                    *****.**  *  **** ** ***************** *****.********.******

HsCD00038207        ATGATGCATCGTCAGGAGACTGTGGAGTGTTTGCGCAAGTTCAATGCCCGGAGAAAACTG
NM_001220.4         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
XM_005270205.1      ATGATGCATCGTCAGGAGACTGTGGAGTGTTTGCGCAAGTTCAATGCCCGGAGAAAACTG
XM_005270199.1      ATGATGCATCGTCAGGAGACTGTGGAGTGTTTGCGCAAGTTCAATGCCCGGAGAAAACTG
NM_172173.2         ATGATGCATCGTCAGGAGACTGTGGAGTGTTTGCGCAAGTTCAATGCCCGGAGAAAACTG
NM_001204492.1      ATGATGCATCGTCAGGAGACTGTGGAGTGTTTGCGCAAGTTCAATGCCCGGAGAAAACTG
XM_005270197.1      ATGATGCATCGTCAGGAGACTGTGGAGTGTTTGCGCAAGTTCAATGCCCGGAGAAAACTG
NM_001222.3         ATGATGCATCGTCAGGAGACTGTGGAGTGTTTGCGCAAGTTCAATGCCCGGAGAAAACTG
NM_172169.2         ATGATGCATCGTCAGGAGACTGTGGAGTGTTTGCGCAAGTTCAATGCCCGGAGAAAACTG
XM_005270203.1      ATGATGCATCGTCAGGAGACTGTGGAGTGTTTGCGCAAGTTCAATGCCCGGAGAAAACTG
NM_172170.4         ATGATGCATCGTCAGGAGACTGTGGAGTGTTTGCGCAAGTTCAATGCCCGGAGAAAACTG
                    ******** .*:****************** **...************.*******.** 

HsCD00038207        AAGGGTGCCATCCTCACGACCATGCTTGTCTCCAGGAACTTCTCAGTTG-----------
NM_001220.4         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAGTGGGCAGACAGACC
XM_005270205.1      AAGGGTGCCATCCTCACGACCATGCTTGTCTCCAGGAACTTCTCAGTTG-----------
XM_005270199.1      AAGGGTGCCATCCTCACGACCATGCTTGTCTCCAGGAACTTCTCAGTTG-----------
NM_172173.2         AAGGGTGCCATCCTCACGACCATGCTTGTCTCCAGGAACTTCTCAGCTG-----------
NM_001204492.1      AAGGGTGCCATCCTCACGACCATGCTTGTCTCCAGGAACTTCTCAGTTGGCAGGCAGAGC
XM_005270197.1      AAGGGTGCCATCCTCACGACCATGCTTGTCTCCAGGAACTTCTCAGTTG-----------
NM_001222.3         AAGGGTGCCATCCTCACGACCATGCTTGTCTCCAGGAACTTCTCAGCTG-----------
NM_172169.2         AAGGGTGCCATCCTCACGACCATGCTTGTCTCCAGGAACTTCTCAGTTG-----------
XM_005270203.1      AAGGGTGCCATCCTCACGACCATGCTTGTCTCCAGGAACTTCTCAGCTG-----------
NM_172170.4         AAGGGTGCCATCCTCACGACCATGCTTGTCTCCAGGAACTTCTCAGCTG-----------
                    *****:*********** ******** * *:*..**** *******  *           

HsCD00038207        ----------------------------------------------------------GC
NM_001220.4         ACCGCTCCGGCCACAATGTCCACCG------------------------CGGCCTCCGGC
XM_005270205.1      ----------------------------------------------------------GC
XM_005270199.1      ----------------------------------------------------------GC
NM_172173.2         ----------------------------------------------------CCAAAAGC
NM_001204492.1      TCCGCCCCCGCCTCGCCTGCCGCGAGCGCCGCCGGCCTGGCCGGGCAAGCTGCCAAAAGC
XM_005270197.1      ----------------------------------------------------------GC
NM_001222.3         ----------------------------------------------------CCAAAAGC
NM_172169.2         ----------------------------------------------------------GC
XM_005270203.1      ----------------------------------------------------CCAAAAGC
NM_172170.4         ----------------------------------------------------CCAAAAGC
                                                                              **

HsCD00038207        AGGCAGAGCTCCGCCCCCGCCTCGCCTGCCGCGAGCGCCGCCGGCCTGGCCGGGCAAGCT
NM_001220.4         ACCACCATGGGGCTGGTGGAACAAGCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTC
XM_005270205.1      AGGCAGAGCTCCGCCCCCGCCTCGCCTGCCGCGAGCGCCGCCGGCCTGGCCGGGCAAGCT
XM_005270199.1      AGGCAGAGCTCCGCCCCCGCCTCGCCTGCCGCGAGCGCCGCCGGCCTGGCCGGGCAAGCT
NM_172173.2         CTATTGAACAAGAAGTCGGATGGCG---------------------------------GT
NM_001204492.1      CTATTGAACAAGAAGTCGGATGGCG---------------------------------GT
XM_005270197.1      AGGCAGAGCTCCGCCCCCGCCTCGCCTGCCGCGAGCGCCGCCGGCCTGGCCGGGCAAGCT
NM_001222.3         CTATTGAACAAGAAGTCGGATGGCG-----------------------------------
NM_172169.2         AGGCAGAGCTCCGCCCCCGCCTCGCCTGCCGCGAGCGCCGCCGGCCTGGCCGGGCAAGCT
XM_005270203.1      CTATTGAACAAGAAGTCGGATGGCGGTGTCAAGAAAAGGAAGTCGAGTTCCAGCGTGCAC
NM_172170.4         CTATTGAACAAGAAGTCGGATGGCG---------------------------------GT
                    .     *           *.                                        

HsCD00038207        GCCAAAAGCCTATTGAACAAGAAGTCGGATGGCGGTGTCAAGAAAAGGAAGTCGAGTTCC
NM_001220.4         AAGCCCCAGACGAATAGCACCAAAAACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTT
XM_005270205.1      GCCAAAAGCCTATTGAACAAGAAGTCGGATGGCG--------------------------
XM_005270199.1      GCCAAAAGCCTATTGAACAAGAAGTCGGATGGCG--------------------------
NM_172173.2         GTCAAGCCACAGAGCAACAACAAAAACAGTCTCG--------------------------
NM_001204492.1      GTCAAGCCACAGAGCAACAACAAAAACAGTCTCGTAAGCCCAGCCCAAGAGCCCGCGCCC
XM_005270197.1      GCCAAAAGCCTATTGAACAAGAAGTCGGATGGCGGTGTCAAGAAAAGGAAGTCGAGTTCC
NM_001222.3         ------------------------------------------------------------
NM_172169.2         GCCAAAAGCCTATTGAACAAGAAGTCGGATGGCGGTGTCAAGAAAAGGAAGTCGAGTTCC
XM_005270203.1      CTAATGCCACAGAGCAACAACAAAAACAGTCTCGTAAGCCCAGCCCAAGAGCCCGCGCCC
NM_172170.4         GTCAAGCCACAGAGCAACAACAAAAACAGTCTCGTAAGCCCAGCCCAAGAGCCCGCGCCC
                                                                                

HsCD00038207        AGCGTGCACCTAATGGAGCCACAAACCACTGTGGTACACAACGCTACAGATGGGATCAAG
NM_001220.4         CCTCCTGCCGCCCTGGAGCCTCAAACCACCGTCATCCATAACCCAGTGGACGGGATTAAG
XM_005270205.1      -------GTGTCAAGGAGCCACAAACCACTGTGGTACACAACGCTACAGATGGGATCAAG
XM_005270199.1      -------GTGTCAAGGAGCCACAAACCACTGTGGTACACAACGCTACAGATGGGATCAAG
NM_172173.2         ----------------AGCCACAAACCACTGTGGTACACAACGCTACAGATGGGATCAAG
NM_001204492.1      TTGCAGACGGCCATGGAGCCACAAACCACTGTGGTACACAACGCTACAGATGGGATCAAG
XM_005270197.1      AGCGTGCACCTAATGGAGCCACAAACCACTGTGGTACACAACGCTACAGATGGGATCAAG
NM_001222.3         -------GTGTCAAGGAGCCACAAACCACTGTGGTACACAACGCTACAGATGGGATCAAG
NM_172169.2         AGCGTGCACCTAATGGAGCCACAAACCACTGTGGTACACAACGCTACAGATGGGATCAAG
XM_005270203.1      TTGCAGACGGCCATGGAGCCACAAACCACTGTGGTACACAACGCTACAGATGGGATCAAG
NM_172170.4         TTGCAGACGGCCATGGAGCCACAAACCACTGTGGTACACAACGCTACAGATGGGATCAAG
                                    ****:******** ** .*.** *** *:. .** ***** ***

HsCD00038207        GGCTCCACAGAGAGCTGCAACACCACCACAGAAGATGAGGACCTCAAAGTG---------
NM_001220.4         GAGTCTTCTGACAGTGCCAATACCACCATAGAGGATGAAGACGCTAAAGCCCCCAGGGTC
XM_005270205.1      GGCTCCACAGAGAGCTGCAACACCACCACAGAAGATGAGGACCTCAAAGTG---------
XM_005270199.1      GGCTCCACAGAGAGCTGCAACACCACCACAGAAGATGAGGACCTCAAAGCTGCCCCGCTC
NM_172173.2         GGCTCCACAGAGAGCTGCAACACCACCACAGAAGATGAGGACCTCAAAGTG---------
NM_001204492.1      GGCTCCACAGAGAGCTGCAACACCACCACAGAAGATGAGGACCTCAAAGTG---------
XM_005270197.1      GGCTCCACAGAGAGCTGCAACACCACCACAGAAGATGAGGACCTCAAAGCTGCCCCGCTC
NM_001222.3         GGCTCCACAGAGAGCTGCAACACCACCACAGAAGATGAGGACCTCAAAGTG---------
NM_172169.2         GGCTCCACAGAGAGCTGCAACACCACCACAGAAGATGAGGACCTCAAAGTG---------
XM_005270203.1      GGCTCCACAGAGAGCTGCAACACCACCACAGAAGATGAGGACCTCAAAGTG---------
NM_172170.4         GGCTCCACAGAGAGCTGCAACACCACCACAGAAGATGAGGACCTCAAAGTG---------
                    *. ** :*:** **   *** ******* ***.*****.***   ****           

HsCD00038207        ------------------------------------------------------------
NM_001220.4         CCCGACATCCTGAGCTCAGTGAGGAGGGGCTCGGGAGCCCCAGAAGCCGAGGGGCCCCTG
XM_005270205.1      ------------------------------------------------------------
XM_005270199.1      CGC---------------------------------------------------------
NM_172173.2         ------------------------------------------------------------
NM_001204492.1      ------------------------------------------------------------
XM_005270197.1      CGC---------------------------------------------------------
NM_001222.3         ------------------------------------------------------------
NM_172169.2         ------------------------------------------------------------
XM_005270203.1      ------------------------------------------------------------
NM_172170.4         ------------------------------------------------------------
                                                                                

HsCD00038207        ------------------------------------------------------------
NM_001220.4         CCCTGCCCATCTCCGGCTCCCTTTAGCCCCCTGCCAGCCCCATCCCCCAGGATCTCTGAC
XM_005270205.1      ------------------------------------------------------------
XM_005270199.1      ------------------------------------------------------------
NM_172173.2         ------------------------------------------------------------
NM_001204492.1      ------------------------------------------------------------
XM_005270197.1      ------------------------------------------------------------
NM_001222.3         ------------------------------------------------------------
NM_172169.2         ------------------------------------------------------------
XM_005270203.1      ------------------------------------------------------------
NM_172170.4         ------------------------------------------------------------
                                                                                

HsCD00038207        ------------------------------------------------------------
NM_001220.4         ATCCTGAACTCTGTGAGAAGGGGTTCAGGAACCCCAGAAGCCGAGGGCCCCCTCTCAGCG
XM_005270205.1      ------------------------------------------------------------
XM_005270199.1      ------------------------------------------------------------
NM_172173.2         ------------------------------------------------------------
NM_001204492.1      ------------------------------------------------------------
XM_005270197.1      ------------------------------------------------------------
NM_001222.3         ------------------------------------------------------------
NM_172169.2         ------------------------------------------------------------
XM_005270203.1      ------------------------------------------------------------
NM_172170.4         ------------------------------------------------------------
                                                                                

HsCD00038207        ------------------------------------------------------------
NM_001220.4         GGGCCCCCGCCCTGCCTGTCTCCGGCTCTCCTAGGCCCCCTGTCCTCCCCGTCCCCCAGG
XM_005270205.1      ------------------------------------------------------------
XM_005270199.1      ------------------------------------------------------------
NM_172173.2         ------------------------------------------------------------
NM_001204492.1      ------------------------------------------------------------
XM_005270197.1      ------------------------------------------------------------
NM_001222.3         ------------------------------------------------------------
NM_172169.2         ------------------------------------------------------------
XM_005270203.1      ------------------------------------------------------------
NM_172170.4         ------------------------------------------------------------
                                                                                

HsCD00038207        ------------------------------------------------------------
NM_001220.4         ATCTCTGACATCCTGAACTCTGTGAGGAGGGGCTCAGGGACCCCAGAAGCCGAGGGCCCC
XM_005270205.1      ------------------------------------------------------------
XM_005270199.1      ---------------------ACTGGGAATGGCAGCTCGGTGCCTGAAGGACGGAGCTCC
NM_172173.2         ------------------------------------------------------------
NM_001204492.1      ------------------------------------------------------------
XM_005270197.1      ---------------------ACTGGGAATGGCAGCTCGGTGCCTGAAGGACGGAGCTCC
NM_001222.3         ------------------------------------------------------------
NM_172169.2         ------------------------------------------------------------
XM_005270203.1      ------------------------------------------------------------
NM_172170.4         ------------------------------------------------------------
                                                                                

HsCD00038207        ------------------------------------------------------------
NM_001220.4         TCGCCAGTGGGGCCCCCGCCCTGCCCATCTCCGACTATCCCTGGCCCCCTGCCCACCCCA
XM_005270205.1      ------------------------------------------------------------
XM_005270199.1      CGGGACAGAACAGCCCCCTCTGCAGGCATGCAGCCCCAGCCTTCTCTCTGCTCCTCAGCC
NM_172173.2         ------------------------------------------------------------
NM_001204492.1      ------------------------------------------------------------
XM_005270197.1      CGGGACAGAACAGCCCCCTCTGCAGGCATGCAGCCCCAGCCTTCTCTCTGCTCCTCAGCC
NM_001222.3         ------------------------------------------------------------
NM_172169.2         ------------------------------------------------------------
XM_005270203.1      ------------------------------------------------------------
NM_172170.4         ------------------------------------------------------------
                                                                                

HsCD00038207        ---CGAAAACAGGAGATCATTAAGATTACAGAACAGCTGATTGAAGCCATCAACAATGGG
NM_001220.4         TCCCGGAAGCAGGAGATCATTAAGACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGT
XM_005270205.1      ---CGAAAACAGGAGATCATTAAGATTACAGAACAGCTGATTGAAGCCATCAACAATGGG
XM_005270199.1      ATGCGAAAACAGGAGATCATTAAGATTACAGAACAGCTGATTGAAGCCATCAACAATGGG
NM_172173.2         ---CGAAAACAGGAGATCATTAAGATTACAGAACAGCTGATTGAAGCCATCAACAATGGG
NM_001204492.1      ---CGAAAACAGGAGATCATTAAGATTACAGAACAGCTGATTGAAGCCATCAACAATGGG
XM_005270197.1      ATGCGAAAACAGGAGATCATTAAGATTACAGAACAGCTGATTGAAGCCATCAACAATGGG
NM_001222.3         ---CGAAAACAGGAGATCATTAAGATTACAGAACAGCTGATTGAAGCCATCAACAATGGG
NM_172169.2         ---CGAAAACAGGAGATCATTAAGATTACAGAACAGCTGATTGAAGCCATCAACAATGGG
XM_005270203.1      ---CGAAAACAGGAGATCATTAAGATTACAGAACAGCTGATTGAAGCCATCAACAATGGG
NM_172170.4         ---CGAAAACAGGAGATCATTAAGATTACAGAACAGCTGATTGAAGCCATCAACAATGGG
                       **.**.****************  **.**.***** ** **.***.******* ** 

HsCD00038207        GACTTTGAGGCCTACACGAAGATTTGTGATCCAGGCCTCACTTCCTTTGAGCCTGAGGCC
NM_001220.4         GACTTTGAGGCCTACGCGAAAATCTGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCA
XM_005270205.1      GACTTTGAGGCCTACACGAAGATTTGTGATCCAGGCCTCACTTCCTTTGAGCCTGAGGCC
XM_005270199.1      GACTTTGAGGCCTACACGAAGATTTGTGATCCAGGCCTCACTTCCTTTGAGCCTGAGGCC
NM_172173.2         GACTTTGAGGCCTACACGAAGATTTGTGATCCAGGCCTCACTTCCTTTGAGCCTGAGGCC
NM_001204492.1      GACTTTGAGGCCTACACGAAGATTTGTGATCCAGGCCTCACTTCCTTTGAGCCTGAGGCC
XM_005270197.1      GACTTTGAGGCCTACACGAAGATTTGTGATCCAGGCCTCACTTCCTTTGAGCCTGAGGCC
NM_001222.3         GACTTTGAGGCCTACACGAAGATTTGTGATCCAGGCCTCACTTCCTTTGAGCCTGAGGCC
NM_172169.2         GACTTTGAGGCCTACACGAAGATTTGTGATCCAGGCCTCACTTCCTTTGAGCCTGAGGCC
XM_005270203.1      GACTTTGAGGCCTACACGAAGATTTGTGATCCAGGCCTCACTTCCTTTGAGCCTGAGGCC
NM_172170.4         GACTTTGAGGCCTACACGAAGATTTGTGATCCAGGCCTCACTTCCTTTGAGCCTGAGGCC
                    ***************.****.** ***** ***** ** ** ** ***********.**.

HsCD00038207        CTTGGTAACCTCGTGGAGGGGATGGATTTCCATAAGTTTTACTTTGAGAATCTCCTGTCA
NM_001220.4         CTGGGCAACCTGGTTGAAGGGATGGACTTCCACAGATTCTACTTCGAGAACCTGCTGGCC
XM_005270205.1      CTTGGTAACCTCGTGGAGGGGATGGATTTCCATAAGTTTTACTTTGAGAATCTCCTGTCC
XM_005270199.1      CTTGGTAACCTCGTGGAGGGGATGGATTTCCATAAGTTTTACTTTGAGAATCTCCTGTCC
NM_172173.2         CTTGGTAACCTCGTGGAGGGGATGGATTTCCATAAGTTTTACTTTGAGAATCTCCTGTCC
NM_001204492.1      CTTGGTAACCTCGTGGAGGGGATGGATTTCCATAAGTTTTACTTTGAGAATCTCCTGTCC
XM_005270197.1      CTTGGTAACCTCGTGGAGGGGATGGATTTCCATAAGTTTTACTTTGAGAATCTCCTGTCC
NM_001222.3         CTTGGTAACCTCGTGGAGGGGATGGATTTCCATAAGTTTTACTTTGAGAATCTCCTGTCC
NM_172169.2         CTTGGTAACCTCGTGGAGGGGATGGATTTCCATAAGTTTTACTTTGAGAATCTCCTGTCC
XM_005270203.1      CTTGGTAACCTCGTGGAGGGGATGGATTTCCATAAGTTTTACTTTGAGAATCTCCTGTCC
NM_172170.4         CTTGGTAACCTCGTGGAGGGGATGGATTTCCATAAGTTTTACTTTGAGAATCTCCTGTCC
                    ** ** ***** ** **.******** ***** *..** ***** ***** ** *** *.

HsCD00038207        AAGAACAGCAAGCCTATCCATACCACCATCCTAAACCCACACGTCCACGTGATTGGGGAG
NM_001220.4         AAGAACAGCAAGCCGATCCACACGACCATCCTGAACCCACACGTGCACGTCATTGGAGAG
XM_005270205.1      AAGAACAGCAAGCCTATCCATACCACCATCCTAAACCCACACGTCCACGTGATTGGGGAG
XM_005270199.1      AAGAACAGCAAGCCTATCCATACCACCATCCTAAACCCACACGTCCACGTGATTGGGGAG
NM_172173.2         AAGAACAGCAAGCCTATCCATACCACCATCCTAAACCCACACGTCCACGTGATTGGGGAG
NM_001204492.1      AAGAACAGCAAGCCTATCCATACCACCATCCTAAACCCACACGTCCACGTGATTGGGGAG
XM_005270197.1      AAGAACAGCAAGCCTATCCATACCACCATCCTAAACCCACACGTCCACGTGATTGGGGAG
NM_001222.3         AAGAACAGCAAGCCTATCCATACCACCATCCTAAACCCACACGTCCACGTGATTGGGGAG
NM_172169.2         AAGAACAGCAAGCCTATCCATACCACCATCCTAAACCCACACGTCCACGTGATTGGGGAG
XM_005270203.1      AAGAACAGCAAGCCTATCCATACCACCATCCTAAACCCACACGTCCACGTGATTGGGGAG
NM_172170.4         AAGAACAGCAAGCCTATCCATACCACCATCCTAAACCCACACGTCCACGTGATTGGGGAG
                    ************** ***** ** ********.*********** ***** *****.***

HsCD00038207        GACGCAGCGTGCATCGCCTACATCCGCCTCACCCAGTACATCGACGGGCAGGGTCGGCCT
NM_001220.4         GATGCCGCCTGCATCGCTTACATCCGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCC
XM_005270205.1      GACGCAGCGTGCATCGCCTACATCCGCCTCACCCAGTACATCGACGGGCAGGGTCGGCCT
XM_005270199.1      GACGCAGCGTGCATCGCCTACATCCGCCTCACCCAGTACATCGACGGGCAGGGTCGGCCT
NM_172173.2         GACGCAGCGTGCATCGCCTACATCCGCCTCACCCAGTACATCGACGGGCAGGGTCGGCCT
NM_001204492.1      GACGCAGCGTGCATCGCCTACATCCGCCTCACCCAGTACATCGACGGGCAGGGTCGGCCT
XM_005270197.1      GACGCAGCGTGCATCGCCTACATCCGCCTCACCCAGTACATCGACGGGCAGGGTCGGCCT
NM_001222.3         GACGCAGCGTGCATCGCCTACATCCGCCTCACCCAGTACATCGACGGGCAGGGTCGGCCT
NM_172169.2         GACGCAGCGTGCATCGCCTACATCCGCCTCACCCAGTACATCGACGGGCAGGGTCGGCCT
XM_005270203.1      GACGCAGCGTGCATCGCCTACATCCGCCTCACCCAGTACATCGACGGGCAGGGTCGGCCT
NM_172170.4         GACGCAGCGTGCATCGCCTACATCCGCCTCACCCAGTACATCGACGGGCAGGGTCGGCCT
                    ** **.** ******** ******** ***** ******** *********** ***** 

HsCD00038207        CGCACCAGCCAGTCAGAAGAGACCCGGGTCTGGCACCGTCGGGATGGCAAGTGGCTCAAT
NM_001220.4         CGCACCAGCCAGTCTGAGGAGACCCGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAAC
XM_005270205.1      CGCACCAGCCAGTCAGAAGAGACCCGGGTCTGGCACCGTCGGGATGGCAAGTGGCTCAAT
XM_005270199.1      CGCACCAGCCAGTCAGAAGAGACCCGGGTCTGGCACCGTCGGGATGGCAAGTGGCTCAAT
NM_172173.2         CGCACCAGCCAGTCAGAAGAGACCCGGGTCTGGCACCGTCGGGATGGCAAGTGGCTCAAT
NM_001204492.1      CGCACCAGCCAGTCAGAAGAGACCCGGGTCTGGCACCGTCGGGATGGCAAGTGGCTCAAT
XM_005270197.1      CGCACCAGCCAGTCAGAAGAGACCCGGGTCTGGCACCGTCGGGATGGCAAGTGGCTCAAT
NM_001222.3         CGCACCAGCCAGTCAGAAGAGACCCGGGTCTGGCACCGTCGGGATGGCAAGTGGCTCAAT
NM_172169.2         CGCACCAGCCAGTCAGAAGAGACCCGGGTCTGGCACCGTCGGGATGGCAAGTGGCTCAAT
XM_005270203.1      CGCACCAGCCAGTCAGAAGAGACCCGGGTCTGGCACCGTCGGGATGGCAAGTGGCTCAAT
NM_172170.4         CGCACCAGCCAGTCAGAAGAGACCCGGGTCTGGCACCGTCGGGATGGCAAGTGGCTCAAT
                    **************:**.******** ** ******** ** ** **********: ** 

HsCD00038207        GTCCACTATCACTGCTCAGGGGCCCCTGCCGCACCGCTGCAGTTG
NM_001220.4         GTGCACTTCCACTGCTCGGGCGCGCCTGTGGCCCCGCTGCAGTGA
XM_005270205.1      GTCCACTATCACTGCTCAGGGGCCCCTGCCGCACCGCTGCAGTGA
XM_005270199.1      GTCCACTATCACTGCTCAGGGGCCCCTGCCGCACCGCTGCAGTGA
NM_172173.2         GTCCACTATCACTGCTCAGGGGCCCCTGCCGCACCGCTGCAGTGA
NM_001204492.1      GTCCACTATCACTGCTCAGGGGCCCCTGCCGCACCGCTGCAGTGA
XM_005270197.1      GTCCACTATCACTGCTCAGGGGCCCCTGCCGCACCGCTGCAGTGA
NM_001222.3         GTCCACTATCACTGCTCAGGGGCCCCTGCCGCACCGCTGCAGTGA
NM_172169.2         GTCCACTATCACTGCTCAGGGGCCCCTGCCGCACCGCTGCAGTGA
XM_005270203.1      GTCCACTATCACTGCTCAGGGGCCCCTGCCGCACCGCTGCAGTGA
NM_172170.4         GTCCACTATCACTGCTCAGGGGCCCCTGCCGCACCGCTGCAGTGA
                    ** ****: ********.** ** ****  **.********** .

Pathways

NCI : BCR signaling pathway
NCI : IFN-gamma pathway
NCI : N-cadherin signaling events
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : CREB phosphorylation through the activation of CaMKII
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Cytokine Signaling in Immune system
Reactome : Glutamate Binding, Activation of AMPA Receptors and Synaptic Plasticity
Reactome : HSF1-dependent transactivation
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon gamma signaling
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Post NMDA receptor activation events
Reactome : Ras activation uopn Ca2+ infux through NMDA receptor
Reactome : Trafficking of AMPA receptors
Reactome : Transmission across Chemical Synapses
Reactome : Unblocking of NMDA receptor, glutamate binding and activation
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Energy Metabolism
WikiPathway : Myometrial Relaxation and Contraction Pathways

Clone

Cloning Information : 178145
HIP Master Clone ID : 134924
Original Clone ID : FLH178145.01L

Organism


TAX_ID : 9606
Species Specific ID: 818

Genome

Chromosome : 10
Map Location : 10q22
Ensembl : ENSG00000148660

Reagents

Labome : CAMK2G-antibody