DNASU Plasmid Repository • 480.965.5697 | Email

EEF2K (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EEF2K
Gene Name:  eukaryotic elongation factor-2 kinase
Sequence             
Original Clone ID: FLH178149.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038211

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2178nts         Open reading frame : 1 to 2178
Reference Sequence Alignment

ATGGCAGACGAAGATCTCATCTTCCGCCTGGAAGGCGTTGATGGCGGCCAGTCCCCCCGA
GCTGGCCGTGATGGTGATTCTGATGGGGACAGCGACGATGAGGAAGGTTACTTCATCTGC
CCCATCACGGATGACCCAAGCTCGAACCAGAATGTCAATTCCAAGGTTAATAAGTACTAC
AGCAACCTAACAAAAAGTGAGCGGTATAGCTCCAGCGGGTCCCCGGCAAACTCCTTCCAC
TTCAAGGAAGCCTGGAAGCACGCAATCCAGAAGGCCAAGCACATGCCCGACCCCTGGGCT
GAGTTCCACCTGGAAGATATTGCCACCGAACGTGCTACTCGACACAGGTACAACGCCGTC
ACCGGGGAATGGCTGGATGATGAAGTTCTGATCAAGATGGCATCTCAGCCCTTCGGCCGA
GGAGCAATGAGGGAGTGCTTCCGGACGAAGAAGCTCTCCAACTTCTTGCATGCCCAGCAG
TGGAAGGGAGCCTCCAACTACGTGGCGAAGCGCTACATCGAGCCCGTAGACCGGGATGTG
TACTTTGAGGACGTGCGTCTACAGATGGAGGCCAAGCTCTGGGGGGAGGAGTATAATCGG
CACAAGCCCCCCAAGCAGGTGGACATCATGCAGATGTGCATCATCGAGCTGAAGGACAGA
CCGGGCAAGCCCCTCTTCCACCTGGAGCACTACATCGAGGGCAAGTACATCAAGTACAAC
TCCAACTCTGGCTTTGTCCGCGATGACAACATCCGCCTGACGCCGCAGGCCTTCAGCCAC
TTCACTTTTGAGCGTTCCGGCCATCAGCTGATAGTGGTGGACATCCAGGGAGTTGGGGAT
CTCTACACTGACCCACAGATCCACACGGAGACGGGCACTGACTTTGGAGACGGCAACCTA
GGTGTCCGCGGGATGGCGCTCTTCTTCTACTCTCATGCCTGCAACCGGATTTGCGAGAGC
ATGGGCCTTGCTCCCTTTGACCTCTCGCCCCGGGAGAGGGATGCAGTGAATCAGAACACC
AAGCTGCTGCAATCAGCCAAGACCATCTTGAGAGGAACAGAGGAAAAATGTGGGAGCCCC
CGAGTAAGGACCCTCTCTGGGAGCCGGCCACCCCTGCTCCGTCCCCTTTCAGAGAACTCT
GGAGACGAGAACATGAGCGACGTGACCTTCGACTCTCTCCCTTCTTCCCCATCTTCGGCC
ACACCACACAGCCAGAAGCTAGACCACCTCCATTGGCCAGTGTTCAGTGACCTCGATAAC
ATGGCATCCAGAGACCATGATCATCTAGACAACCACCGGGAGTCTGAGAATAGTGGGGAC
AGCGGATACCCCAGTGAGAAGCGGGGTGAGCTGGATGACCCTGAGCCCCGAGAACATGGC
CACTCATACAGTAATCGGAAGTACGAGTCTGACGAAGACAGCCTGGGCAGCTCTGGACGG
GTATGTGTAGAGAAGTGGAATCTCCTCAACTCCTCCCGCCTCCACCTGCCGAGGGCTTCG
GCCGTGGCCCTGGAAGTGCAAAGGCTTAATGCTCTGGACCTCGAAAAGAAAATCGGGAAG
TCCATTTTGGGGAAGGTCCATCTGGCCATGGTGCGCTACCACGAGGGTGGGCGCTTCTGC
GAGAAGGGCGAGGAGTGGGACCAGGAGTCGGCTGTCTTCCACCTGGAGCACGCAGCCAAC
CTGGGCGAGCTGGAGGCCATCGTGGGCCTGGGACTCATGTACTCGCAGTTGCCTCATCAC
ATCCTAGCCGATGTCTCTCTGAAGGAGACAGAAGAGAACAAAACCAAAGGATTTGATTAC
TTACTAAAGGCCGCTGAAGCTGGCGACAGGCAGTCCATGATCCTAGTGGCGCGAGCTTTT
GACTCTGGCCAGAACCTCAGCCCGGACAGGTGCCAAGACTGGCTAGAGGCCCTGCACTGG
TACAACACTGCCCTGGAGATGACGGACTGTGATGAGGGCGGTGAGTACGACGGAATGCAG
GACGAGCCCCGGTACATGATGCTGGCCAGGGAGGCCGAGATGCTGTTCACAGGAGGCTAC
GGGCTGGAGAAGGACCCGCAGAGATCAGGGGACTTGTATACCCAGGCAGCAGAGGCAGCG
ATGGAAGCCATGAAGGGCCGACTGGCCAACCAGTACTACCAAAAGGCTGAAGAGGCCTGG
GCCCAGATGGAGGAGTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 2374
Start on reference sequence 197
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : EEF2K
Symbol Nomenclature : EEF2K
SYNONYM : HSU93850; eEF-2K
Designation : calcium/calmodulin-dependent eukaryotic elongation factor 2 kinase|calcium/calmodulin-dependent eukaryotic elongation factor-2 kinase|calmodulin-dependent protein kinase III|eEF-2 kinase|elongation factor-2 kinase|eukaroytic elongation factor 2 kinase|eukaryotic elongation factor 2 kinase
Full Nomenclature : eukaryotic elongation factor-2 kinase
GENEID : 29904
HGNC : 24615
MIM : 606968
Target GenBank: BC032665

 

Reference Sequence Alignment

  

HsCD00038211        ATGGCAGACGAAGATCTCATCTTCCGCCTGGAAGGCGTTGATGGCGGCCAGTCCCCCCGA
NM_013302.3         ATGGCAGACGAAGATCTCATCTTCCGCCTGGAAGGCGTTGATGGCGGCCAGTCCCCCCGA
XM_005276497.1      ATGGCAGACGAAGATCTCATCTTCCGCCTGGAAGGCGTTGATGGCGGCCAGTCCCCCCGA
                    ************************************************************

HsCD00038211        GCTGGCCGTGATGGTGATTCTGATGGGGACAGCGACGATGAGGAAGGTTACTTCATCTGC
NM_013302.3         GCTGGCCATGATGGTGATTCTGATGGGGACAGCGACGATGAGGAAGGTTACTTCATCTGC
XM_005276497.1      GCTGGCCATGATGGTGATTCTGATGGGGACAGCGACGATGAGGAAGGTTACTTCATCTGC
                    *******.****************************************************

HsCD00038211        CCCATCACGGATGACCCAAGCTCGAACCAGAATGTCAATTCCAAGGTTAATAAGTACTAC
NM_013302.3         CCCATCACGGATGACCCAAGCTCGAACCAGAATGTCAATTCCAAGGTTAATAAGTACTAC
XM_005276497.1      CCCATCACGGATGACCCAAGCTCGAACCAGAATGTCAATTCCAAGGTTAATAAGTACTAC
                    ************************************************************

HsCD00038211        AGCAACCTAACAAAAAGTGAGCGGTATAGCTCCAGCGGGTCCCCGGCAAACTCCTTCCAC
NM_013302.3         AGCAACCTAACAAAAAGTGAGCGGTATAGCTCCAGCGGGTCCCCGGCAAACTCCTTCCAC
XM_005276497.1      AGCAACCTAACAAAAAGTGAGCGGTATAGCTCCAGCGGGTCCCCGGCAAACTCCTTCCAC
                    ************************************************************

HsCD00038211        TTCAAGGAAGCCTGGAAGCACGCAATCCAGAAGGCCAAGCACATGCCCGACCCCTGGGCT
NM_013302.3         TTCAAGGAAGCCTGGAAGCACGCAATCCAGAAGGCCAAGCACATGCCCGACCCCTGGGCT
XM_005276497.1      TTCAAGGAAGCCTGGAAGCACGCAATCCAGAAGGCCAAGCACATGCCCGACCCCTGGGCT
                    ************************************************************

HsCD00038211        GAGTTCCACCTGGAAGATATTGCCACCGAACGTGCTACTCGACACAGGTACAACGCCGTC
NM_013302.3         GAGTTCCACCTGGAAGATATTGCCACCGAACGTGCTACTCGACACAGGTACAACGCCGTC
XM_005276497.1      GAGTTCCACCTGGAAGATATTGCCACCGAACGTGCTACTCGACACAGGTACAACGCCGTC
                    ************************************************************

HsCD00038211        ACCGGGGAATGGCTGGATGATGAAGTTCTGATCAAGATGGCATCTCAGCCCTTCGGCCGA
NM_013302.3         ACCGGGGAATGGCTGGATGATGAAGTTCTGATCAAGATGGCATCTCAGCCCTTCGGCCGA
XM_005276497.1      ACCGGGGAATGGCTGGATGATGAAGTTCTGATCAAGATGGCATCTCAGCCCTTCGGCCGA
                    ************************************************************

HsCD00038211        GGAGCAATGAGGGAGTGCTTCCGGACGAAGAAGCTCTCCAACTTCTTGCATGCCCAGCAG
NM_013302.3         GGAGCAATGAGGGAGTGCTTCCGGACGAAGAAGCTCTCCAACTTCTTGCATGCCCAGCAG
XM_005276497.1      GGAGCAATGAGGGAGTGCTTCCGGACGAAGAAGCTCTCCAACTTCTTGCATGCCCAGCAG
                    ************************************************************

HsCD00038211        TGGAAGGGAGCCTCCAACTACGTGGCGAAGCGCTACATCGAGCCCGTAGACCGGGATGTG
NM_013302.3         TGGAAGGGCGCCTCCAACTACGTGGCGAAGCGCTACATCGAGCCCGTAGACCGGGATGTG
XM_005276497.1      TGGAAGGGCGCCTCCAACTACGTGGCGAAGCGCTACATCGAGCCCGTAGACCGGGATGTG
                    ********.***************************************************

HsCD00038211        TACTTTGAGGACGTGCGTCTACAGATGGAGGCCAAGCTCTGGGGGGAGGAGTATAATCGG
NM_013302.3         TACTTTGAGGACGTGCGTCTACAGATGGAGGCCAAGCTCTGGGGGGAGGAGTATAATCGG
XM_005276497.1      TACTTTGAGGACGTGCGTCTACAGATGGAGGCCAAGCTCTGGGGGGAGGAGTATAATCGG
                    ************************************************************

HsCD00038211        CACAAGCCCCCCAAGCAGGTGGACATCATGCAGATGTGCATCATCGAGCTGAAGGACAGA
NM_013302.3         CACAAGCCCCCCAAGCAGGTGGACATCATGCAGATGTGCATCATCGAGCTGAAGGACAGA
XM_005276497.1      CACAAGCCCCCCAAGCAGGTGGACATCATGCAGATGTGCATCATCGAGCTGAAGGACAGA
                    ************************************************************

HsCD00038211        CCGGGCAAGCCCCTCTTCCACCTGGAGCACTACATCGAGGGCAAGTACATCAAGTACAAC
NM_013302.3         CCGGGCAAGCCCCTCTTCCACCTGGAGCACTACATCGAGGGCAAGTACATCAAGTACAAC
XM_005276497.1      CCGGGCAAGCCCCTCTTCCACCTGGAGCACTACATCGAGGGCAAGTACATCAAGTACAAC
                    ************************************************************

HsCD00038211        TCCAACTCTGGCTTTGTCCGCGATGACAACATCCGCCTGACGCCGCAGGCCTTCAGCCAC
NM_013302.3         TCCAACTCTGGCTTTGTCCGCGATGACAACATCCGCCTGACGCCGCAGGCCTTCAGCCAC
XM_005276497.1      TCCAACTCTGGCTTTGTCCGCGATGACAACATCCGCCTGACGCCGCAGGCCTTCAGCCAC
                    ************************************************************

HsCD00038211        TTCACTTTTGAGCGTTCCGGCCATCAGCTGATAGTGGTGGACATCCAGGGAGTTGGGGAT
NM_013302.3         TTCACTTTTGAGCGTTCCGGCCATCAGCTGATAGTGGTGGACATCCAGGGAGTTGGGGAT
XM_005276497.1      TTCACTTTTGAGCGTTCCGGCCATCAGCTGATAGTGGTGGACATCCAGGGAGTTGGGGAT
                    ************************************************************

HsCD00038211        CTCTACACTGACCCACAGATCCACACGGAGACGGGCACTGACTTTGGAGACGGCAACCTA
NM_013302.3         CTCTACACTGACCCACAGATCCACACGGAGACGGGCACTGACTTTGGAGACGGCAACCTA
XM_005276497.1      CTCTACACTGACCCACAGATCCACACGGAGACGGGCACTGACTTTGGAGACGGCAACCTA
                    ************************************************************

HsCD00038211        GGTGTCCGCGGGATGGCGCTCTTCTTCTACTCTCATGCCTGCAACCGGATTTGCGAGAGC
NM_013302.3         GGTGTCCGCGGGATGGCGCTCTTCTTCTACTCTCATGCCTGCAACCGGATTTGCGAGAGC
XM_005276497.1      GGTGTCCGCGGGATGGCGCTCTTCTTCTACTCTCATGCCTGCAACCGGATTTGCGAGAGC
                    ************************************************************

HsCD00038211        ATGGGCCTTGCTCCCTTTGACCTCTCGCCCCGGGAGAGGGATGCAGTGAATCAGAACACC
NM_013302.3         ATGGGCCTTGCTCCCTTTGACCTCTCGCCCCGGGAGAGGGATGCAGTGAATCAGAACACC
XM_005276497.1      ATGGGCCTTGCTCCCTTTGACCTCTCGCCCCGGGAGAGGGATGCAGTGAATCAGAACACC
                    ************************************************************

HsCD00038211        AAGCTGCTGCAATCAGCCAAGACCATCTTGAGAGGAACAGAGGAAAAATGTGGGAGCCCC
NM_013302.3         AAGCTGCTGCAATCAGCCAAGACCATCTTGAGAGGAACAGAGGAAAAATGTGGGAGCCCC
XM_005276497.1      AAGCTGCTGCAATCAGCCAAGACCATCTTGAGAGGAACAGAGGAAAAATGTGGGAGCCCC
                    ************************************************************

HsCD00038211        CGAGTAAGGACCCTCTCTGGGAGCCGGCCACCCCTGCTCCGTCCCCTTTCAGAGAACTCT
NM_013302.3         CGAGTAAGGACCCTCTCTGGGAGCCGGCCACCCCTGCTCCGTCCCCTTTCAGAGAACTCT
XM_005276497.1      CGAGTAAGGACCCTCTCTGGGAGCCGGCCACCCCTGCTCCGTCCCCTTTCAGAGAACTCT
                    ************************************************************

HsCD00038211        GGAGACGAGAACATGAGCGACGTGACCTTCGACTCTCTCCCTTCTTCCCCATCTTCGGCC
NM_013302.3         GGAGACGAGAACATGAGCGACGTGACCTTCGACTCTCTCCCTTCTTCCCCATCTTCGGCC
XM_005276497.1      GGAGACGAGAACATGAGCGACGTGACCTTCGACTCTCTCCCTTCTTCCCCATCTTCGGCC
                    ************************************************************

HsCD00038211        ACACCACACAGCCAGAAGCTAGACCACCTCCATTGGCCAGTGTTCAGTGACCTCGATAAC
NM_013302.3         ACACCACACAGCCAGAAGCTAGACCACCTCCATTGGCCAGTGTTCAGTGACCTCGATAAC
XM_005276497.1      ACACCACACAGCCAGAAGCTAGACCACCTCCATTGGCCAGTGTTCAGTGACCTCGATAAC
                    ************************************************************

HsCD00038211        ATGGCATCCAGAGACCATGATCATCTAGACAACCACCGGGAGTCTGAGAATAGTGGGGAC
NM_013302.3         ATGGCATCCAGAGACCATGATCATCTAGACAACCACCGGGAGTCTGAGAATAGTGGGGAC
XM_005276497.1      ATGGCATCCAGAGACCATGATCATCTAGACAACCACCGGGAGTCTGAGAATAGTGGGGAC
                    ************************************************************

HsCD00038211        AGCGGATACCCCAGTGAGAAGCGGGGTGAGCTGGATGACCCTGAGCCCCGAGAACATGGC
NM_013302.3         AGCGGATACCCCAGTGAGAAGCGGGGTGAGCTGGATGACCCTGAGCCCCGAGAACATGGC
XM_005276497.1      AGCGGATACCCCAGTGAGAAGCGGGGTGAGCTGGATGACCCTGAGCCCCGAGAACATGGC
                    ************************************************************

HsCD00038211        CACTCATACAGTAATCGGAAGTACGAGTCTGACGAAGACAGCCTGGGCAGCTCTGGACGG
NM_013302.3         CACTCATACAGTAATCGGAAGTACGAGTCTGACGAAGACAGCCTGGGCAGCTCTGGACGG
XM_005276497.1      CACTCATACAGTAATCGGAAGTACGAGTCTGACGAAGACAGCCTGGGCAGCTCTGGACGG
                    ************************************************************

HsCD00038211        GTATGTGTAGAGAAGTGGAATCTCCTCAACTCCTCCCGCCTCCACCTGCCGAGGGCTTCG
NM_013302.3         GTATGTGTAGAGAAGTGGAATCTCCTCAACTCCTCCCGCCTCCACCTGCCGAGGGCTTCG
XM_005276497.1      GTATGTGTAGAGAAGTGGAATCTCCTCAACTCCTCCCGCCTCCACCTGCCGAGGGCTTCG
                    ************************************************************

HsCD00038211        GCCGTGGCCCTGGAAGTGCAAAGGCTTAATGCTCTGGACCTCGAAAAGAAAATCGGGAAG
NM_013302.3         GCCGTGGCCCTGGAAGTGCAAAGGCTTAATGCTCTGGACCTCGAAAAGAAAATCGGGAAG
XM_005276497.1      GCCGTGGCCCTGGAAGTGCAAAGGCTTAATGCTCTGGACCTCGAAAAGAAAATCGGGAAG
                    ************************************************************

HsCD00038211        TCCATTTTGGGGAAGGTCCATCTGGCCATGGTGCGCTACCACGAGGGTGGGCGCTTCTGC
NM_013302.3         TCCATTTTGGGGAAGGTCCATCTGGCCATGGTGCGCTACCACGAGGGTGGGCGCTTCTGC
XM_005276497.1      TCCATTTTGGGGAAGGTCCATCTGGCCATGGTGCGCTACCACGAGGGTGGGCGCTTCTGC
                    ************************************************************

HsCD00038211        GAGAAGGGCGAGGAGTGGGACCAGGAGTCGGCTGTCTTCCACCTGGAGCACGCAGCCAAC
NM_013302.3         GAGAAGGGCGAGGAGTGGGACCAGGAGTCGGCTGTCTTCCACCTGGAGCACGCAGCCAAC
XM_005276497.1      GAGAAGGGCGAGGAGTGGGACCAGGAGTCGGCTGTCTTCCACCTGGAGCACGCAGCCAAC
                    ************************************************************

HsCD00038211        CTGGGCGAGCTGGAGGCCATCGTGGGCCTGGGACTCATGTACTCGCAGTTGCCTCATCAC
NM_013302.3         CTGGGCGAGCTGGAGGCCATCGTGGGCCTGGGACTCATGTACTCGCAGTTGCCTCATCAC
XM_005276497.1      CTGGGCGAGCTGGAGGCCATCGTGGGCCTGGGACTCATGTACTCGCAGTTGCCTCATCAC
                    ************************************************************

HsCD00038211        ATCCTAGCCGATGTCTCTCTGAAGGAGACAGAAGAGAACAAAACCAAAGGATTTGATTAC
NM_013302.3         ATCCTAGCCGATGTCTCTCTGAAGGAGACAGAAGAGAACAAAACCAAAGGATTTGATTAC
XM_005276497.1      ATCCTAGCCGATGTCTCTCTGAAGGAGACAGAAGAGAACAAAACCAAAGGATTTGATTAC
                    ************************************************************

HsCD00038211        TTACTAAAGGCCGCTGAAGCTGGCGACAGGCAGTCCATGATCCTAGTGGCGCGAGCTTTT
NM_013302.3         TTACTAAAGGCCGCTGAAGCTGGCGACAGGCAGTCCATGATCCTAGTGGCGCGAGCTTTT
XM_005276497.1      TTACTAAAGGCCGCTGAAGCTGGCGACAGGCAGTCCATGATCCTAGTGGCGCGAGCTTTT
                    ************************************************************

HsCD00038211        GACTCTGGCCAGAACCTCAGCCCGGACAGGTGCCAAGACTGGCTAGAGGCCCTGCACTGG
NM_013302.3         GACTCTGGCCAGAACCTCAGCCCGGACAGGTGCCAAGACTGGCTAGAGGCCCTGCACTGG
XM_005276497.1      GACTCTGGCCAGAACCTCAGCCCGGACAGGTGCCAAGACTGGCTAGAGGCCCTGCACTGG
                    ************************************************************

HsCD00038211        TACAACACTGCCCTGGAGATGACGGACTGTGATGAGGGCGGTGAGTACGACGGAATGCAG
NM_013302.3         TACAACACTGCCCTGGAGATGACGGACTGTGATGAGGGCGGTGAGTACGACGGAATGCAG
XM_005276497.1      TACAACACTGCCCTGGAGATGACGGACTGTGATGAGGGCGGTGAGTACGACGGAATGCAG
                    ************************************************************

HsCD00038211        GACGAGCCCCGGTACATGATGCTGGCCAGGGAGGCCGAGATGCTGTTCACAGGAGGCTAC
NM_013302.3         GACGAGCCCCGGTACATGATGCTGGCCAGGGAGGCCGAGATGCTGTTCACAGGAGGCTAC
XM_005276497.1      GACGAGCCCCGGTACATGATGCTGGCCAGGGAGGCCGAGATGCTGTTCACAGGAGGCTAC
                    ************************************************************

HsCD00038211        GGGCTGGAGAAGGACCCGCAGAGATCAGGGGACTTGTATACCCAGGCAGCAGAGGCAGCG
NM_013302.3         GGGCTGGAGAAGGACCCGCAGAGATCAGGGGACTTGTATACCCAGGCAGCAGAGGCAGCG
XM_005276497.1      GGGCTGGAGAAGGACCCGCAGAGATCAGGGGACTTGTATACCCAGGCAGCAGAGGCAGCG
                    ************************************************************

HsCD00038211        ATGGAAGCCATGAAGGGCCGACTGGCCAACCAGTACTACCAAAAGGCTGAAGAGGCCTGG
NM_013302.3         ATGGAAGCCATGAAGGGCCGACTGGCCAACCAGTACTACCAAAAGGCTGAAGAGGCCTGG
XM_005276497.1      ATGGAAGCCATGAAGGGCCGACTGGCCAACCAGTACTACCAAAAGGCTGAAGAGGCCTGG
                    ************************************************************

HsCD00038211        GCCCAGATGGAGGAGTTG
NM_013302.3         GCCCAGATGGAGGAGTAA
XM_005276497.1      GCCCAGATGGAGGAGTAA
                    ****************:.

Pathways

NCI : Signaling mediated by p38-gamma and p38-delta
NCI : mTOR signaling pathway
Panther : Oxidative stress response
Panther : p38 MAPK pathway
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Insulin receptor signalling cascade
Reactome : PI3K Cascade
Reactome : PKB-mediated events
Reactome : S6K1 signalling
Reactome : S6K1-mediated signalling
Reactome : Signal Transduction
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : mTOR signalling
Reactome : mTORC1-mediated signalling
WikiPathway : AMPK signaling
WikiPathway : Translation Factors

Protein

SMART domain : Alpha_kinase : Alpha-kinase family
UniProt : O00418
HPRD : 07369

Clone

Cloning Information : 178149
HIP Master Clone ID : 134848
Original Clone ID : FLH178149.01L

Organism


TAX_ID : 9606
Species Specific ID: 29904

Genome

Chromosome : 16
Map Location : 16p12.2