DNASU Plasmid Repository • 480.965.5697 | Email

ITGB2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ITGB2
Gene Name:  integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH023494.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00003822

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2310nts        
Open reading frame : 1 to 2310
Reference Sequence Alignment

ATGCTGGGCCTGCGCCCCCCACTTCTCGCCCTGGTGGGGCTGCTCTCCCTCGGGTGCGTC
CTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTGCCGGGAATGCATCGAGTCGGGG
CCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGGGCCGGGGGATCCTGACTCCATT
CGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTGTGCGGCTGACGACATCATGGAC
CCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGGGGGCCAGAAGCAGCTGTCCCCA
CAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGCAGCGTTCAACGTGACCTTCCGG
CGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGATGGACCTCTCCTACTCCATGCTT
GATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCTGCTCCGGGCCCTCAACGAGATC
ACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGACAAGACCGTGCTGCCGTTCGTG
AACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAACAAGGAGAAAGAGTGCCAGCCC
CCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAACTCCAACCAGTTTCAGACCGAG
GTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACCCGAGGGTGGGCTGGACGCCATG
ATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCGCAACGTCACGCGGCTGCTGGTG
TTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGGGAAGCTGGGCGCCATCCTGACC
CCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTACAAGAGGAGCAACGAATTCGAC
TACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGAAAACAACATCCAGCCCATCTTC
GCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACTCACCGAGATCATCCCCAAGTCA
GCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGTCCATCTCATTAAGAATGCTTAC
AATAAACTCTCCTCCAGGGTATTCCTGGATCACAACGCCCTCCCCGACACCCTGAAAGTC
ACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAGGAACCAGCCCAGAGGTGACTGT
GATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGTGAAGGTCACGGCCACAGAGTGC
ATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTTCACGGACATAGTGACCGTGCAG
GTCCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAGCAGAGACCGCAGCCTCTGCCAT
GGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGACACTGGCTACATTGGGAAAAAC
TGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCTGGAAGGAAGCTGCCGGAAGGAC
AACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGTCTGCGGGCAGTGCCTGTGCCAC
ACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTACTGCGAGTGTGACACCATCAAC
TGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGGGAGGGGGCTCTGCTTCTGCGGG
AAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTGCCAGTGCGAGAGGACCACTGAG
GGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCGTGGCCGGTGCCGCTGCAACGTA
TGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCAGGAGTGCCCCGGCTGCCCCTCA
CCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAAGTTCGAAAAGGGCCCCTTTGGG
AAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTCGAACAACCCCGTGAAGGGCAGG
ACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGCCTACACGCTGGAGCAGCAGGAC
GGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCGAGAGTGTGTGGCAGGCCCCAAC
ATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGTGCTGATCGGCATTCTCCTGCTG
GTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCGGGAGTACAGGCGCTTTGAGAAG
GAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCTTTTCAAGAGCGCCACCACGACG
GTCATGAACCCCAAGTTTGCTGAGAGTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2363
Start on reference sequence 54
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ITGB2
Symbol Nomenclature : ITGB2
SYNONYM : CD18; LAD; LCAMB; LFA-1; MAC-1; MF17; MFI7
Designation : cell surface adhesion glycoprotein LFA-1/CR3/P150,959 beta subunit precursor)|cell surface adhesion glycoproteins LFA-1/CR3/p150,95 subunit beta|complement receptor C3 beta-subunit|complement receptor C3 subunit beta|integrin beta chain, beta 2|integrin beta-2|leukocyte cell adhesion molecule CD18|leukocyte-associated antigens CD18/11A, CD18/11B, CD18/11C
Full Nomenclature : integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
GENEID : 3689
GI : 60653080
GenBank Accession : AY892318
HGNC : 6155
MIM : 600065
Vega : OTTHUMG00000090257
Target GenBank: BC005861

 

Reference Sequence Alignment

  

HsCD00003822        ATGCTGGGCCTGCGCCCCCCACTTCTCGCCCTGGTGGGGCTGCTCTCCCTCGGGTGCGTC
NM_000211.3         ATGCTGGGCCTGCGCCCCCCACTGCTCGCCCTGGTGGGGCTGCTCTCCCTCGGGTGCGTC
NM_001127491.1      ATGCTGGGCCTGCGCCCCCCACTGCTCGCCCTGGTGGGGCTGCTCTCCCTCGGGTGCGTC
                    *********************** ************************************

HsCD00003822        CTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTGCCGGGAATGCATCGAGTCGGGG
NM_000211.3         CTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTGCCGGGAATGCATCGAGTCGGGG
NM_001127491.1      CTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTGCCGGGAATGCATCGAGTCGGGG
                    ************************************************************

HsCD00003822        CCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGGGCCGGGGGATCCTGACTCCATT
NM_000211.3         CCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGGGCCGGGGGATCCTGACTCCATT
NM_001127491.1      CCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGGGCCGGGGGATCCTGACTCCATT
                    ************************************************************

HsCD00003822        CGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTGTGCGGCTGACGACATCATGGAC
NM_000211.3         CGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTGTGCGGCTGACGACATCATGGAC
NM_001127491.1      CGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTGTGCGGCTGACGACATCATGGAC
                    ************************************************************

HsCD00003822        CCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGGGGGCCAGAAGCAGCTGTCCCCA
NM_000211.3         CCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGGGGGCCAGAAGCAGCTGTCCCCA
NM_001127491.1      CCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGGGGGCCAGAAGCAGCTGTCCCCA
                    ************************************************************

HsCD00003822        CAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGCAGCGTTCAACGTGACCTTCCGG
NM_000211.3         CAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGCAGCGTTCAACGTGACCTTCCGG
NM_001127491.1      CAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGCAGCGTTCAACGTGACCTTCCGG
                    ************************************************************

HsCD00003822        CGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGATGGACCTCTCCTACTCCATGCTT
NM_000211.3         CGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGATGGACCTCTCCTACTCCATGCTT
NM_001127491.1      CGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGATGGACCTCTCCTACTCCATGCTT
                    ************************************************************

HsCD00003822        GATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCTGCTCCGGGCCCTCAACGAGATC
NM_000211.3         GATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCTGCTCCGGGCCCTCAACGAGATC
NM_001127491.1      GATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCTGCTCCGGGCCCTCAACGAGATC
                    ************************************************************

HsCD00003822        ACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGACAAGACCGTGCTGCCGTTCGTG
NM_000211.3         ACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGACAAGACCGTGCTGCCGTTCGTG
NM_001127491.1      ACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGACAAGACCGTGCTGCCGTTCGTG
                    ************************************************************

HsCD00003822        AACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAACAAGGAGAAAGAGTGCCAGCCC
NM_000211.3         AACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAACAAGGAGAAAGAGTGCCAGCCC
NM_001127491.1      AACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAACAAGGAGAAAGAGTGCCAGCCC
                    ************************************************************

HsCD00003822        CCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAACTCCAACCAGTTTCAGACCGAG
NM_000211.3         CCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAACTCCAACCAGTTTCAGACCGAG
NM_001127491.1      CCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAACTCCAACCAGTTTCAGACCGAG
                    ************************************************************

HsCD00003822        GTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACCCGAGGGTGGGCTGGACGCCATG
NM_000211.3         GTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACCCGAGGGTGGGCTGGACGCCATG
NM_001127491.1      GTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACCCGAGGGTGGGCTGGACGCCATG
                    ************************************************************

HsCD00003822        ATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCGCAACGTCACGCGGCTGCTGGTG
NM_000211.3         ATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCGCAACGTCACGCGGCTGCTGGTG
NM_001127491.1      ATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCGCAACGTCACGCGGCTGCTGGTG
                    ************************************************************

HsCD00003822        TTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGGGAAGCTGGGCGCCATCCTGACC
NM_000211.3         TTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGGGAAGCTGGGCGCCATCCTGACC
NM_001127491.1      TTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGGGAAGCTGGGCGCCATCCTGACC
                    ************************************************************

HsCD00003822        CCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTACAAGAGGAGCAACGAATTCGAC
NM_000211.3         CCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTACAAGAGGAGCAACGAATTCGAC
NM_001127491.1      CCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTACAAGAGGAGCAACGAATTCGAC
                    ************************************************************

HsCD00003822        TACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGAAAACAACATCCAGCCCATCTTC
NM_000211.3         TACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGAAAACAACATCCAGCCCATCTTC
NM_001127491.1      TACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGAAAACAACATCCAGCCCATCTTC
                    ************************************************************

HsCD00003822        GCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACTCACCGAGATCATCCCCAAGTCA
NM_000211.3         GCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACTCACCGAGATCATCCCCAAGTCA
NM_001127491.1      GCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACTCACCGAGATCATCCCCAAGTCA
                    ************************************************************

HsCD00003822        GCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGTCCATCTCATTAAGAATGCTTAC
NM_000211.3         GCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGTCCAACTCATTAAGAATGCTTAC
NM_001127491.1      GCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGTCCAACTCATTAAGAATGCTTAC
                    *****************************************:******************

HsCD00003822        AATAAACTCTCCTCCAGGGTATTCCTGGATCACAACGCCCTCCCCGACACCCTGAAAGTC
NM_000211.3         AATAAACTCTCCTCCAGGGTCTTCCTGGATCACAACGCCCTCCCCGACACCCTGAAAGTC
NM_001127491.1      AATAAACTCTCCTCCAGGGTCTTCCTGGATCACAACGCCCTCCCCGACACCCTGAAAGTC
                    ********************.***************************************

HsCD00003822        ACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAGGAACCAGCCCAGAGGTGACTGT
NM_000211.3         ACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAGGAACCAGCCCAGAGGTGACTGT
NM_001127491.1      ACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAGGAACCAGCCCAGAGGTGACTGT
                    ************************************************************

HsCD00003822        GATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGTGAAGGTCACGGCCACAGAGTGC
NM_000211.3         GATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGTGAAGGTCACGGCCACAGAGTGC
NM_001127491.1      GATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGTGAAGGTCACGGCCACAGAGTGC
                    ************************************************************

HsCD00003822        ATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTTCACGGACATAGTGACCGTGCAG
NM_000211.3         ATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTTCACGGACATAGTGACCGTGCAG
NM_001127491.1      ATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTTCACGGACATAGTGACCGTGCAG
                    ************************************************************

HsCD00003822        GTCCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAGCAGAGACCGCAGCCTCTGCCAT
NM_000211.3         GTTCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAGCAGAGACCGCAGCCTCTGCCAT
NM_001127491.1      GTTCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAGCAGAGACCGCAGCCTCTGCCAT
                    ** *********************************************************

HsCD00003822        GGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGACACTGGCTACATTGGGAAAAAC
NM_000211.3         GGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGACACTGGCTACATTGGGAAAAAC
NM_001127491.1      GGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGACACTGGCTACATTGGGAAAAAC
                    ************************************************************

HsCD00003822        TGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCTGGAAGGAAGCTGCCGGAAGGAC
NM_000211.3         TGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCTGGAAGGAAGCTGCCGGAAGGAC
NM_001127491.1      TGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCTGGAAGGAAGCTGCCGGAAGGAC
                    ************************************************************

HsCD00003822        AACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGTCTGCGGGCAGTGCCTGTGCCAC
NM_000211.3         AACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGTCTGCGGGCAGTGCCTGTGCCAC
NM_001127491.1      AACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGTCTGCGGGCAGTGCCTGTGCCAC
                    ************************************************************

HsCD00003822        ACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTACTGCGAGTGTGACACCATCAAC
NM_000211.3         ACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTACTGCGAGTGTGACACCATCAAC
NM_001127491.1      ACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTACTGCGAGTGTGACACCATCAAC
                    ************************************************************

HsCD00003822        TGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGGGAGGGGGCTCTGCTTCTGCGGG
NM_000211.3         TGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGGGAGGGGGCTCTGCTTCTGCGGG
NM_001127491.1      TGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGGGAGGGGGCTCTGCTTCTGCGGG
                    ************************************************************

HsCD00003822        AAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTGCCAGTGCGAGAGGACCACTGAG
NM_000211.3         AAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTGCCAGTGCGAGAGGACCACTGAG
NM_001127491.1      AAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTGCCAGTGCGAGAGGACCACTGAG
                    ************************************************************

HsCD00003822        GGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCGTGGCCGGTGCCGCTGCAACGTA
NM_000211.3         GGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCGTGGCCGGTGCCGCTGCAACGTA
NM_001127491.1      GGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCGTGGCCGGTGCCGCTGCAACGTA
                    ************************************************************

HsCD00003822        TGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCAGGAGTGCCCCGGCTGCCCCTCA
NM_000211.3         TGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCAGGAGTGCCCCGGCTGCCCCTCA
NM_001127491.1      TGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCAGGAGTGCCCCGGCTGCCCCTCA
                    ************************************************************

HsCD00003822        CCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAAGTTCGAAAAGGGCCCCTTTGGG
NM_000211.3         CCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAAGTTCGAAAAGGGCCCCTTTGGG
NM_001127491.1      CCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAAGTTCGAAAAGGGCCCCTTTGGG
                    ************************************************************

HsCD00003822        AAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTCGAACAACCCCGTGAAGGGCAGG
NM_000211.3         AAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTCGAACAACCCCGTGAAGGGCAGG
NM_001127491.1      AAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTCGAACAACCCCGTGAAGGGCAGG
                    ************************************************************

HsCD00003822        ACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGCCTACACGCTGGAGCAGCAGGAC
NM_000211.3         ACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGCCTACACGCTGGAGCAGCAGGAC
NM_001127491.1      ACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGCCTACACGCTGGAGCAGCAGGAC
                    ************************************************************

HsCD00003822        GGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCGAGAGTGTGTGGCAGGCCCCAAC
NM_000211.3         GGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCGAGAGTGTGTGGCAGGCCCCAAC
NM_001127491.1      GGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCGAGAGTGTGTGGCAGGCCCCAAC
                    ************************************************************

HsCD00003822        ATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGTGCTGATCGGCATTCTCCTGCTG
NM_000211.3         ATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGTGCTGATCGGCATTCTCCTGCTG
NM_001127491.1      ATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGTGCTGATCGGCATTCTCCTGCTG
                    ************************************************************

HsCD00003822        GTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCGGGAGTACAGGCGCTTTGAGAAG
NM_000211.3         GTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCGGGAGTACAGGCGCTTTGAGAAG
NM_001127491.1      GTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCGGGAGTACAGGCGCTTTGAGAAG
                    ************************************************************

HsCD00003822        GAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCTTTTCAAGAGCGCCACCACGACG
NM_000211.3         GAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCTTTTCAAGAGCGCCACCACGACG
NM_001127491.1      GAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCTTTTCAAGAGCGCCACCACGACG
                    ************************************************************

HsCD00003822        GTCATGAACCCCAAGTTTGCTGAGAGTTTG
NM_000211.3         GTCATGAACCCCAAGTTTGCTGAGAGTTAG
NM_001127491.1      GTCATGAACCCCAAGTTTGCTGAGAGTTAG
                    ****************************:*

Pathways

NCI : amb2 Integrin signaling
NCI : Beta2 integrin cell surface interactions
NCI : CXCR3-mediated signaling events
NCI : HIF-1-alpha transcription factor network
NCI : Integrin family cell surface interactions
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
Panther : Integrin signalling pathway
Reactome : Adaptive Immune System
Reactome : Cell surface interactions at the vascular wall
Reactome : Extracellular matrix organization
Reactome : Hemostasis
Reactome : Immune System
Reactome : Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell
Reactome : Innate Immune System
Reactome : Integrin cell surface interactions
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Focal Adhesion
WikiPathway : Integrin-mediated cell adhesion

Clone

Cloning Information : 23494
HIP Master Clone ID : 53870
Original Clone ID : FLH023494.01L

Organism


TAX_ID : 9606
Species Specific ID: 3689

Genome

Chromosome : 21
Map Location : 21q22.3
Ensembl : ENSG00000160255

Reagents

Labome : CD18-antibody