DNASU Plasmid Repository • 480.965.5697 | Email

SRC (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SRC
Gene Name:  v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
Sequence             
Original Clone ID: FLH181107.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038220

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1611nts         Open reading frame : 1 to 1611
Reference Sequence Alignment

ATGGGTAGCAACAAGAGCAAGCCCAAGGATGCCAGCCAGCGGCGCCGCAGCCTGGAGCCC
GCCGAGAACGTGCACGGCGCTGGCGGGGGCGCTTTCCCCGCCTCGCAGACCCCCAGCAAG
CCAGCCTCGGCCGACGGCCACCGCGGCCCCAGCGCGGCCTTCGCCCCCGCGGCCGCCGAG
CCCAAGCTGTTCGGAGGCTTCAACTCCTCGGACACCGTCACCTCCCCGCAGAGGGCGGGC
CCGCTGGCCGGTGGAGTGACCACCTTTGTGGCCCTCTATGACTATGAGTCTAGGACGGAG
ACAGACCTGTCCTTCAAGAAAGGCGAGCGGCTCCAGATTGTCAACAACACAGAGGGAGAC
TGGTGGCTGGCCCACTCGCTCAGCACAGGACAGACAGGCTACATCCCCAGCAACTACGTG
GCGCCCTCCGACTCCATCCAGGCTGAGGAGTGGTATTTTGGCAAGATCACCAGACGGGAG
TCAGAGCGGTTACTGCTCAATGCAGAGAACCCGAGAGGGACCTTCCTCGTGCGAGAAAGT
GAGACCACGAAAGGTGCCTACTGCCTCTCAGTGTCTGACTTCGACAACGCCAAGGGCCTC
AACGTGAAGCACTACAAGATCCGCAAGCTGGACAGCGGCGGCTTCTACATCACCTCCCGC
ACCCAGTTCAACAGCCTGCAGCAGCTGGTGGCCTACTACTCCAAACACGCCGATGGCCTG
TGCCACCGCCTCACCACCGTGTGCCCCACGTCCAAGCCGCAGACTCAGGGCCTGGCCAAG
GATGCCTGGGAGATCCCTCGGGAGTCGCTGCGGCTGGAGGTCAAGCTGGGCCAGGGCTGC
TTTGGCGAGGTGTGGATGGGGACCTGGAACGGTACCACCAGGGTGGCCATCAAAACCCTG
AAGCCTGGCACGATGTCTCCAGAGGCCTTCCTGCAGGAGGCCCAGGTCATGAAGAAGCTG
AGGCATGAGAAGCTGGTGCAGTTGTATGCTGTGGTTTCAGAGGAGCCCATTTACATCGTC
ACGGAGTACATGAGCAAGGGGAGTTTGCTGGACTTTCTCAAGGGGGAGACAGGCAAGTAC
CTGCGGCTGCCTCAGCTGGTGGACATGGCTGCTCAGATCGCCTCAGGCATGGCGTACGTG
GAGCGGATGAACTACGTCCACCGGGACCTTCGTGCAGCCAACATCCTGGTGGGAGAGAAC
CTGGTGTGCAAAGTGGCCGACTTTGGGCTGGCTCGGCTCATTGAAGACAATGAGTACACG
GCGCGGCAAGGTGCCAAATTCCCCATCAAGTGGACGGCTCCAGAAGCTGCCCTCTATGGC
CGCTTCACCATCAAGTCGGACGTGTGGTCCTTCGGGATCCTGCTGACTGAGCTCACCACA
AAGGGACGGGTGCCCTACCCTGGGATGGTGAACCGCGAGGTGCTGGACCAGGTGGAGCGG
GGCTACCGGATGCCCTGCCCGCCGGAGTGTCCCGAGTCCCTGCACGACCTCATGTGCCAG
TGCTGGCGGAAGGAGCCTGAGGAGCGGCCCACCTTCGAGTACCTGCAGGCCTTCCTGGAG
GACTACTTCACGTCCACCGAGCCCCAGTACCAGCCCGGGGAGAACCTCTTG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1650
Start on reference sequence 40
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SRC
Symbol Nomenclature : SRC
SYNONYM : ASV; SRC1; c-SRC; p60-Src
Designation : proto-oncogene c-Src|proto-oncogene tyrosine-protein kinase Src|protooncogene SRC, Rous sarcoma|tyrosine kinase pp60c-src|tyrosine-protein kinase SRC-1
Full Nomenclature : v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
GENEID : 6714
Locus Tag : RP5-823N20.1
HGNC : 11283
MIM : 190090
Vega : OTTHUMG00000032417
Target GenBank: BC011566

 

Reference Sequence Alignment

  

HsCD00038220      ATGGGTAGCAACAAGAGCAAGCCCAAGGATGCCAGCCAGCGGCGCCGCAGCCTGGAGCCC
NM_198291.2       ATGGGTAGCAACAAGAGCAAGCCCAAGGATGCCAGCCAGCGGCGCCGCAGCCTGGAGCCC
NM_005417.4       ATGGGTAGCAACAAGAGCAAGCCCAAGGATGCCAGCCAGCGGCGCCGCAGCCTGGAGCCC
                  ************************************************************

HsCD00038220      GCCGAGAACGTGCACGGCGCTGGCGGGGGCGCTTTCCCCGCCTCGCAGACCCCCAGCAAG
NM_198291.2       GCCGAGAACGTGCACGGCGCTGGCGGGGGCGCTTTCCCCGCCTCGCAGACCCCCAGCAAG
NM_005417.4       GCCGAGAACGTGCACGGCGCTGGCGGGGGCGCTTTCCCCGCCTCGCAGACCCCCAGCAAG
                  ************************************************************

HsCD00038220      CCAGCCTCGGCCGACGGCCACCGCGGCCCCAGCGCGGCCTTCGCCCCCGCGGCCGCCGAG
NM_198291.2       CCAGCCTCGGCCGACGGCCACCGCGGCCCCAGCGCGGCCTTCGCCCCCGCGGCCGCCGAG
NM_005417.4       CCAGCCTCGGCCGACGGCCACCGCGGCCCCAGCGCGGCCTTCGCCCCCGCGGCCGCCGAG
                  ************************************************************

HsCD00038220      CCCAAGCTGTTCGGAGGCTTCAACTCCTCGGACACCGTCACCTCCCCGCAGAGGGCGGGC
NM_198291.2       CCCAAGCTGTTCGGAGGCTTCAACTCCTCGGACACCGTCACCTCCCCGCAGAGGGCGGGC
NM_005417.4       CCCAAGCTGTTCGGAGGCTTCAACTCCTCGGACACCGTCACCTCCCCGCAGAGGGCGGGC
                  ************************************************************

HsCD00038220      CCGCTGGCCGGTGGAGTGACCACCTTTGTGGCCCTCTATGACTATGAGTCTAGGACGGAG
NM_198291.2       CCGCTGGCCGGTGGAGTGACCACCTTTGTGGCCCTCTATGACTATGAGTCTAGGACGGAG
NM_005417.4       CCGCTGGCCGGTGGAGTGACCACCTTTGTGGCCCTCTATGACTATGAGTCTAGGACGGAG
                  ************************************************************

HsCD00038220      ACAGACCTGTCCTTCAAGAAAGGCGAGCGGCTCCAGATTGTCAACAACACAGAGGGAGAC
NM_198291.2       ACAGACCTGTCCTTCAAGAAAGGCGAGCGGCTCCAGATTGTCAACAACACAGAGGGAGAC
NM_005417.4       ACAGACCTGTCCTTCAAGAAAGGCGAGCGGCTCCAGATTGTCAACAACACAGAGGGAGAC
                  ************************************************************

HsCD00038220      TGGTGGCTGGCCCACTCGCTCAGCACAGGACAGACAGGCTACATCCCCAGCAACTACGTG
NM_198291.2       TGGTGGCTGGCCCACTCGCTCAGCACAGGACAGACAGGCTACATCCCCAGCAACTACGTG
NM_005417.4       TGGTGGCTGGCCCACTCGCTCAGCACAGGACAGACAGGCTACATCCCCAGCAACTACGTG
                  ************************************************************

HsCD00038220      GCGCCCTCCGACTCCATCCAGGCTGAGGAGTGGTATTTTGGCAAGATCACCAGACGGGAG
NM_198291.2       GCGCCCTCCGACTCCATCCAGGCTGAGGAGTGGTATTTTGGCAAGATCACCAGACGGGAG
NM_005417.4       GCGCCCTCCGACTCCATCCAGGCTGAGGAGTGGTATTTTGGCAAGATCACCAGACGGGAG
                  ************************************************************

HsCD00038220      TCAGAGCGGTTACTGCTCAATGCAGAGAACCCGAGAGGGACCTTCCTCGTGCGAGAAAGT
NM_198291.2       TCAGAGCGGTTACTGCTCAATGCAGAGAACCCGAGAGGGACCTTCCTCGTGCGAGAAAGT
NM_005417.4       TCAGAGCGGTTACTGCTCAATGCAGAGAACCCGAGAGGGACCTTCCTCGTGCGAGAAAGT
                  ************************************************************

HsCD00038220      GAGACCACGAAAGGTGCCTACTGCCTCTCAGTGTCTGACTTCGACAACGCCAAGGGCCTC
NM_198291.2       GAGACCACGAAAGGTGCCTACTGCCTCTCAGTGTCTGACTTCGACAACGCCAAGGGCCTC
NM_005417.4       GAGACCACGAAAGGTGCCTACTGCCTCTCAGTGTCTGACTTCGACAACGCCAAGGGCCTC
                  ************************************************************

HsCD00038220      AACGTGAAGCACTACAAGATCCGCAAGCTGGACAGCGGCGGCTTCTACATCACCTCCCGC
NM_198291.2       AACGTGAAGCACTACAAGATCCGCAAGCTGGACAGCGGCGGCTTCTACATCACCTCCCGC
NM_005417.4       AACGTGAAGCACTACAAGATCCGCAAGCTGGACAGCGGCGGCTTCTACATCACCTCCCGC
                  ************************************************************

HsCD00038220      ACCCAGTTCAACAGCCTGCAGCAGCTGGTGGCCTACTACTCCAAACACGCCGATGGCCTG
NM_198291.2       ACCCAGTTCAACAGCCTGCAGCAGCTGGTGGCCTACTACTCCAAACACGCCGATGGCCTG
NM_005417.4       ACCCAGTTCAACAGCCTGCAGCAGCTGGTGGCCTACTACTCCAAACACGCCGATGGCCTG
                  ************************************************************

HsCD00038220      TGCCACCGCCTCACCACCGTGTGCCCCACGTCCAAGCCGCAGACTCAGGGCCTGGCCAAG
NM_198291.2       TGCCACCGCCTCACCACCGTGTGCCCCACGTCCAAGCCGCAGACTCAGGGCCTGGCCAAG
NM_005417.4       TGCCACCGCCTCACCACCGTGTGCCCCACGTCCAAGCCGCAGACTCAGGGCCTGGCCAAG
                  ************************************************************

HsCD00038220      GATGCCTGGGAGATCCCTCGGGAGTCGCTGCGGCTGGAGGTCAAGCTGGGCCAGGGCTGC
NM_198291.2       GATGCCTGGGAGATCCCTCGGGAGTCGCTGCGGCTGGAGGTCAAGCTGGGCCAGGGCTGC
NM_005417.4       GATGCCTGGGAGATCCCTCGGGAGTCGCTGCGGCTGGAGGTCAAGCTGGGCCAGGGCTGC
                  ************************************************************

HsCD00038220      TTTGGCGAGGTGTGGATGGGGACCTGGAACGGTACCACCAGGGTGGCCATCAAAACCCTG
NM_198291.2       TTTGGCGAGGTGTGGATGGGGACCTGGAACGGTACCACCAGGGTGGCCATCAAAACCCTG
NM_005417.4       TTTGGCGAGGTGTGGATGGGGACCTGGAACGGTACCACCAGGGTGGCCATCAAAACCCTG
                  ************************************************************

HsCD00038220      AAGCCTGGCACGATGTCTCCAGAGGCCTTCCTGCAGGAGGCCCAGGTCATGAAGAAGCTG
NM_198291.2       AAGCCTGGCACGATGTCTCCAGAGGCCTTCCTGCAGGAGGCCCAGGTCATGAAGAAGCTG
NM_005417.4       AAGCCTGGCACGATGTCTCCAGAGGCCTTCCTGCAGGAGGCCCAGGTCATGAAGAAGCTG
                  ************************************************************

HsCD00038220      AGGCATGAGAAGCTGGTGCAGTTGTATGCTGTGGTTTCAGAGGAGCCCATTTACATCGTC
NM_198291.2       AGGCATGAGAAGCTGGTGCAGTTGTATGCTGTGGTTTCAGAGGAGCCCATTTACATCGTC
NM_005417.4       AGGCATGAGAAGCTGGTGCAGTTGTATGCTGTGGTTTCAGAGGAGCCCATTTACATCGTC
                  ************************************************************

HsCD00038220      ACGGAGTACATGAGCAAGGGGAGTTTGCTGGACTTTCTCAAGGGGGAGACAGGCAAGTAC
NM_198291.2       ACGGAGTACATGAGCAAGGGGAGTTTGCTGGACTTTCTCAAGGGGGAGACAGGCAAGTAC
NM_005417.4       ACGGAGTACATGAGCAAGGGGAGTTTGCTGGACTTTCTCAAGGGGGAGACAGGCAAGTAC
                  ************************************************************

HsCD00038220      CTGCGGCTGCCTCAGCTGGTGGACATGGCTGCTCAGATCGCCTCAGGCATGGCGTACGTG
NM_198291.2       CTGCGGCTGCCTCAGCTGGTGGACATGGCTGCTCAGATCGCCTCAGGCATGGCGTACGTG
NM_005417.4       CTGCGGCTGCCTCAGCTGGTGGACATGGCTGCTCAGATCGCCTCAGGCATGGCGTACGTG
                  ************************************************************

HsCD00038220      GAGCGGATGAACTACGTCCACCGGGACCTTCGTGCAGCCAACATCCTGGTGGGAGAGAAC
NM_198291.2       GAGCGGATGAACTACGTCCACCGGGACCTTCGTGCAGCCAACATCCTGGTGGGAGAGAAC
NM_005417.4       GAGCGGATGAACTACGTCCACCGGGACCTTCGTGCAGCCAACATCCTGGTGGGAGAGAAC
                  ************************************************************

HsCD00038220      CTGGTGTGCAAAGTGGCCGACTTTGGGCTGGCTCGGCTCATTGAAGACAATGAGTACACG
NM_198291.2       CTGGTGTGCAAAGTGGCCGACTTTGGGCTGGCTCGGCTCATTGAAGACAATGAGTACACG
NM_005417.4       CTGGTGTGCAAAGTGGCCGACTTTGGGCTGGCTCGGCTCATTGAAGACAATGAGTACACG
                  ************************************************************

HsCD00038220      GCGCGGCAAGGTGCCAAATTCCCCATCAAGTGGACGGCTCCAGAAGCTGCCCTCTATGGC
NM_198291.2       GCGCGGCAAGGTGCCAAATTCCCCATCAAGTGGACGGCTCCAGAAGCTGCCCTCTATGGC
NM_005417.4       GCGCGGCAAGGTGCCAAATTCCCCATCAAGTGGACGGCTCCAGAAGCTGCCCTCTATGGC
                  ************************************************************

HsCD00038220      CGCTTCACCATCAAGTCGGACGTGTGGTCCTTCGGGATCCTGCTGACTGAGCTCACCACA
NM_198291.2       CGCTTCACCATCAAGTCGGACGTGTGGTCCTTCGGGATCCTGCTGACTGAGCTCACCACA
NM_005417.4       CGCTTCACCATCAAGTCGGACGTGTGGTCCTTCGGGATCCTGCTGACTGAGCTCACCACA
                  ************************************************************

HsCD00038220      AAGGGACGGGTGCCCTACCCTGGGATGGTGAACCGCGAGGTGCTGGACCAGGTGGAGCGG
NM_198291.2       AAGGGACGGGTGCCCTACCCTGGGATGGTGAACCGCGAGGTGCTGGACCAGGTGGAGCGG
NM_005417.4       AAGGGACGGGTGCCCTACCCTGGGATGGTGAACCGCGAGGTGCTGGACCAGGTGGAGCGG
                  ************************************************************

HsCD00038220      GGCTACCGGATGCCCTGCCCGCCGGAGTGTCCCGAGTCCCTGCACGACCTCATGTGCCAG
NM_198291.2       GGCTACCGGATGCCCTGCCCGCCGGAGTGTCCCGAGTCCCTGCACGACCTCATGTGCCAG
NM_005417.4       GGCTACCGGATGCCCTGCCCGCCGGAGTGTCCCGAGTCCCTGCACGACCTCATGTGCCAG
                  ************************************************************

HsCD00038220      TGCTGGCGGAAGGAGCCTGAGGAGCGGCCCACCTTCGAGTACCTGCAGGCCTTCCTGGAG
NM_198291.2       TGCTGGCGGAAGGAGCCTGAGGAGCGGCCCACCTTCGAGTACCTGCAGGCCTTCCTGGAG
NM_005417.4       TGCTGGCGGAAGGAGCCTGAGGAGCGGCCCACCTTCGAGTACCTGCAGGCCTTCCTGGAG
                  ************************************************************

HsCD00038220      GACTACTTCACGTCCACCGAGCCCCAGTACCAGCCCGGGGAGAACCTCTTG
NM_198291.2       GACTACTTCACGTCCACCGAGCCCCAGTACCAGCCCGGGGAGAACCTCTAG
NM_005417.4       GACTACTTCACGTCCACCGAGCCCCAGTACCAGCCCGGGGAGAACCTCTAG
                  *************************************************:*

Pathways

NCI : Alpha-synuclein signaling
NCI : Alpha4 beta1 integrin signaling events
NCI : Alpha9 beta1 integrin signaling events
NCI : Arf6 signaling events
NCI : Atypical NF-kappaB pathway
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : Class I PI3K signaling events mediated by Akt
NCI : E-cadherin signaling in keratinocytes
NCI : E-cadherin signaling in the nascent adherens junction
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EPHA forward signaling
NCI : EPHA2 forward signaling
NCI : EPHB forward signaling
NCI : Endothelins
NCI : Ephrin B reverse signaling
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : FAS (CD95) signaling pathway
NCI : FGF signaling pathway
NCI : Glypican 1 network
NCI : Integrins in angiogenesis
NCI : Internalization of ErbB1
NCI : LPA receptor mediated events
NCI : Nectin adhesion pathway
NCI : Netrin-mediated signaling events
NCI : Nongenotropic Androgen signaling
NCI : PDGFR-beta signaling pathway
NCI : Plasma membrane estrogen receptor signaling
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Regulation of Androgen receptor activity
NCI : Regulation of p38-alpha and p38-beta
NCI : S1P3 pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PRL
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by TCPTP
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : Syndecan-2-mediated signaling events
NCI : Syndecan-3-mediated signaling events
NCI : Thromboxane A2 receptor signaling
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : amb2 Integrin signaling
Panther : Angiogenesis
Panther : Cadherin signaling pathway
Panther : Integrin signalling pathway
Panther : Parkinson disease
Reactome : ADP signalling through P2Y purinoceptor 1
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : CD28 co-stimulation
Reactome : CTLA4 inhibitory signaling
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Costimulation by the CD28 family
Reactome : DCC mediated attractive signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : FCGR activation
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : GAB1 signalosome
Reactome : GP1b-IX-V activation signalling
Reactome : GRB2:SOS provides linkage to MAPK signaling for Integrins
Reactome : Gap junction trafficking and regulation
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Integrin alphaIIb beta3 signaling
Reactome : L1CAM interactions
Reactome : Membrane Trafficking
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : Netrin mediated repulsion signals
Reactome : Netrin-1 signaling
Reactome : PECAM1 interactions
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Recycling pathway of L1
Reactome : Regulation of KIT signaling
Reactome : Regulation of gap junction activity
Reactome : Signal Transduction
Reactome : Signal amplification
Reactome : Signal regulatory protein (SIRP) family interactions
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Spry regulation of FGF signaling
Reactome : Thrombin signalling through proteinase activated receptors (PARs)
Reactome : c-src mediated regulation of Cx43 function and closure of gap junctions
Reactome : p130Cas linkage to MAPK signaling for integrins
Reactome : p38MAPK events
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : Androgen receptor signaling pathway
WikiPathway : Angiogenesis
WikiPathway : EPO Receptor Signaling
WikiPathway : ErbB signaling pathway
WikiPathway : FSH signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-3 Signaling Pathway
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : Notch Signaling Pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Senescence and Autophagy
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : angiogenesis overview

Clone

Cloning Information : 181107
HIP Master Clone ID : 111566
Original Clone ID : FLH181107.01L

Organism


TAX_ID : 9606
Species Specific ID: 6714

Genome

Chromosome : 20
Map Location : 20q12-q13
Ensembl : ENSG00000197122

Reagents

Labome : Src-antibody