DNASU Plasmid Repository • 480.965.5697 | Email

PRKACG (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRKACG
Gene Name:  protein kinase, cAMP-dependent, catalytic, gamma
Sequence             
Original Clone ID: FLH181111.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038224

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1056nts         Open reading frame : 1 to 1056
Reference Sequence Alignment

ATGGGCAACGCCCCCGCCAAGAAGGACACCGAGCAGGAGGAGAGCGTGAACGAGTTCCTA
GCCAAAGCCAGAGGAGATTTCCTCTACAGATGGGGAAACCCCGCTCAAAACACCGCCAGC
TCGGATCAGTTCGAACGGCTCAGGACGCTGGGCATGGGCTCCTTCGGGCGGGTGATGCTG
GTGAGGCACCAGGAGACCGGCGGCCACTACGCCATGAAGATCCTCAACAAGCAGAAGGTG
GTGAAGATGAAGCAGGTCGAGCACATACTGAACGAGAAGCGCATCCTGCAGGCGATCGAC
TTTCCGTTCCTCGTCAAGCTCCAGTTCTCCTTTAAGGACAACTCCTACCTGTACCTGGTG
ATGGAGTACGTGCCGGGTGGGGAGATGTTCTCCCGCCTACAGCGCGTCGGAAGGTTTAGC
GAGCCCCATGCCTGTTTCTATGCCGCCCAGGTCGTCCTGGCCGTCCAGTACCTACACTCG
CTCGACCTCATCCACCGCGACCTGAAGCCCGAGAATCTCCTCATCGACCAGCAGGGCTAC
CTGCAGGTGACGGACTTCGGTTTCGCCAAGCGCGTGAAGGGCCGCACTTGGACCTTGTGC
GGGACCCCAGAGTACCTGGCCCCCGAGATCATCCTGAGCAAAGGCTACAACAAGGCCGTG
GACTGGTGGGCCCTAGGGGTGCTCATCTATGAGATGGCCGTGGGCTTCCCACCCTTCTAC
GCCGACCAGCCCATCCAGATCTACGAGAAGATCGTCTCTGGGAGGGTGCGGTTTCCCTCC
AAACTCAGCTCTGACCTCAAGCATCTGCTGCGGAGCCTGCTGCAGGTGGACCTCACCAAG
CGCTTCGGAAACCTCAGGAACGGGGTTGGCGACATCAAGAACCACAAGTGGTTCGCCACA
ACCAGCTGGATCGCCATCTATGAGAAGAAGGTGGAAGCTCCCTTCATCCCGAAGTACACA
GGCCCTGGGGATGCCAGTAACTTTGACGACTACGAGGAGGAAGAGCTCCGGATCTCCATC
AATGAGAAGTGTCCCAAGGAGTTTTCTGAGTTTTAG


Coding Sequence Details
Insert Sequence Verified?: N Verification Method: Insert was fully sequenced in parent vector
Reference Sequence Annotations:
End on reference sequence 1087
Start on reference sequence 32
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRKACG
Symbol Nomenclature : PRKACG
SYNONYM : KAPG; PKACg
Designation : PKA C-gamma|cAMP-dependent protein kinase catalytic subunit gamma|serine(threonine) protein kinase
Full Nomenclature : protein kinase, cAMP-dependent, catalytic, gamma
GENEID : 5568
HGNC : 9382
MIM : 176893
Vega : OTTHUMG00000019974
Target GenBank: BC039888

 

Reference Sequence Alignment

  

HsCD00038224      ATGGGCAACGCCCCCGCCAAGAAGGACACCGAGCAGGAGGAGAGCGTGAACGAGTTCCTA
NM_002732.3       ATGGGCAACGCCCCCGCCAAGAAGGACACCGAGCAGGAGGAGAGCGTGAACGAGTTCCTA
                  ************************************************************

HsCD00038224      GCCAAAGCCAGAGGAGATTTCCTCTACAGATGGGGAAACCCCGCTCAAAACACCGCCAGC
NM_002732.3       GCCAAAGCCAGAGGAGATTTCCTCTACAGATGGGGAAACCCCGCTCAAAACACCGCCAGC
                  ************************************************************

HsCD00038224      TCGGATCAGTTCGAACGGCTCAGGACGCTGGGCATGGGCTCCTTCGGGCGGGTGATGCTG
NM_002732.3       TCGGATCAGTTCGAACGGCTCAGGACGCTGGGCATGGGCTCCTTCGGGCGGGTGATGCTG
                  ************************************************************

HsCD00038224      GTGAGGCACCAGGAGACCGGCGGCCACTACGCCATGAAGATCCTCAACAAGCAGAAGGTG
NM_002732.3       GTGAGGCACCAGGAGACCGGCGGCCACTACGCCATGAAGATCCTCAACAAGCAGAAGGTG
                  ************************************************************

HsCD00038224      GTGAAGATGAAGCAGGTCGAGCACATACTGAACGAGAAGCGCATCCTGCAGGCGATCGAC
NM_002732.3       GTGAAGATGAAGCAGGTCGAGCACATACTGAACGAGAAGCGCATCCTGCAGGCGATCGAC
                  ************************************************************

HsCD00038224      TTTCCGTTCCTCGTCAAGCTCCAGTTCTCCTTTAAGGACAACTCCTACCTGTACCTGGTG
NM_002732.3       TTTCCGTTCCTCGTCAAGCTCCAGTTCTCCTTTAAGGACAACTCCTACCTGTACCTGGTG
                  ************************************************************

HsCD00038224      ATGGAGTACGTGCCGGGTGGGGAGATGTTCTCCCGCCTACAGCGCGTCGGAAGGTTTAGC
NM_002732.3       ATGGAGTACGTGCCGGGTGGGGAGATGTTCTCCCGCCTACAGCGCGTCGGAAGGTTTAGC
                  ************************************************************

HsCD00038224      GAGCCCCATGCCTGTTTCTATGCCGCCCAGGTCGTCCTGGCCGTCCAGTACCTACACTCG
NM_002732.3       GAGCCCCATGCCTGTTTCTATGCCGCCCAGGTCGTCCTGGCCGTCCAGTACCTACACTCG
                  ************************************************************

HsCD00038224      CTCGACCTCATCCACCGCGACCTGAAGCCCGAGAATCTCCTCATCGACCAGCAGGGCTAC
NM_002732.3       CTCGACCTCATCCACCGCGACCTGAAGCCCGAGAATCTCCTCATCGACCAGCAGGGCTAC
                  ************************************************************

HsCD00038224      CTGCAGGTGACGGACTTCGGTTTCGCCAAGCGCGTGAAGGGCCGCACTTGGACCTTGTGC
NM_002732.3       CTGCAGGTGACGGACTTCGGTTTCGCCAAGCGCGTGAAGGGCCGCACTTGGACCTTGTGC
                  ************************************************************

HsCD00038224      GGGACCCCAGAGTACCTGGCCCCCGAGATCATCCTGAGCAAAGGCTACAACAAGGCCGTG
NM_002732.3       GGGACCCCAGAGTACCTGGCCCCCGAGATCATCCTGAGCAAAGGCTACAACAAGGCCGTG
                  ************************************************************

HsCD00038224      GACTGGTGGGCCCTAGGGGTGCTCATCTATGAGATGGCCGTGGGCTTCCCACCCTTCTAC
NM_002732.3       GACTGGTGGGCCCTAGGGGTGCTCATCTATGAGATGGCCGTGGGCTTCCCACCCTTCTAC
                  ************************************************************

HsCD00038224      GCCGACCAGCCCATCCAGATCTACGAGAAGATCGTCTCTGGGAGGGTGCGGTTTCCCTCC
NM_002732.3       GCCGACCAGCCCATCCAGATCTACGAGAAGATCGTCTCTGGGAGGGTGCGGTTTCCCTCC
                  ************************************************************

HsCD00038224      AAACTCAGCTCTGACCTCAAGCATCTGCTGCGGAGCCTGCTGCAGGTGGACCTCACCAAG
NM_002732.3       AAACTCAGCTCTGACCTCAAGCATCTGCTGCGGAGCCTGCTGCAGGTGGACCTCACCAAG
                  ************************************************************

HsCD00038224      CGCTTCGGAAACCTCAGGAACGGGGTTGGCGACATCAAGAACCACAAGTGGTTCGCCACA
NM_002732.3       CGCTTCGGAAACCTCAGGAACGGGGTTGGCGACATCAAGAACCACAAGTGGTTCGCCACA
                  ************************************************************

HsCD00038224      ACCAGCTGGATCGCCATCTATGAGAAGAAGGTGGAAGCTCCCTTCATCCCGAAGTACACA
NM_002732.3       ACCAGCTGGATCGCCATCTATGAGAAGAAGGTGGAAGCTCCCTTCATCCCGAAGTACACA
                  ************************************************************

HsCD00038224      GGCCCTGGGGATGCCAGTAACTTTGACGACTACGAGGAGGAAGAGCTCCGGATCTCCATC
NM_002732.3       GGCCCTGGGGATGCCAGTAACTTTGACGACTACGAGGAGGAAGAGCTCCGGATCTCCATC
                  ************************************************************

HsCD00038224      AATGAGAAGTGTCCCAAGGAGTTTTCTGAGTTTTAG
NM_002732.3       AATGAGAAGTGTGCCAAGGAGTTTTCTGAGTTTTAG
                  ************ ***********************

Pathways

NCI : GMCSF-mediated signaling events
NCI : Glucocorticoid receptor regulatory network
NCI : IL3-mediated signaling events
Panther : 5HT1 type receptor mediated signaling pathway
Panther : Beta1 adrenergic receptor signaling pathway
Panther : Beta2 adrenergic receptor signaling pathway
Panther : Dopamine receptor mediated signaling pathway
Panther : Endothelin signaling pathway
Panther : Enkephalin release
Panther : GABA-B receptor II signaling
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Heterotrimeric G-protein signaling pathway-rod outer segment phototransduction
Panther : Histamine H2 receptor mediated signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Metabotropic glutamate receptor group I pathway
Panther : Metabotropic glutamate receptor group II pathway
Panther : Metabotropic glutamate receptor group III pathway
Panther : Muscarinic acetylcholine receptor 2 and 4 signaling pathway
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Adaptive Immune System
Reactome : Aquaporin-mediated transport
Reactome : CREB phosphorylation through the activation of Adenylate Cyclase
Reactome : Ca-dependent events
Reactome : CaM pathway
Reactome : Calmodulin induced events
Reactome : Cytokine Signaling in Immune system
Reactome : DAG and IP3 signaling
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : DARPP-32 events
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : G-protein mediated events
Reactome : Glucagon signaling in metabolic regulation
Reactome : Glucagon-like Peptide-1 (GLP1) regulates insulin secretion
Reactome : Gluconeogenesis
Reactome : Glucose metabolism
Reactome : Glycogen storage diseases
Reactome : Hemostasis
Reactome : Hormone-sensitive lipase (HSL)-mediated triacylglycerol hydrolysis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Integration of energy metabolism
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Lipid digestion, mobilization, and transport
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Metabolism of lipids and lipoproteins
Reactome : Myoclonic epilepsy of Lafora
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Opioid Signalling
Reactome : PKA activation
Reactome : PKA activation in glucagon signalling
Reactome : PKA-mediated phosphorylation of CREB
Reactome : PKA-mediated phosphorylation of key metabolic factors
Reactome : PLC beta mediated events
Reactome : PLC-gamma1 signalling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Post NMDA receptor activation events
Reactome : Rap1 signalling
Reactome : Regulation of insulin secretion
Reactome : Regulation of water balance by renal Aquaporins
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signalling by NGF
Reactome : Transmembrane transport of small molecules
Reactome : Transmission across Chemical Synapses
WikiPathway : AMPK signaling
WikiPathway : G Protein Signaling Pathways
WikiPathway : miRs in Muscle Cell Differentiation

Clone

Cloning Information : 181111
HIP Master Clone ID : 116483
Original Clone ID : FLH181111.01X

Organism


TAX_ID : 9606
Species Specific ID: 5568

Genome

Chromosome : 9
Map Location : 9q13
Ensembl : ENSG00000165059

Reagents

Labome : PRKACG-antibody