DNASU Plasmid Repository • 480.965.5697 | Email

LCK (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  LCK
Gene Name:  lymphocyte-specific protein tyrosine kinase
Original Clone ID: FLH204909.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1530nts        
Open reading frame : 1 to 1530
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1581
Start on reference sequence 52

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : LCK
Symbol Nomenclature : LCK
SYNONYM : LSK; YT16; p56lck; pp58lck
Designation : T-lymphocyte specific protein tyrosine kinase p56lck|leukocyte C-terminal Src kinase|lymphocyte cell-specific protein-tyrosine kinase|p56(LSTRA) protein-tyrosine kinase|proto-oncogene tyrosine-protein kinase LCK|t cell-specific protein-tyrosine kinase|tyrosine-protein kinase Lck
Full Nomenclature : lymphocyte-specific protein tyrosine kinase
GENEID : 3932
Locus Tag : RP4-675E8.4
HGNC : 6524
MIM : 153390
Vega : OTTHUMG00000007463
Target GenBank: NM_005356


Reference Sequence Alignment





HsCD00038248        CTGCAAG-----------------------------------------------------

HsCD00038248        ------------------------------------------------------------

HsCD00038248        ------------------------------------------------------------























                    ********************** .


NCI : Alpha-synuclein signaling
NCI : amb2 Integrin signaling
NCI : Atypical NF-kappaB pathway
NCI : Class I PI3K signaling events
NCI : CXCR4-mediated signaling events
NCI : EPHA forward signaling
NCI : Ephrin B reverse signaling
NCI : Glypican 1 network
NCI : IL12-mediated signaling events
NCI : IL2 signaling events mediated by PI3K
NCI : IL2 signaling events mediated by STAT5
NCI : IL2-mediated signaling events
NCI : PDGFR-beta signaling pathway
NCI : Regulation of p38-alpha and p38-beta
NCI : SHP2 signaling
NCI : Signaling events mediated by PTP1B
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : Thromboxane A2 receptor signaling
Panther : Parkinson disease
Panther : T cell activation
Reactome : Adaptive Immune System
Reactome : CD28 co-stimulation
Reactome : CD28 dependent PI3K/Akt signaling
Reactome : CD28 dependent Vav1 pathway
Reactome : Cell surface interactions at the vascular wall
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : CTLA4 inhibitory signaling
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Downstream TCR signaling
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : Generation of second messenger molecules
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : HIV Infection
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-2 signaling
Reactome : Nef and signal transduction
Reactome : Nef Mediated CD4 Down-regulation
Reactome : Nef-mediates down modulation of cell surface receptors by recruiting them to clathrin adapters
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PD-1 signaling
Reactome : PECAM1 interactions
Reactome : Phosphorylation of CD3 and TCR zeta chains
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT activation
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PIP3 activates AKT signaling
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of KIT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : TCR signaling
Reactome : The role of Nef in HIV-1 replication and disease pathogenesis
Reactome : Translocation of ZAP-70 to Immunological synapse
WikiPathway : IL-2 Signaling pathway
WikiPathway : Inflammatory Response Pathway
WikiPathway : Notch Signaling Pathway


Cloning Information : 204909
HIP Master Clone ID : 14591
Original Clone ID : FLH204909.01L


TAX_ID : 9606
Species Specific ID: 3932


Chromosome : 1
Map Location : 1p34.3
Ensembl : ENSG00000182866


Labome : Lck-antibody