DNASU Plasmid Repository • 480.965.5697 | Email

Ndufv1 (Mus musculus) in pMH4 (bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  Ndufv1
Gene Name:  NADH dehydrogenase (ubiquinone) flavoprotein 1
Sequence             
Original Clone ID: 11924
Keyword: full-length cds
Species: Mus musculus
Type: cDNA
Vector Name: pMH4               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: Linker not verified.
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Joint Center for Structural Genomics
MmCD00382505

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1395nts         Open reading frame : 34 to 1428

GGATCTGATAAAATTCATCATCATCATCATCACATGCTAGCGGCACGGCATTTTCTCGGC
GGGTTGGTTCCCGTGCGGGTATCTGTGCGTTTCAGCAGCGGCACGACAGCACCCAAGAAA
ACCTCATTTGGCTCACTGAAGGATGAAGACCGGATCTTTACCAACCTGTATGGGCGCCAT
GACTGGAGGCTGAAAGGTGCCCTGAGACGGGGTGACTGGTACAAGACAAAGGAGATCCTG
CTGAAGGGGCCTGACTGGATCTTGGGTGAGATGAAGACATCAGGTTTACGGGGCCGTGGT
GGTGCTGGCTTCCCCACTGGCCTCAAGTGGAGCTTCATGAATAAGCCCTCAGATGGCAGG
CCCAAGTATCTGGTGGTGAATGCTGACGAGGGAGAGCCAGGCACCTGTAAGGACCGAGAG
ATCATGCGTCATGACCCTCACAAGCTGGTGGAAGGCTGCCTTGTGGGAGGCCGGGCCATG
GGAGCCCGGGCCGCCTATATCTACATCCGAGGGGAATTCTACAACGAGGCCTCCAATTTG
CAGGTAGCTATCCGAGAGGCCTATGAAGCAGGTCTGATTGGCAAGAATGCTTGTGGCTCC
GACTATGATTTTGATGTGTTTGTGGTGCGTGGGGCTGGGGCCTACATCTGTGGAGAAGAG
ACGGCACTTATTGAATCCATTGAAGGCAAGCAGGGAAAGCCACGCCTGAAGCCGCCCTTT
CCAGCAGATGTGGGAGTGTTTGGATGCCCCACAACTGTGGCCAATGTGGAGACAGTGGCT
GTGTCCCCCACCATTTGCCGTCGTGGGGGCACCTGGTTTGCTGGCTTTGGCCGAGAACGC
AATTCAGGTACCAAATTGTTTAACATCTCTGGCCATGTCAACCACCCCTGCACTGTGGAG
GAAGAGATGTCTGTGCCACTGAAAGAGCTGATTGAGAAACATGCTGGTGGTGTCACAGGT
GGCTGGGACAACCTCCTTGCTGTGATTCCTGGTGGCTCATCTACTCCACTGATTCCCAAA
TCTGTGTGTGAGACCGTGCTAATGGACTTCGATGCACTGGTGCAGGCTCAGACAGGCCTG
GGCACGGCTGCAGTTATTGTTATGGATCGCTCGACAGACATTGTGAAAGCCATCGCTCGT
CTCATTGAGTTCTACAAGCATGAGAGCTGTGGCCAGTGTACCCCGTGCCGTGAGGGCGTT
GACTGGATGAACAAGGTGATGGCCCGATTTGTGAAGGGAGATGCCCGGCCAGCTGAGATT
GACTCCCTGTGGGAGATCAGCAAGCAGATAGAAGGCCACACCATTTGTGCTCTGGGTGAT
GGGGCTGCCTGGCCAGTACAGGGTCTGATCCGACATTTCAGGCCAGAGCTTGAGGATCGG
ATGCAACGGTTTGCCCAGCAGCACCGGGCCTGGCAGGCAGCCTCGTGACGGGACTTAATT
AACTCTAGATAACTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCAC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Not_Applicable
ProteinPurified: Protein_Purified
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in 354818
Recommended expression in: BL21Gold(DE3)pLysS
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMH4

pMH4 in advanced viewed

Synonyms: pMH-4
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial expression vector, arabinose or T7 induced expression, adds N-terminal MGSDKIHHHHHH tag; amp resistance; restriction enyzme (Pml I/Pac I) or PIPE cloning.
Comments: None
Size (bp): 5489
Parent Vector: None
Empty Vector: None
Properties: PIPE cloning, bacterial expression, in vitro transcription, inducible expression, with tag/fusion/marker
Author Name: Joint Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1 bacterial origin of replication 3331 4013
inducible trxn activator protein gene araC araC cds 5463 4585
negative selection marker ccdB ccdB negative selection gene (may be gone in with-insert form) 1576 1785
promoter T7 T7 promoter 290 310
promoter araC araC promoter 153 124
selectable marker CmR chloramphenicol resistance gene (CmR) 484 1140
selectable marker AmpR ampicillin resistance gene 2574 3233
tag His N-terminal 6xHis tag 364 381
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn termination sequence rrnB rrnB T2 transcription terminator 2238 2264

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : Ndufv1
Symbol Nomenclature : Ndufv1
SYNONYM : CI-51kD
Designation : NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial|NADH dehydrogenase flavoprotein 1; 24 kDa (FP)|NADH-ubiquinone oxidoreductase 51 kDa subunit|complex I-51kD
Full Nomenclature : NADH dehydrogenase (ubiquinone) flavoprotein 1
GENEID : 17995
GI : 19526814
GenBank Accession : NM_133666
Mouse Genome Informatics : 107851
Vega : OTTMUSG00000034058
Target GenBank: None

 

Clone

Cloning Information : 278477
HIP Master Clone ID : 207963
Original Clone ID : 11924

Experimental

TargetTrack - Experimental data : 354818

Organism


TAX_ID : 10090
Species Specific ID: 17995

Genome

Chromosome : 19
Map Location : 19 A|19 3.72 cM
Ensembl : ENSMUSG00000037916

Reagents

Labome : Ndufv1-antibody