DNASU Plasmid Repository • 480.965.5697 | Email

MAPK14 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPK14
Gene Name:  mitogen-activated protein kinase 14
Sequence             
Original Clone ID: FLH204930.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038268

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1083nts         Open reading frame : 1 to 1083
Reference Sequence Alignment

ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGGGAGGTG
CCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCTCTGTGTGTGCT
GCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCTCTCCAGACCATTTCAG
TCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGGTTACTTAAACATATGAAACAT
GAAAATGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAATTCAAT
GATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACAACATTGTGAAATGTCAG
AAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCAAATTCTCCGAGGTCTAAAGTAT
ATACATTCAGCTGACATAATTCACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAA
GACTGTGAGCTGAAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACA
GGCTACGTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTAC
AACCAGACAGTTGATATTTGGTCAGTGGGATGCATAATGGCCGAGCTGTTGACTGGAAGA
ACATTGTTTCCTGGTACAGACCATATTGATCAGTTGAAGCTCATTTTAAGACTCGTTGGA
ACCCCAGGGGCTGAGCTTTTGAAGAAAATCTCCTCAGAGTCTGCAAGAAACTATATTCAG
TCTTTGACTCAGATGCCGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTG
GCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCC
CAAGCCCTTGCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGAACCAGTGGCC
GATCCTTATGATCAGTCCTTTGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTG
ACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCC
TTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1421
Start on reference sequence 339
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAPK14
Symbol Nomenclature : MAPK14
SYNONYM : CSBP; CSBP1; CSBP2; CSPB1; EXIP; Mxi2; PRKM14; PRKM15; RK; SAPK2A; p38; p38ALPHA
Designation : CSAID-binding protein|Csaids binding protein|MAP kinase 14|MAP kinase Mxi2|MAP kinase p38 alpha|MAX-interacting protein 2|cytokine suppressive anti-inflammatory drug binding protein|cytokine suppressive anti-inflammatory drug-binding protein|mitogen-activated protein kinase p38 alpha|p38 MAP kinase|p38 mitogen activated protein kinase|p38alpha Exip|stress-activated protein kinase 2A
Full Nomenclature : mitogen-activated protein kinase 14
GENEID : 1432
Locus Tag : RP1-179N16.5
HGNC : 6876
MIM : 600289
Vega : OTTHUMG00000159806
Target GenBank: BC000092

 

Reference Sequence Alignment

  

HsCD00038268      ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGGGAGGTG
NM_139012.2       ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGGGAGGTG
NM_001315.2       ATGTCTCAGGAGAGGCCCACGTTCTACCGGCAGGAGCTGAACAAGACAATCTGGGAGGTG
                  ************************************************************

HsCD00038268      CCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCTCTGTGTGTGCT
NM_139012.2       CCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCTCTGTGTGTGCT
NM_001315.2       CCCGAGCGTTACCAGAACCTGTCTCCAGTGGGCTCTGGCGCCTATGGCTCTGTGTGTGCT
                  ************************************************************

HsCD00038268      GCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCTCTCCAGACCATTTCAG
NM_139012.2       GCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCTCTCCAGACCATTTCAG
NM_001315.2       GCTTTTGACACAAAAACGGGGTTACGTGTGGCAGTGAAGAAGCTCTCCAGACCATTTCAG
                  ************************************************************

HsCD00038268      TCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGGTTACTTAAACATATGAAACAT
NM_139012.2       TCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGGTTACTTAAACATATGAAACAT
NM_001315.2       TCCATCATTCATGCGAAAAGAACCTACAGAGAACTGCGGTTACTTAAACATATGAAACAT
                  ************************************************************

HsCD00038268      GAAAATGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAATTCAAT
NM_139012.2       GAAAATGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAATTCAAT
NM_001315.2       GAAAATGTGATTGGTCTGTTGGACGTTTTTACACCTGCAAGGTCTCTGGAGGAATTCAAT
                  ************************************************************

HsCD00038268      GATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACAACATTGTGAAATGTCAG
NM_139012.2       GATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACAACATTGTGAAATGTCAG
NM_001315.2       GATGTGTATCTGGTGACCCATCTCATGGGGGCAGATCTGAACAACATTGTGAAATGTCAG
                  ************************************************************

HsCD00038268      AAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCAAATTCTCCGAGGTCTAAAGTAT
NM_139012.2       AAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCAAATTCTCCGAGGTCTAAAGTAT
NM_001315.2       AAGCTTACAGATGACCATGTTCAGTTCCTTATCTACCAAATTCTCCGAGGTCTAAAGTAT
                  ************************************************************

HsCD00038268      ATACATTCAGCTGACATAATTCACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAA
NM_139012.2       ATACATTCAGCTGACATAATTCACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAA
NM_001315.2       ATACATTCAGCTGACATAATTCACAGGGACCTAAAACCTAGTAATCTAGCTGTGAATGAA
                  ************************************************************

HsCD00038268      GACTGTGAGCTGAAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACA
NM_139012.2       GACTGTGAGCTGAAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACA
NM_001315.2       GACTGTGAGCTGAAGATTCTGGATTTTGGACTGGCTCGGCACACAGATGATGAAATGACA
                  ************************************************************

HsCD00038268      GGCTACGTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTAC
NM_139012.2       GGCTACGTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTAC
NM_001315.2       GGCTACGTGGCCACTAGGTGGTACAGGGCTCCTGAGATCATGCTGAACTGGATGCATTAC
                  ************************************************************

HsCD00038268      AACCAGACAGTTGATATTTGGTCAGTGGGATGCATAATGGCCGAGCTGTTGACTGGAAGA
NM_139012.2       AACCAGACAGTTGATATTTGGTCAGTGGGATGCATAATGGCCGAGCTGTTGACTGGAAGA
NM_001315.2       AACCAGACAGTTGATATTTGGTCAGTGGGATGCATAATGGCCGAGCTGTTGACTGGAAGA
                  ************************************************************

HsCD00038268      ACATTGTTTCCTGGTACAGACCATATTGATCAGTTGAAGCTCATTTTAAGACTCGTTGGA
NM_139012.2       ACATTGTTTCCTGGTACAGACCATATTGATCAGTTGAAGCTCATTTTAAGACTCGTTGGA
NM_001315.2       ACATTGTTTCCTGGTACAGACCATATTAACCAGCTTCAGCAGATTATGCGTCTGACAGGA
                  ***************************.* *** * .***: ***:*..*:** . :***

HsCD00038268      ACCCCAGGGGCTGAGCTTTTGAAGAAAATCTCCTCAGAGTCTGCAAGAAACTATATTCAG
NM_139012.2       ACCCCAGGGGCTGAGCTTTTGAAGAAAATCTCCTCAGAGTCTGCAAGAAACTATATTCAG
NM_001315.2       ACACCCCCCGCTTATCTCATTAACAGGATGCCAAGCCATGAGGCAAGAAACTATATTCAG
                  **.**.   *** * ** :* ** *..**  *.: . *  . ******************

HsCD00038268      TCTTTGACTCAGATGCCGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTG
NM_139012.2       TCTTTGACTCAGATGCCGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTG
NM_001315.2       TCTTTGACTCAGATGCCGAAGATGAACTTTGCGAATGTATTTATTGGTGCCAATCCCCTG
                  ************************************************************

HsCD00038268      GCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCC
NM_139012.2       GCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCC
NM_001315.2       GCTGTCGACTTGCTGGAGAAGATGCTTGTATTGGACTCAGATAAGAGAATTACAGCGGCC
                  ************************************************************

HsCD00038268      CAAGCCCTTGCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGAACCAGTGGCC
NM_139012.2       CAAGCCCTTGCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGAACCAGTGGCC
NM_001315.2       CAAGCCCTTGCACATGCCTACTTTGCTCAGTACCACGATCCTGATGATGAACCAGTGGCC
                  ************************************************************

HsCD00038268      GATCCTTATGATCAGTCCTTTGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTG
NM_139012.2       GATCCTTATGATCAGTCCTTTGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTG
NM_001315.2       GATCCTTATGATCAGTCCTTTGAAAGCAGGGACCTCCTTATAGATGAGTGGAAAAGCCTG
                  ************************************************************

HsCD00038268      ACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCC
NM_139012.2       ACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCC
NM_001315.2       ACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAGATGGAGTCC
                  ************************************************************

HsCD00038268      TTG
NM_139012.2       TGA
NM_001315.2       TGA
                  * .

Pathways

NCI : ATF-2 transcription factor network
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Atypical NF-kappaB pathway
NCI : BCR signaling pathway
NCI : CD40/CD40L signaling
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : EPO signaling pathway
NCI : Endothelins
NCI : FAS (CD95) signaling pathway
NCI : FGF signaling pathway
NCI : Glucocorticoid receptor regulatory network
NCI : IL12-mediated signaling events
NCI : IL2-mediated signaling events
NCI : IL4-mediated signaling events
NCI : IL6-mediated signaling events
NCI : RAC1 signaling pathway
NCI : Rapid glucocorticoid signaling
NCI : Regulation of Androgen receptor activity
NCI : Regulation of p38-alpha and p38-beta
NCI : Regulation of retinoblastoma protein
NCI : Retinoic acid receptors-mediated signaling
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : S1P2 pathway
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling mediated by p38-alpha and p38-beta
NCI : Thromboxane A2 receptor signaling
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : p38 MAPK signaling pathway
NCI : p38 signaling mediated by MAPKAP kinases
NCI : p53 pathway
NCI : p73 transcription factor network
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Angiogenesis
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Interferon-gamma signaling pathway
Panther : Oxidative stress response
Panther : Parkinson disease
Panther : Ras Pathway
Panther : TGF-beta signaling pathway
Panther : Toll receptor signaling pathway
Panther : VEGF signaling pathway
Panther : p38 MAPK pathway
Panther : p53 pathway feedback loops 2
Reactome : ADP signalling through P2Y purinoceptor 1
Reactome : Activated TLR4 signalling
Reactome : Activation of PPARGC1A (PGC-1alpha) by phosphorylation
Reactome : Activation of the AP-1 family of transcription factors
Reactome : CDO in myogenesis
Reactome : Cell-Cell communication
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : DSCAM interactions
Reactome : Developmental Biology
Reactome : ERK/MAPK targets
Reactome : Gene Expression
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : KSRP destabilizes mRNA
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Mitochondrial biogenesis
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Myogenesis
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Organelle biogenesis and maintenance
Reactome : Oxidative Stress Induced Senescence
Reactome : Platelet activation, signaling and aggregation
Reactome : Platelet homeostasis
Reactome : Platelet sensitization by LDL
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Signal Transduction
Reactome : Signal amplification
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
Reactome : p38MAPK events
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Energy Metabolism
WikiPathway : Epithelium TarBase
WikiPathway : Estrogen signaling pathway
WikiPathway : FSH signaling pathway
WikiPathway : IL-1 signaling pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : Leukocyte TarBase
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Monoamine Transport
WikiPathway : Muscle cell TarBase
WikiPathway : Oxidative Stress
WikiPathway : Physiological and Pathological Hypertrophy of the Heart
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Senescence and Autophagy
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : angiogenesis overview
WikiPathway : p38 MAPK Signaling Pathway

Clone

Cloning Information : 204930
HIP Master Clone ID : 54022
Original Clone ID : FLH204930.01L

Organism


TAX_ID : 9606
Species Specific ID: 1432

Genome

Chromosome : 6
Map Location : 6p21.3-p21.2
Ensembl : ENSG00000112062

Reagents

Labome : p38-antibody