DNASU Plasmid Repository • 480.965.5697 | Email

CDC2 (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  CDK1
Gene Name:  cyclin-dependent kinase 1
Original Clone ID: FLH204931.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 894nts         Open reading frame : 1 to 894
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 907
Start on reference sequence 14
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : CDK1
Symbol Nomenclature : CDK1
Designation : cell cycle controller CDC2|cell division control protein 2 homolog|cell division cycle 2, G1 to S and G2 to M|cell division protein kinase 1|p34 protein kinase
Full Nomenclature : cyclin-dependent kinase 1
GENEID : 983
HGNC : 1722
MIM : 116940
Vega : OTTHUMG00000018290
Target GenBank: BC014563


Reference Sequence Alignment


















NCI : AP-1 transcription factor network
NCI : E2F transcription factor network
NCI : FOXM1 transcription factor network
NCI : PLK1 signaling events
NCI : Retinoic acid receptors-mediated signaling
NCI : p73 transcription factor network
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of Cyclin B
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : ARMS-mediated activation
Reactome : Activated TLR4 signalling
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of NIMA Kinases NEK9, NEK6, NEK7
Reactome : Axon guidance
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Centrosome maturation
Reactome : Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex
Reactome : Condensation of Prometaphase Chromosomes
Reactome : Condensation of Prophase Chromosomes
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : Cyclin B2 mediated events
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Depolymerisation of the Nuclear Lamina
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : E2F mediated regulation of DNA replication
Reactome : E2F-enabled inhibition of pre-replication complex formation
Reactome : ERK activation
Reactome : ERK1 activation
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Frs2-mediated activation
Reactome : G0 and Early G1
Reactome : G1/S Transition
Reactome : G1/S-Specific Transcription
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : G2/M DNA replication checkpoint
Reactome : G2/M Transition
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Golgi Cisternae Pericentriolar Stack Reorganization
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin-2 signaling
Reactome : Loss of Nlp from mitotic centrosomes
Reactome : Loss of proteins required for interphase microtubule organizationÿ from the centrosome
Reactome : M Phase
Reactome : MAP kinase activation in TLR cascade
Reactome : MASTL Facilitates Mitotic Progression
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prometaphase
Reactome : Mitotic Prophase
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear Envelope Breakdown
Reactome : Nuclear Pore Complex (NPC) Disassembly
Reactome : Phosphorylation of Emi1
Reactome : Phosphorylation of proteins involved in the G2/M transition by Cyclin A:Cdc2 complexes
Reactome : Phosphorylation of the APC/C
Reactome : Prolonged ERK activation events
Reactome : RAF/MAP kinase cascade
Reactome : Recruitment of NuMA to mitotic centrosomes
Reactome : Recruitment of mitotic centrosome proteins and complexes
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Regulation of mitotic cell cycle
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : Integrated Cancer pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : miRNA regulation of DNA Damage Response


SMART domain : TyrKc : Tyrosine kinase, catalytic domain
SMART domain : S_TKc : Serine/Threonine protein kinases, catalytic domain
UniProt : P06493
UniProt : B7Z3D6
HPRD : 00302


Cloning Information : 204931
HIP Master Clone ID : 56925
Original Clone ID : FLH204931.01L


TAX_ID : 9606
Species Specific ID: 983


Chromosome : 10
Map Location : 10q21.1
Ensembl : ENSG00000170312


Labome : Cdc2-antibody