DNASU Plasmid Repository • 480.965.5697 | Email

MAP3K7 (Homo sapiens) in pJP1520 (retroviral expression vector)


Explanation of Terms

Gene: Gene Symbol:  MAP3K7
Gene Name:  mitogen-activated protein kinase kinase kinase 7
Original Clone ID: FLH205044.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: None

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 1821nts         Open reading frame : 1 to 1821
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1902
Start on reference sequence 163

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : MAP3K7
Symbol Nomenclature : MAP3K7
Designation : TGF-beta activated kinase 1|TGF-beta-activated kinase 1|transforming growth factor-beta-activated kinase 1
Full Nomenclature : mitogen-activated protein kinase kinase kinase 7
GENEID : 6885
Locus Tag : RP1-154G14.1
HGNC : 6859
MIM : 602614
Vega : OTTHUMG00000015217
Target GenBank: NM_003188


Reference Sequence Alignment






















NM_003188.3       GCAACCACAG--------------------------------------------------

NM_003188.3       -------------------------------GCAACGGACAGCCAAGACGTAGATCCATC











NCI : BCR signaling pathway
NCI : BMP receptor signaling
NCI : C-MYB transcription factor network
NCI : Ephrin B reverse signaling
NCI : IL1-mediated signaling events
NCI : JNK signaling in the CD4+ TCR pathway
NCI : Noncanonical Wnt signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : TGF-beta receptor signaling
NCI : TNF receptor signaling pathway
NCI : p38 MAPK signaling pathway
Panther : TGF-beta signaling pathway
Panther : Toll receptor signaling pathway
Panther : Wnt signaling pathway
Panther : p38 MAPK pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Ca2+ pathway
Reactome : Cytokine Signaling in Immune system
Reactome : Downstream TCR signaling
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : FCERI mediated NF-kB activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : IRAK2 mediated activation of TAK1 complex
Reactome : IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Signal Transduction
Reactome : Signaling by Interleukins
Reactome : Signaling by Wnt
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TCR signaling
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRAF6 mediated induction of TAK1 complex
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
Reactome : beta-catenin independent WNT signaling
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : EBV LMP1 signaling
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : IL-1 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : MAPK signaling pathway
WikiPathway : NLR proteins
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency
WikiPathway : angiogenesis overview
WikiPathway : p38 MAPK Signaling Pathway


Cloning Information : 205044
HIP Master Clone ID : 11548
Original Clone ID : FLH205044.01X


TAX_ID : 9606
Species Specific ID: 6885


Chromosome : 6
Map Location : 6q15
Ensembl : ENSG00000135341


Labome : Tak1-antibody