DNASU Plasmid Repository • 480.965.5697 | Email

RIPK1 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RIPK1
Gene Name:  receptor (TNFRSF)-interacting serine-threonine kinase 1
Sequence             
Original Clone ID: FLH205138.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00038383

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2016nts         Open reading frame : 1 to 2016
Reference Sequence Alignment

ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCAGTGACTTCCTGGAGAGT
GCAGAACTGGACAGCGGAGGCTTCGGGAAGGTGTCTCTGTGTTTCCACAGAACCCAGGGA
CTCATGATCATGAAAACAGTGTACAAGGGGCCCAACTGCATTGAGCACAACGAGGCCCTC
TTGGAGGAGGCGAAGATGATGAACAGACTGAGACACAGCCGGGTGGTGAAGCTCCTGGGC
GTCATCATAGAGGAAGGGAAGTACTCCCTGGTGATGGAGTACATGGAGAAGGGCAACCTG
ATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTTCTGTAAAAGGAAGGATAATTTTG
GAAATCATTGAAGGAATGTGCTACTTACATGGAAAAGGCGTGATACACAAGGACCTGAAG
CCTGAAAATATCCTTGTTGATAATGACTTCCACATTAAGATCGCAGACCTCGGCCTTGCC
TCCTTTAAGATGTGGAGCAAACTGAATAATGAAGAGCACAATGAGCTGAGGGAAGTGGAC
GGCACCGCTAAGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAGCACCTGAATGAC
GTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACAGCTTTGCTGTAGTACTCTGGGCG
ATATTTGCAAATAAGGAGCCATATGAAAATGCTATCTGTGAGCAGCAGTTGATAATGTGC
ATAAAATCTGGGAACAGGCCAGATGTGGATGACATCACTGAGTACTGCCCAAGAGAAATT
ATCAGTCTCATGAAGCTCTGCTGGGAAGCGAATCCGGAAGCTCGGCCGACATTTCCTGGC
ATTGAAGAAAAATTTAGGCCTTTTTATTTAAGTCAATTAGAAGAAAGTGTAGAAGAGGAC
GTGAAGAGTTTAAAGAAAGAGTATTCAAACGAAAATGCAGTTGTGAAGAGAATGCAGTCT
CTTCAACTTGATTGTGTGGCAGTACCTTCAAGCCGGTCAAATTCAGCCACAGAACAGCCT
GGTTCACTGCACAGTTCCCAGGGACTTGGGATGGGTCCTGTGGAGGAGTCCTGGTTTGCT
CCTTCCCTGGAGCACCCACAAGAAGAGAATGAGCCCAGCCTGCAGAGTAAACTCCAAGAC
GAAGCCAACTACCATCTTTATGGCAGCCGCATGGACAGGCAGACGAAACAGCAGCCCAGA
CAGAATGTGGCTTACAACAGAGAGGAGGAAAGGAGACGCAGGGTCTCCCATGACCCTTTT
GCACAGCAAAGACCTTACGAGAATTTTCAGAATACAGAGGGAAAAGGCACTGCTTATTCC
AGTGCAGCCAGTCATGGTAATGCAGTGCACCAGCCCTCAGGGCTCACCAGCCAACCTCAA
GTACTGTATCAGAACAATGGATTATATAGCTCACATGGCTTTGGAACAAGACCACTGGAT
CCAGGAACAGCAGGTCCCAGAGTTTGGTACAGGCCAATTCCAAGTCATATGCCTAGTCTG
CATAATATCCCAGTGCCTGAGACCAACTATCTAGGAAATACACCCACCATGCCATTCAGC
TCCTTGCCACCAACAGATGAATCTATAAAATATACCATATACAATAGTACTGGCATTCAG
ATTGGAGCCTACAATTATATGGAGATTGGTGGGACGAGTTCATCACTACTAGACAGCACA
AATACGAACTTCAAAGAAGAGCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCACT
AGTCTGACGGATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAAC
TGTGCCCGTAAACTGGGCTTCACACAGTCTCAGATTGATGAAATTGACCATGACTATGAG
CGAGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAAAGTGGGTGATGAGGGAAGGC
ATAAAGGGAGCCACGGTGGGGAAGCTGGCCCAGGCGCTCCACCAGTGTTCCAGGATCGAC
CTTCTGAGCAGCTTGATTTACGTCAGCCAGAACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 2016
Start on reference sequence 1
Mutations:
None
Discrepancy:
t84c; t1313c,V438A
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RIPK1
Symbol Nomenclature : RIPK1
SYNONYM : RIP; RIP1
Designation : RIP-1|cell death protein RIP|receptor interacting protein|receptor-interacting protein 1|receptor-interacting serine/threonine-protein kinase 1|serine/threonine-protein kinase RIP
Full Nomenclature : receptor (TNFRSF)-interacting serine-threonine kinase 1
GENEID : 8737
HGNC : 10019
MIM : 603453
Vega : OTTHUMG00000014134
Target GenBank: NM_003804

 

Reference Sequence Alignment

  

HsCD00038383        ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCAGTGACTTCCTGGAGAGT
NM_003804.3         ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCAGTGACTTCCTGGAGAGT
XM_005249458.1      ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCAGTGACTTCCTGGAGAGT
                    ************************************************************

HsCD00038383        GCAGAACTGGACAGCGGAGGCTTCGGGAAGGTGTCTCTGTGTTTCCACAGAACCCAGGGA
NM_003804.3         GCAGAACTGGACAGCGGAGGCTTTGGGAAGGTGTCTCTGTGTTTCCACAGAACCCAGGGA
XM_005249458.1      GCAGAACTGGACAGCGGAGGCTTTGGGAAGGTGTCTCTGTGTTTCCACAGAACCCAGGGA
                    *********************** ************************************

HsCD00038383        CTCATGATCATGAAAACAGTGTACAAGGGGCCCAACTGCATTGAGCACAACGAGGCCCTC
NM_003804.3         CTCATGATCATGAAAACAGTGTACAAGGGGCCCAACTGCATTGAGCACAACGAGGCCCTC
XM_005249458.1      CTCATGATCATGAAAACAGTGTACAAGGGGCCCAACTGCATTGAGCACAACGAGGCCCTC
                    ************************************************************

HsCD00038383        TTGGAGGAGGCGAAGATGATGAACAGACTGAGACACAGCCGGGTGGTGAAGCTCCTGGGC
NM_003804.3         TTGGAGGAGGCGAAGATGATGAACAGACTGAGACACAGCCGGGTGGTGAAGCTCCTGGGC
XM_005249458.1      TTGGAGGAGGCGAAGATGATGAACAGACTGAGACACAGCCGGGTGGTGAAGCTCCTGGGC
                    ************************************************************

HsCD00038383        GTCATCATAGAGGAAGGGAAGTACTCCCTGGTGATGGAGTACATGGAGAAGGGCAACCTG
NM_003804.3         GTCATCATAGAGGAAGGGAAGTACTCCCTGGTGATGGAGTACATGGAGAAGGGCAACCTG
XM_005249458.1      GTCATCATAGAGGAAGGGAAGTACTCCCTGGTGATGGAGTACATGGAGAAGGGCAACCTG
                    ************************************************************

HsCD00038383        ATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTTCTGTAAAAGGAAGGATAATTTTG
NM_003804.3         ATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTTCTGTAAAAGGAAGGATAATTTTG
XM_005249458.1      ATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTTCTGTAAAAGGAAGGATAATTTTG
                    ************************************************************

HsCD00038383        GAAATCATTGAAGGAATGTGCTACTTACATGGAAAAGGCGTGATACACAAGGACCTGAAG
NM_003804.3         GAAATCATTGAAGGAATGTGCTACTTACATGGAAAAGGCGTGATACACAAGGACCTGAAG
XM_005249458.1      GAAATCATTGAAGGAATGTGCTACTTACATGGAAAAGGCGTGATACACAAGGACCTGAAG
                    ************************************************************

HsCD00038383        CCTGAAAATATCCTTGTTGATAATGACTTCCACATTAAGATCGCAGACCTCGGCCTTGCC
NM_003804.3         CCTGAAAATATCCTTGTTGATAATGACTTCCACATTAAGATCGCAGACCTCGGCCTTGCC
XM_005249458.1      CCTGAAAATATCCTTGTTGATAATGACTTCCACATTAAGATCGCAGACCTCGGCCTTGCC
                    ************************************************************

HsCD00038383        TCCTTTAAGATGTGGAGCAAACTGAATAATGAAGAGCACAATGAGCTGAGGGAAGTGGAC
NM_003804.3         TCCTTTAAGATGTGGAGCAAACTGAATAATGAAGAGCACAATGAGCTGAGGGAAGTGGAC
XM_005249458.1      TCCTTTAAGATGTGGAGCAAACTGAATAATGAAGAGCACAATGAGCTGAGGGAAGTGGAC
                    ************************************************************

HsCD00038383        GGCACCGCTAAGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAGCACCTGAATGAC
NM_003804.3         GGCACCGCTAAGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAGCACCTGAATGAC
XM_005249458.1      GGCACCGCTAAGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAGCACCTGAATGAC
                    ************************************************************

HsCD00038383        GTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACAGCTTTGCTGTAGTACTCTGGGCG
NM_003804.3         GTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACAGCTTTGCTGTAGTACTCTGGGCG
XM_005249458.1      GTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACAGCTTTGCTGTAGTACTCTGGGCG
                    ************************************************************

HsCD00038383        ATATTTGCAAATAAGGAGCCATATGAAAATGCTATCTGTGAGCAGCAGTTGATAATGTGC
NM_003804.3         ATATTTGCAAATAAGGAGCCATATGAAAATGCTATCTGTGAGCAGCAGTTGATAATGTGC
XM_005249458.1      ATATTTGCAAATAAGGAGCCATATGAAAATGCTATCTGTGAGCAGCAGTTGATAATGTGC
                    ************************************************************

HsCD00038383        ATAAAATCTGGGAACAGGCCAGATGTGGATGACATCACTGAGTACTGCCCAAGAGAAATT
NM_003804.3         ATAAAATCTGGGAACAGGCCAGATGTGGATGACATCACTGAGTACTGCCCAAGAGAAATT
XM_005249458.1      ATAAAATCTGGGAACAGGCCAGATGTGGATGACATCACTGAGTACTGCCCAAGAGAAATT
                    ************************************************************

HsCD00038383        ATCAGTCTCATGAAGCTCTGCTGGGAAGCGAATCCGGAAGCTCGGCCGACATTTCCTGGC
NM_003804.3         ATCAGTCTCATGAAGCTCTGCTGGGAAGCGAATCCGGAAGCTCGGCCGACATTTCCTGGC
XM_005249458.1      ATCAGTCTCATGAAGCTCTGCTGGGAAGCGAATCCGGAAGCTCGGCCGACATTTCCTGGC
                    ************************************************************

HsCD00038383        ATTGAAGAAAAATTTAGGCCTTTTTATTTAAGTCAATTAGAAGAAAGTGTAGAAGAGGAC
NM_003804.3         ATTGAAGAAAAATTTAGGCCTTTTTATTTAAGTCAATTAGAAGAAAGTGTAGAAGAGGAC
XM_005249458.1      ATTGAAGAAAAATTTAGGCCTTTTTATTTAAGTCAATTAGAAGAAAGTGTAGAAGAGGAC
                    ************************************************************

HsCD00038383        GTGAAGAGTTTAAAGAAAGAGTATTCAAACGAAAATGCAGTTGTGAAGAGAATGCAGTCT
NM_003804.3         GTGAAGAGTTTAAAGAAAGAGTATTCAAACGAAAATGCAGTTGTGAAGAGAATGCAGTCT
XM_005249458.1      GTGAAGAGTTTAAAGAAAGAGTATTCAAACGAAAATGCAGTTGTGAAGAGAATGCAGTCT
                    ************************************************************

HsCD00038383        CTTCAACTTGATTGTGTGGCAGTACCTTCAAGCCGGTCAAATTCAGCCACAGAACAGCCT
NM_003804.3         CTTCAACTTGATTGTGTGGCAGTACCTTCAAGCCGGTCAAATTCAGCCACAGAACAGCCT
XM_005249458.1      CTTCAACTTGATTGTGTGGCAGTACCTTCAAGCCGGTCAAATTCAGCCACAGAACAGCCT
                    ************************************************************

HsCD00038383        GGTTCACTGCACAGTTCCCAGGGACTTGGGATGGGTCCTGTGGAGGAGTCCTGGTTTGCT
NM_003804.3         GGTTCACTGCACAGTTCCCAGGGACTTGGGATGGGTCCTGTGGAGGAGTCCTGGTTTGCT
XM_005249458.1      GGTTCACTGCACAGTTCCCAGGGACTTGGGATGGGTCCTGTGGAGGAGTCCTGGTTTGCT
                    ************************************************************

HsCD00038383        CCTTCCCTGGAGCACCCACAAGAAGAGAATGAGCCCAGCCTGCAGAGTAAACTCCAAGAC
NM_003804.3         CCTTCCCTGGAGCACCCACAAGAAGAGAATGAGCCCAGCCTGCAGAGTAAACTCCAAGAC
XM_005249458.1      CCTTCCCTGGAGCACCCACAAGAAGAGAATGAGCCCAGCCTGCAGAGTAAACTCCAAGAC
                    ************************************************************

HsCD00038383        GAAGCCAACTACCATCTTTATGGCAGCCGCATGGACAGGCAGACGAAACAGCAGCCCAGA
NM_003804.3         GAAGCCAACTACCATCTTTATGGCAGCCGCATGGACAGGCAGACGAAACAGCAGCCCAGA
XM_005249458.1      GAAGCCAACTACCATCTTTATGGCAGCCGCATGGACAGGCAGACGAAACAGCAGCCCAGA
                    ************************************************************

HsCD00038383        CAGAATGTGGCTTACAACAGAGAGGAGGAAAGGAGACGCAGGGTCTCCCATGACCCTTTT
NM_003804.3         CAGAATGTGGCTTACAACAGAGAGGAGGAAAGGAGACGCAGGGTCTCCCATGACCCTTTT
XM_005249458.1      CAGAATGTGGCTTACAACAGAGAGGAGGAAAGGAGACGCAGGGTCTCCCATGACCCTTTT
                    ************************************************************

HsCD00038383        GCACAGCAAAGACCTTACGAGAATTTTCAGAATACAGAGGGAAAAGGCACTGCTTATTCC
NM_003804.3         GCACAGCAAAGACCTTACGAGAATTTTCAGAATACAGAGGGAAAAGGCACTGCTTATTCC
XM_005249458.1      GCACAGCAAAGACCTTACGAGAATTTTCAGAATACAGAGGGAAAAGGCACTGCTTATTCC
                    ************************************************************

HsCD00038383        AGTGCAGCCAGTCATGGTAATGCAGTGCACCAGCCCTCAGGGCTCACCAGCCAACCTCAA
NM_003804.3         AGTGCAGCCAGTCATGGTAATGCAGTGCACCAGCCCTCAGGGCTCACCAGCCAACCTCAA
XM_005249458.1      AGTGCAGCCAGTCATGGTAATGCAGTGCACCAGCCCTCAGGGCTCACCAGCCAACCTCAA
                    ************************************************************

HsCD00038383        GTACTGTATCAGAACAATGGATTATATAGCTCACATGGCTTTGGAACAAGACCACTGGAT
NM_003804.3         GTACTGTATCAGAACAATGGATTATATAGCTCACATGGCTTTGGAACAAGACCACTGGAT
XM_005249458.1      GTACTGTATCAGAACAATGGATTATATAGCTCACATGGCTTTGGAACAAGACCACTGGAT
                    ************************************************************

HsCD00038383        CCAGGAACAGCAGGTCCCAGAGTTTGGTACAGGCCAATTCCAAGTCATATGCCTAGTCTG
NM_003804.3         CCAGGAACAGCAGGTCCCAGAGTTTGGTACAGGCCAATTCCAAGTCATATGCCTAGTCTG
XM_005249458.1      CCAGGAACAGCAGGTCCCAGAGTTTGGTACAGGCCAATTCCAAGTCATATGCCTAGTCTG
                    ************************************************************

HsCD00038383        CATAATATCCCAGTGCCTGAGACCAACTATCTAGGAAATACACCCACCATGCCATTCAGC
NM_003804.3         CATAATATCCCAGTGCCTGAGACCAACTATCTAGGAAATACACCCACCATGCCATTCAGC
XM_005249458.1      CATAATATCCCAGTGCCTGAGACCAACTATCTAGGAAATACACCCACCATGCCATTCAGC
                    ************************************************************

HsCD00038383        TCCTTGCCACCAACAGATGAATCTATAAAATATACCATATACAATAGTACTGGCATTCAG
NM_003804.3         TCCTTGCCACCAACAGATGAATCTATAAAATATACCATATACAATAGTACTGGCATTCAG
XM_005249458.1      TCCTTGCCACCAACAGATGAATCTATAAAATATACCATATACAATAGTACTGGCATTCAG
                    ************************************************************

HsCD00038383        ATTGGAGCCTACAATTATATGGAGATTGGTGGGACGAGTTCATCACTACTAGACAGCACA
NM_003804.3         ATTGGAGCCTACAATTATATGGAGATTGGTGGGACGAGTTCATCACTACTAGACAGCACA
XM_005249458.1      ATTGGAGCCTACAATTATATGGAGATTGGTGGGACGAGTTCATCACTACTAGACAGCACA
                    ************************************************************

HsCD00038383        AATACGAACTTCAAAGAAGAGCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCACT
NM_003804.3         AATACGAACTTCAAAGAAGAGCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCACT
XM_005249458.1      AATACGAACTTCAAAGAAGAGCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCACT
                    ************************************************************

HsCD00038383        AGTCTGACGGATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAAC
NM_003804.3         AGTCTGACGGATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAAC
XM_005249458.1      AGTCTGACGGATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAAC
                    ************************************************************

HsCD00038383        TGTGCCCGTAAACTGGGCTTCACACAGTCTCAGATTGATGAAATTGACCATGACTATGAG
NM_003804.3         TGTGCCCGTAAACTGGGCTTCACACAGTCTCAGATTGATGAAATTGACCATGACTATGAG
XM_005249458.1      TGTGCCCGTAAACTGGGCTTCACACAGTCTCAGATTGATGAAATTGACCATGACTATGAG
                    ************************************************************

HsCD00038383        CGAGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAAAGTGGGTGATGAGGGAAGGC
NM_003804.3         CGAGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAAAGTGGGTGATGAGGGAAGGC
XM_005249458.1      CGAGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAAAGTGGGTGATGAGGGAAGGC
                    ************************************************************

HsCD00038383        ATAAAGGGAGCCACGGTGGGGAAGCTGGCCCAGGCGCTCCACCAGTGTTCCAGGATCGAC
NM_003804.3         ATAAAGGGAGCCACGGTGGGGAAGCTGGCCCAGGCGCTCCACCAGTGTTCCAGGATCGAC
XM_005249458.1      ATAAAGGGAGCCACGGTGGGGAAGCTGGCCCAGGCGCTCCACCAGTGTTCCAGGATCGAC
                    ************************************************************

HsCD00038383        CTTCTGAGCAGCTTGATTTACGTCAGCCAGAACTTG
NM_003804.3         CTTCTGAGCAGCTTGATTTACGTCAGCCAGAACTAA
XM_005249458.1      CTTCTGAGCAGCTTGATTTACGTCAGCCAGAACTAA
                    **********************************:.

Pathways

NCI : Caspase Cascade in Apoptosis
NCI : Ceramide signaling pathway
NCI : FAS (CD95) signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : Regulation of p38-alpha and p38-beta
NCI : TNF receptor signaling pathway
NCI : TRAIL signaling pathway
Panther : Apoptosis signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Apoptosis
Reactome : Caspase-8 activation
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Death Receptor Signalling
Reactome : Dimerization of procaspase-8
Reactome : Extrinsic Pathway for Apoptosis
Reactome : IKK complex recruitment mediated by RIP1
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MyD88-independent cascade
Reactome : NF-kB activation through FADD/RIP-1 pathway mediated by caspase-8 and -10
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : RIP-mediated NFkB activation via ZBP1
Reactome : Regulation by c-FLIP
Reactome : TNF signaling
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : TRIF-mediated programmed cell death
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : p38 MAPK Signaling Pathway

Clone

Cloning Information : 205138
HIP Master Clone ID : 148167
Original Clone ID : FLH205138.01L

Organism


TAX_ID : 9606
Species Specific ID: 8737

Genome

Chromosome : 6
Map Location : 6p25.2
Ensembl : ENSG00000137275

Reagents

Labome : RIP-antibody