DNASU Plasmid Repository • 480.965.5697 | Email

CASK (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CASK
Gene Name:  calcium/calmodulin-dependent serine protein kinase (MAGUK family)
Sequence             
Original Clone ID: FLH205140.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00038384

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2694nts         Open reading frame : 1 to 2694
Reference Sequence Alignment

ATGGCCGACGACGACGTGCTGTTCGAGGATGTGTACGAGCTGTGCGAGGTGATCGGAAAG
GGTCCCTTCAGTGTTGTACGACGATGTATCAACAGAGAAACTGGGCAACAATTTGCTGTA
AAAATTGTTGATGTAGCCAAGTTCACATCAAGTCCAGGGTTAAGTACAGAAGATCTAAAG
CGGGAAGCCAGTATCTGTCATATGCTGAAACATCCACACATTGTAGAGTTATTGGAGACA
TATAGCTCAGATGGAATGCTTTACATGGTTTTCGAATTTATGGATGGAGCAGATCTGTGT
TTTGAAATCGTAAAGCGAGCTGACGCTGGTTTTGTGTACAGTGAAGCTGTAGCCAGCCAT
TATATGAGACAGATACTGGAAGCTCTACGCTACTGCCATGATAATAACATAATTCACAGG
GATGTGAAGCCCCACTGTGTTCTCCTTGCCTCAAAAGAAAACTCGGCACCTGTTAAACTT
GGAGGCTTTGGGGTAGCTATTCAATTAGGGGAGTCTGGACTTGTAGCTGGAGGACGTGTT
GGAACACCTCATTTTATGGCACCAGAAGTGGTCAAAAGAGAGCCTTACGGAAAGCCTGTA
GACGTCTGGGGGTGCGGTGTGATCCTTTTTATCCTGCTCAGTGGTTGTTTGCCTTTTTAC
GGAACCAAGGAAAGATTGTTTGAAGGCATTATTAAAGGAAAATATAAGATGAATCCAAGG
CAGTGGAGCCATATCTCTGAAAGTGCCAAAGACCTAGTACGTCGCATGCTGATGCTGGAT
CCAGCTGAAAGGATCACTGTTTATGAAGCACTGAATCACCCATGGCTTAAGGAGCGGGAT
CGTTACGCCTACAAGATTCATCTTCCAGAAACAGTAGAGCAGCTGAGGAAATTCAATGCA
AGGAGGAAACTAAAGGGTGCAGTACTAGCCGCTGTGTCAAGTCACAAATTCAACTCATTC
TATGGGGATCCCCCTGAAGAGTTACCAGATTTCTCCGAAGACCCTACCTCCTCAGGAGCA
GTCTCACAGGTGCTGGACAGCCTGGAAGAGATTCATGCGCTTACAGACTGCAGTGAAAAG
GACCTAGATTTTCTACACAGTGTTTTCCAGGATCAGCATCTTCACACACTACTAGATCTG
TATGACAAAATTAACACAAAGTCTTCACCACAAATCAGGAATCCTCCAAGCGATGCAGTA
CAGAGAGCCAAAGAGGTATTGGAAGAAATTTCATGTTACCCTGAGAATAACGACGCAAAG
GAACTAAAGCGTATTTTAACACAACCTCATTTCATGGCCTTACTTCAGACTCACGACGTA
GTGGCACATGAAGTTTACAGTGATGAAGCATTGAGGGTCACACCTCCTCCCACCTCTCCC
TATTTAAACGGCGATTCTCCAGAAAGTGCTAACGGAGACATGGATATGGAGAATGTGACC
AGAGTTCGGCTGGTACAGTTTCAAAAGAACACAGATGAACCAATGGGAATCACTTTAAAA
ATGAATGAACTAAATCATTGTATTGTTGCAAGAATTATGCATGGGGGCATGATTCACAGG
CAAGGTACACTTCATGTTGGTGATGAAATTCGAGAAATCAATGGCATCAGTGTGGCTAAC
CAAACAGTGGAACAACTGCAAAAAATGCTTAGGGAAATGCGGGGGAGTATTACCTTCAAG
ATTGTGCCAAGTTACCGCACTCAGTCTTCGTCCTGTGAGGACTTGCCATCAACTACCCAA
CCAAAAGGACGACAGATCTATGTAAGAGCACAATTTGAATATGATCCAGCCAAGGATGAC
CTCATCCCCTGTAAAGAAGCTGGCATTCGATTCAGAGTTGGTGACATCATCCAGATTATT
AGTAAGGATGATCATAATTGGTGGCAGGGTAAACTGGAAAACTCCAAAAATGGAACTGCA
GGTCTCATTCCTTCTCCTGAACTTCAGGAATGGCGAGTAGCTTGCATTGCCATGGAGAAG
ACCAAACAGGAGCAGCAGGCCAGCTGTACTTGGTTTGGCAAGAAAAAGAAGCAGTACAAA
GATAAATATTTGGCAAAGCACAATGCAGTGTTTGATCAATTAGATCTTGTCACATATGAA
GAAGTAGTAAAACTGCCAGCATTCAAGAGGAAAACACTAGTCTTATTAGGCGCACATGGT
GTTGGGAGAAGACACATAAAAAACACTCTCATCACAAAGCACCCAGACCGGTTTGCGTAC
CCTATTCCACATACAACCAGACCTCCAAAGAAAGACGAAGAAAATGGAAAGAATTATTAC
TTTGTATCTCATGACCAAATGATGCAAGACATCTCTAATAACGAGTACTTGGAGTACGGC
AGCCACGAGGATGCGATGTATGGGACAAAACTGGAGACCATCCGGAAGATCCACGAGCAG
GGGCTGATTGCAATACTGGACGTGGAGCCTCAGGCACTGAAGGTCCTGAGAACTGCAGAG
TTTGCTCCTTTTGTTGTTTTCATTGCTGCACCAACTATTACTCCAGGTTTAAATGAGGAT
GAATCTCTTCAGCGTCTGCAGAAGGAGTCTGACATCTTACAGAGAACATATGCACACTAC
TTCGATCTCACAATTATCAACAATGAAATTGATGAGACAATCAGACATCTGGAGGAAGCT
GTTGAGCTCGTGTGCACAGCCCCACAGTGGGTCCTTGTCTCCTGGGTCTATTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 2793
Start on reference sequence 28
Mutations:
None
Discrepancy:
del@1016,18;g1436a,G479D;
del@1737,69;t2023c,S675P;
ins@2153,15;g2324a,R775K;
c2747t,P916L;
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CASK
Symbol Nomenclature : CASK
SYNONYM : CAGH39; CAMGUK; CMG; FGS4; LIN2; MICPCH; MRXSNA; TNRC8
Designation : calcium/calmodulin-dependent serine protein kinase membrane-associated guanylate kinase|hCASK|peripheral plasma membrane protein CASK|protein lin-2 homolog|trinucleotide repeat containing 8
Full Nomenclature : calcium/calmodulin-dependent serine protein kinase (MAGUK family)
GENEID : 8573
Locus Tag : RP11-540L11.1
HGNC : 1497
MIM : 300172
Vega : OTTHUMG00000021378
Target GenBank: NM_003688

 

Reference Sequence Alignment

  

HsCD00038384        ATGGCCGACGACGACGTGCTGTTCGAGGATGTGTACGAGCTGTGCGAGGTGATCGGAAAG
NM_001126054.2      ATGGCCGACGACGACGTGCTGTTCGAGGATGTGTACGAGCTGTGCGAGGTGATCGGAAAG
NM_001126055.2      ATGGCCGACGACGACGTGCTGTTCGAGGATGTGTACGAGCTGTGCGAGGTGATCGGAAAG
NM_003688.3         ATGGCCGACGACGACGTGCTGTTCGAGGATGTGTACGAGCTGTGCGAGGTGATCGGAAAG
                    ************************************************************

HsCD00038384        GGTCCCTTCAGTGTTGTACGACGATGTATCAACAGAGAAACTGGGCAACAATTTGCTGTA
NM_001126054.2      GGTCCCTTCAGTGTTGTACGACGATGTATCAACAGAGAAACTGGGCAACAATTTGCTGTA
NM_001126055.2      GGTCCCTTCAGTGTTGTACGACGATGTATCAACAGAGAAACTGGGCAACAATTTGCTGTA
NM_003688.3         GGTCCCTTCAGTGTTGTACGACGATGTATCAACAGAGAAACTGGGCAACAATTTGCTGTA
                    ************************************************************

HsCD00038384        AAAATTGTTGATGTAGCCAAGTTCACATCAAGTCCAGGGTTAAGTACAGAAGATCTAAAG
NM_001126054.2      AAAATTGTTGATGTAGCCAAGTTCACATCAAGTCCAGGGTTAAGTACAGAAGATCTAAAG
NM_001126055.2      AAAATTGTTGATGTAGCCAAGTTCACATCAAGTCCAGGGTTAAGTACAGAAGATCTAAAG
NM_003688.3         AAAATTGTTGATGTAGCCAAGTTCACATCAAGTCCAGGGTTAAGTACAGAAGATCTAAAG
                    ************************************************************

HsCD00038384        CGGGAAGCCAGTATCTGTCATATGCTGAAACATCCACACATTGTAGAGTTATTGGAGACA
NM_001126054.2      CGGGAAGCCAGTATCTGTCATATGCTGAAACATCCACACATTGTAGAGTTATTGGAGACA
NM_001126055.2      CGGGAAGCCAGTATCTGTCATATGCTGAAACATCCACACATTGTAGAGTTATTGGAGACA
NM_003688.3         CGGGAAGCCAGTATCTGTCATATGCTGAAACATCCACACATTGTAGAGTTATTGGAGACA
                    ************************************************************

HsCD00038384        TATAGCTCAGATGGAATGCTTTACATGGTTTTCGAATTTATGGATGGAGCAGATCTGTGT
NM_001126054.2      TATAGCTCAGATGGAATGCTTTACATGGTTTTCGAATTTATGGATGGAGCAGATCTGTGT
NM_001126055.2      TATAGCTCAGATGGAATGCTTTACATGGTTTTCGAATTTATGGATGGAGCAGATCTGTGT
NM_003688.3         TATAGCTCAGATGGAATGCTTTACATGGTTTTCGAATTTATGGATGGAGCAGATCTGTGT
                    ************************************************************

HsCD00038384        TTTGAAATCGTAAAGCGAGCTGACGCTGGTTTTGTGTACAGTGAAGCTGTAGCCAGCCAT
NM_001126054.2      TTTGAAATCGTAAAGCGAGCTGACGCTGGTTTTGTGTACAGTGAAGCTGTAGCCAGCCAT
NM_001126055.2      TTTGAAATCGTAAAGCGAGCTGACGCTGGTTTTGTGTACAGTGAAGCTGTAGCCAGCCAT
NM_003688.3         TTTGAAATCGTAAAGCGAGCTGACGCTGGTTTTGTGTACAGTGAAGCTGTAGCCAGCCAT
                    ************************************************************

HsCD00038384        TATATGAGACAGATACTGGAAGCTCTACGCTACTGCCATGATAATAACATAATTCACAGG
NM_001126054.2      TATATGAGACAGATACTGGAAGCTCTACGCTACTGCCATGATAATAACATAATTCACAGG
NM_001126055.2      TATATGAGACAGATACTGGAAGCTCTACGCTACTGCCATGATAATAACATAATTCACAGG
NM_003688.3         TATATGAGACAGATACTGGAAGCTCTACGCTACTGCCATGATAATAACATAATTCACAGG
                    ************************************************************

HsCD00038384        GATGTGAAGCCCCACTGTGTTCTCCTTGCCTCAAAAGAAAACTCGGCACCTGTTAAACTT
NM_001126054.2      GATGTGAAGCCCCACTGTGTTCTCCTTGCCTCAAAAGAAAACTCGGCACCTGTTAAACTT
NM_001126055.2      GATGTGAAGCCCCACTGTGTTCTCCTTGCCTCAAAAGAAAACTCGGCACCTGTTAAACTT
NM_003688.3         GATGTGAAGCCCCACTGTGTTCTCCTTGCCTCAAAAGAAAACTCGGCACCTGTTAAACTT
                    ************************************************************

HsCD00038384        GGAGGCTTTGGGGTAGCTATTCAATTAGGGGAGTCTGGACTTGTAGCTGGAGGACGTGTT
NM_001126054.2      GGAGGCTTTGGGGTAGCTATTCAATTAGGGGAGTCTGGACTTGTAGCTGGAGGACGTGTT
NM_001126055.2      GGAGGCTTTGGGGTAGCTATTCAATTAGGGGAGTCTGGACTTGTAGCTGGAGGACGTGTT
NM_003688.3         GGAGGCTTTGGGGTAGCTATTCAATTAGGGGAGTCTGGACTTGTAGCTGGAGGACGTGTT
                    ************************************************************

HsCD00038384        GGAACACCTCATTTTATGGCACCAGAAGTGGTCAAAAGAGAGCCTTACGGAAAGCCTGTA
NM_001126054.2      GGAACACCTCATTTTATGGCACCAGAAGTGGTCAAAAGAGAGCCTTACGGAAAGCCTGTA
NM_001126055.2      GGAACACCTCATTTTATGGCACCAGAAGTGGTCAAAAGAGAGCCTTACGGAAAGCCTGTA
NM_003688.3         GGAACACCTCATTTTATGGCACCAGAAGTGGTCAAAAGAGAGCCTTACGGAAAGCCTGTA
                    ************************************************************

HsCD00038384        GACGTCTGGGGGTGCGGTGTGATCCTTTTTATCCTGCTCAGTGGTTGTTTGCCTTTTTAC
NM_001126054.2      GACGTCTGGGGGTGCGGTGTGATCCTTTTTATCCTGCTCAGTGGTTGTTTGCCTTTTTAC
NM_001126055.2      GACGTCTGGGGGTGCGGTGTGATCCTTTTTATCCTGCTCAGTGGTTGTTTGCCTTTTTAC
NM_003688.3         GACGTCTGGGGGTGCGGTGTGATCCTTTTTATCCTGCTCAGTGGTTGTTTGCCTTTTTAC
                    ************************************************************

HsCD00038384        GGAACCAAGGAAAGATTGTTTGAAGGCATTATTAAAGGAAAATATAAGATGAATCCAAGG
NM_001126054.2      GGAACCAAGGAAAGATTGTTTGAAGGCATTATTAAAGGAAAATATAAGATGAATCCAAGG
NM_001126055.2      GGAACCAAGGAAAGATTGTTTGAAGGCATTATTAAAGGAAAATATAAGATGAATCCAAGG
NM_003688.3         GGAACCAAGGAAAGATTGTTTGAAGGCATTATTAAAGGAAAATATAAGATGAATCCAAGG
                    ************************************************************

HsCD00038384        CAGTGGAGCCATATCTCTGAAAGTGCCAAAGACCTAGTACGTCGCATGCTGATGCTGGAT
NM_001126054.2      CAGTGGAGCCATATCTCTGAAAGTGCCAAAGACCTAGTACGTCGCATGCTGATGCTGGAT
NM_001126055.2      CAGTGGAGCCATATCTCTGAAAGTGCCAAAGACCTAGTACGTCGCATGCTGATGCTGGAT
NM_003688.3         CAGTGGAGCCATATCTCTGAAAGTGCCAAAGACCTAGTACGTCGCATGCTGATGCTGGAT
                    ************************************************************

HsCD00038384        CCAGCTGAAAGGATCACTGTTTATGAAGCACTGAATCACCCATGGCTTAAGGAGCGGGAT
NM_001126054.2      CCAGCTGAAAGGATCACTGTTTATGAAGCACTGAATCACCCATGGCTTAAGGAGCGGGAT
NM_001126055.2      CCAGCTGAAAGGATCACTGTTTATGAAGCACTGAATCACCCATGGCTTAAGGAGCGGGAT
NM_003688.3         CCAGCTGAAAGGATCACTGTTTATGAAGCACTGAATCACCCATGGCTTAAGGAGCGGGAT
                    ************************************************************

HsCD00038384        CGTTACGCCTACAAGATTCATCTTCCAGAAACAGTAGAGCAGCTGAGGAAATTCAATGCA
NM_001126054.2      CGTTACGCCTACAAGATTCATCTTCCAGAAACAGTAGAGCAGCTGAGGAAATTCAATGCA
NM_001126055.2      CGTTACGCCTACAAGATTCATCTTCCAGAAACAGTAGAGCAGCTGAGGAAATTCAATGCA
NM_003688.3         CGTTACGCCTACAAGATTCATCTTCCAGAAACAGTAGAGCAGCTGAGGAAATTCAATGCA
                    ************************************************************

HsCD00038384        AGGAGGAAACTAAAGGGTGCAGTACTAGCCGCTGTGTCAAGTCACAAATTCAACTCATTC
NM_001126054.2      AGGAGGAAACTAAAGGGTGCAGTACTAGCCGCTGTGTCAAGTCACAAATTCAACTCATTC
NM_001126055.2      AGGAGGAAACTAAAGGGTGCAGTACTAGCCGCTGTGTCAAGTCACAAATTCAACTCATTC
NM_003688.3         AGGAGGAAACTAAAGGGTGCAGTACTAGCCGCTGTGTCAAGTCACAAATTCAACTCATTC
                    ************************************************************

HsCD00038384        TATGGGGATCCCCCTGAAGAGTTACCAGATTTCTCCGAAGACCCTACCTCCTCAG-----
NM_001126054.2      TATGGGGATCCCCCTGAAGAGTTACCAGATTTCTCCGAAGACCCTACCTCCTCAGGACTT
NM_001126055.2      TATGGGGATCCCCCTGAAGAGTTACCAGATTTCTCCGAAGACCCTACCTCCTCAG-----
NM_003688.3         TATGGGGATCCCCCTGAAGAGTTACCAGATTTCTCCGAAGACCCTACCTCCTCAGGACTT
                    *******************************************************     

HsCD00038384        -------------GAGCAGTCTCACAGGTGCTGGACAGCCTGGAAGAGATTCATGCGCTT
NM_001126054.2      CTAGCAGCAGAAAGAGCAGTCTCACAGGTGCTGGACAGCCTGGAAGAGATTCATGCGCTT
NM_001126055.2      -------------GAGCAGTCTCACAGGTGCTGGACAGCCTGGAAGAGATTCATGCGCTT
NM_003688.3         CTAGCAGCAGAAAGAGCAGTCTCACAGGTGCTGGACAGCCTGGAAGAGATTCATGCGCTT
                                 ***********************************************

HsCD00038384        ACAGACTGCAGTGAAAAGGACCTAGATTTTCTACACAGTGTTTTCCAGGATCAGCATCTT
NM_001126054.2      ACAGACTGCAGTGAAAAGGACCTAGATTTTCTACACAGTGTTTTCCAGGATCAGCATCTT
NM_001126055.2      ACAGACTGCAGTGAAAAGGACCTAGATTTTCTACACAGTGTTTTCCAGGATCAGCATCTT
NM_003688.3         ACAGACTGCAGTGAAAAGGACCTAGATTTTCTACACAGTGTTTTCCAGGATCAGCATCTT
                    ************************************************************

HsCD00038384        CACACACTACTAGATCTGTATGACAAAATTAACACAAAGTCTTCACCACAAATCAGGAAT
NM_001126054.2      CACACACTACTAGATCTGTATGACAAAATTAACACAAAGTCTTCACCACAAATCAGGAAT
NM_001126055.2      CACACACTACTAGATCTGTATGACAAAATTAACACAAAGTCTTCACCACAAATCAGGAAT
NM_003688.3         CACACACTACTAGATCTGTATGACAAAATTAACACAAAGTCTTCACCACAAATCAGGAAT
                    ************************************************************

HsCD00038384        CCTCCAAGCGATGCAGTACAGAGAGCCAAAGAGGTATTGGAAGAAATTTCATGTTACCCT
NM_001126054.2      CCTCCAAGCGATGCAGTACAGAGAGCCAAAGAGGTATTGGAAGAAATTTCATGTTACCCT
NM_001126055.2      CCTCCAAGCGATGCAGTACAGAGAGCCAAAGAGGTATTGGAAGAAATTTCATGTTACCCT
NM_003688.3         CCTCCAAGCGATGCAGTACAGAGAGCCAAAGAGGTATTGGAAGAAATTTCATGTTACCCT
                    ************************************************************

HsCD00038384        GAGAATAACGACGCAAAGGAACTAAAGCGTATTTTAACACAACCTCATTTCATGGCCTTA
NM_001126054.2      GAGAATAACGACGCAAAGGAACTAAAGCGTATTTTAACACAACCTCATTTCATGGCCTTA
NM_001126055.2      GAGAATAACGACGCAAAGGAACTAAAGCGTATTTTAACACAACCTCATTTCATGGCCTTA
NM_003688.3         GAGAATAACGACGCAAAGGAACTAAAGCGTATTTTAACACAACCTCATTTCATGGCCTTA
                    ************************************************************

HsCD00038384        CTTCAGACTCACGACGTAGTGGCACATGAAGTTTACAGTGATGAAGCATTGAGGGTCACA
NM_001126054.2      CTTCAGACTCACGACGTAGTGGCACATGAAGTTTACAGTGATGAAGCATTGAGGGTCACA
NM_001126055.2      CTTCAGACTCACGACGTAGTGGCACATGAAGTTTACAGTGATGAAGCATTGAGGGTCACA
NM_003688.3         CTTCAGACTCACGACGTAGTGGCACATGAAGTTTACAGTGATGAAGCATTGAGGGTCACA
                    ************************************************************

HsCD00038384        CCTCCTCCCACCTCTCCCTATTTAAACGGCGATTCTCCAGAAAGTGCTAACGGAGACATG
NM_001126054.2      CCTCCTCCCACCTCTCCCTATTTAAACGGCGATTCTCCAGAAAGTGCTAACGGAGACATG
NM_001126055.2      CCTCCTCCCACCTCTCCCTATTTAAACGGCGATTCTCCAGAAAGTGCTAACGGAGACATG
NM_003688.3         CCTCCTCCCACCTCTCCCTATTTAAACGGCGATTCTCCAGAAAGTGCTAACGGAGACATG
                    ************************************************************

HsCD00038384        GATATGGAGAATGTGACCAGAGTTCGGCTGGTACAGTTTCAAAAGAACACAGATGAACCA
NM_001126054.2      GATATGGAGAATGTGACCAGAGTTCGGCTGGTACAGTTTCAAAAGAACACAGATGAACCA
NM_001126055.2      GATATGGAGAATGTGACCAGAGTTCGGCTGGTACAGTTTCAAAAGAACACAGATGAACCA
NM_003688.3         GATATGGAGAATGTGACCAGAGTTCGGCTGGTACAGTTTCAAAAGAACACAGATGAACCA
                    ************************************************************

HsCD00038384        ATGGGAATCACTTTAAAAATGAATGAACTAAATCATTGTATTGTTGCAAGAATTATGCAT
NM_001126054.2      ATGGGAATCACTTTAAAAATGAATGAACTAAATCATTGTATTGTTGCAAGAATTATGCAT
NM_001126055.2      ATGGGAATCACTTTAAAAATGAATGAACTAAATCATTGTATTGTTGCAAGAATTATGCAT
NM_003688.3         ATGGGAATCACTTTAAAAATGAATGAACTAAATCATTGTATTGTTGCAAGAATTATGCAT
                    ************************************************************

HsCD00038384        GGGGGCATGATTCACAGGCAAGGTACACTTCATGTTGGTGATGAAATTCGAGAAATCAAT
NM_001126054.2      GGGGGCATGATTCACAGGCAAGGTACACTTCATGTTGGTGATGAAATTCGAGAAATCAAT
NM_001126055.2      GGGGGCATGATTCACAGGCAAGGTACACTTCATGTTGGTGATGAAATTCGAGAAATCAAT
NM_003688.3         GGGGGCATGATTCACAGGCAAGGTACACTTCATGTTGGTGATGAAATTCGAGAAATCAAT
                    ************************************************************

HsCD00038384        GGCATCAGTGTGGCTAACCAAACAGTGGAACAACTGCAAAAAATGCTTAGGGAAATGCGG
NM_001126054.2      GGCATCAGTGTGGCTAACCAAACAGTGGAACAACTGCAAAAAATGCTTAGGGAAATGCGG
NM_001126055.2      GGCATCAGTGTGGCTAACCAAACAGTGGAACAACTGCAAAAAATGCTTAGGGAAATGCGG
NM_003688.3         GGCATCAGTGTGGCTAACCAAACAGTGGAACAACTGCAAAAAATGCTTAGGGAAATGCGG
                    ************************************************************

HsCD00038384        GGGAGTATTACCTTCAAGATTGTGCCAAGTTACCGCACTCAGTCTTCGTCCTGTGAGG--
NM_001126054.2      GGGAGTATTACCTTCAAGATTGTGCCAAGTTACCGCACTCAGTCTTCGTCCTGTGAGG--
NM_001126055.2      GGGAGTATTACCTTCAAGATTGTGCCAAGTTACCGCACTCAGTCTTCGTCCTGTGAGG--
NM_003688.3         GGGAGTATTACCTTCAAGATTGTGCCAAGTTACCGCACTCAGTCTTCGTCCTGTGAGAGA
                    *********************************************************.  

HsCD00038384        ------------------------------------------------------------
NM_001126054.2      ------------------------------------------------------------
NM_001126055.2      ------------------------------------------------------------
NM_003688.3         GATTCCCCTTCCACTTCCAGACAGTCCCCAGCTAATGGTCATAGCAGCACTAACAATTCT
                                                                                

HsCD00038384        -------ACTTGCCATCAACTACCCAACCAAAAGGACGACAGATCTATGTAAGAGCACAA
NM_001126054.2      -------ACTTGCCATCAACTACCCAACCAAAAGGACGACAGATCTATGTAAGAGCACAA
NM_001126055.2      -------ACTTGCCATCAACTACCCAACCAAAAGGACGACAGATCTATGTAAGAGCACAA
NM_003688.3         GTTTCGGACTTGCCATCAACTACCCAACCAAAAGGACGACAGATCTATGTAAGAGCACAA
                           *****************************************************

HsCD00038384        TTTGAATATGATCCAGCCAAGGATGACCTCATCCCCTGTAAAGAAGCTGGCATTCGATTC
NM_001126054.2      TTTGAATATGATCCAGCCAAGGATGACCTCATCCCCTGTAAAGAAGCTGGCATTCGATTC
NM_001126055.2      TTTGAATATGATCCAGCCAAGGATGACCTCATCCCCTGTAAAGAAGCTGGCATTCGATTC
NM_003688.3         TTTGAATATGATCCAGCCAAGGATGACCTCATCCCCTGTAAAGAAGCTGGCATTCGATTC
                    ************************************************************

HsCD00038384        AGAGTTGGTGACATCATCCAGATTATTAGTAAGGATGATCATAATTGGTGGCAGGGTAAA
NM_001126054.2      AGAGTTGGTGACATCATCCAGATTATTAGTAAGGATGATCATAATTGGTGGCAGGGTAAA
NM_001126055.2      AGAGTTGGTGACATCATCCAGATTATTAGTAAGGATGATCATAATTGGTGGCAGGGTAAA
NM_003688.3         AGAGTTGGTGACATCATCCAGATTATTAGTAAGGATGATCATAATTGGTGGCAGGGTAAA
                    ************************************************************

HsCD00038384        CTGGAAAACTCCAAAAATGGAACTGCAGGTCTCATTCCTTCTCCTGAACTTCAGGAATGG
NM_001126054.2      CTGGAAAACTCCAAAAATGGAACTGCAGGTCTCATTCCTTCTCCTGAACTTCAGGAATGG
NM_001126055.2      CTGGAAAACTCCAAAAATGGAACTGCAGGTCTCATTCCTTCTCCTGAACTTCAGGAATGG
NM_003688.3         CTGGAAAACTCCAAAAATGGAACTGCAGGTCTCATTCCTTCTCCTGAACTTCAGGAATGG
                    ************************************************************

HsCD00038384        CGAGTAGCTTGCATTGCCATGGAGAAGACCAAACAGGAGCAGCAGGCCAGCTGTACTTGG
NM_001126054.2      CGAGTAGCTTGCATTGCCATGGAGAAGACCAAACAGGAGCAGCAGGCCAGCTGTACTTGG
NM_001126055.2      CGAGTAGCTTGCATTGCCATGGAGAAGACCAAACAGGAGCAGCAGGCCAGCTGTACTTGG
NM_003688.3         CGAGTAGCTTGCATTGCCATGGAGAAGACCAAACAGGAGCAGCAGGCCAGCTGTACTTGG
                    ************************************************************

HsCD00038384        TTTGGCAAGAAAAAGAAGCAGTACAAAGATAAATATTTGGCAAAGCACAATGCAGTGTTT
NM_001126054.2      TTTGGCAAGAAAAAGAAGCAGTACAAAGATAAATATTTGGCAAAGCACAATGCAG-----
NM_001126055.2      TTTGGCAAGAAAAAGAAGCAGTACAAAGATAAATATTTGGCAAAGCACAATGCAGTGTTT
NM_003688.3         TTTGGCAAGAAAAAGAAGCAGTACAAAGATAAATATTTGGCAAAGCACAATGCAG-----
                    *******************************************************     

HsCD00038384        GATCAATTAGATCTTGTCACATATGAAGAAGTAGTAAAACTGCCAGCATTCAAGAGGAAA
NM_001126054.2      ----------ATCTTGTCACATATGAAGAAGTAGTAAAACTGCCAGCATTCAAGAGGAAA
NM_001126055.2      GATCAATTAGATCTTGTCACATATGAAGAAGTAGTAAAACTGCCAGCATTCAAGAGGAAA
NM_003688.3         ----------ATCTTGTCACATATGAAGAAGTAGTAAAACTGCCAGCATTCAAGAGGAAA
                              **************************************************

HsCD00038384        ACACTAGTCTTATTAGGCGCACATGGTGTTGGGAGAAGACACATAAAAAACACTCTCATC
NM_001126054.2      ACACTAGTCTTATTAGGCGCACATGGTGTTGGGAGAAGACACATAAAAAACACTCTCATC
NM_001126055.2      ACACTAGTCTTATTAGGCGCACATGGTGTTGGGAGAAGACACATAAAAAACACTCTCATC
NM_003688.3         ACACTAGTCTTATTAGGCGCACATGGTGTTGGGAGAAGACACATAAAAAACACTCTCATC
                    ************************************************************

HsCD00038384        ACAAAGCACCCAGACCGGTTTGCGTACCCTATTCCACATACAACCAGACCTCCAAAGAAA
NM_001126054.2      ACAAAGCACCCAGACCGGTTTGCGTACCCTATTCCACATACAACCAGACCTCCAAAGAAA
NM_001126055.2      ACAAAGCACCCAGACCGGTTTGCGTACCCTATTCCACATACAACCAGACCTCCAAAGAAA
NM_003688.3         ACAAAGCACCCAGACCGGTTTGCGTACCCTATTCCACATACAACCAGACCTCCAAAGAAA
                    ************************************************************

HsCD00038384        GACGAAGAAAATGGAAAGAATTATTACTTTGTATCTCATGACCAAATGATGCAAGACATC
NM_001126054.2      GACGAAGAAAATGGAAAGAATTATTACTTTGTATCTCATGACCAAATGATGCAAGACATC
NM_001126055.2      GACGAAGAAAATGGAAAGAATTATTACTTTGTATCTCATGACCAAATGATGCAAGACATC
NM_003688.3         GACGAAGAAAATGGAAAGAATTATTACTTTGTATCTCATGACCAAATGATGCAAGACATC
                    ************************************************************

HsCD00038384        TCTAATAACGAGTACTTGGAGTACGGCAGCCACGAGGATGCGATGTATGGGACAAAACTG
NM_001126054.2      TCTAATAACGAGTACTTGGAGTACGGCAGCCACGAGGATGCGATGTATGGGACAAAACTG
NM_001126055.2      TCTAATAACGAGTACTTGGAGTACGGCAGCCACGAGGATGCGATGTATGGGACAAAACTG
NM_003688.3         TCTAATAACGAGTACTTGGAGTACGGCAGCCACGAGGATGCGATGTATGGGACAAAACTG
                    ************************************************************

HsCD00038384        GAGACCATCCGGAAGATCCACGAGCAGGGGCTGATTGCAATACTGGACGTGGAGCCTCAG
NM_001126054.2      GAGACCATCCGGAAGATCCACGAGCAGGGGCTGATTGCAATACTGGACGTGGAGCCTCAG
NM_001126055.2      GAGACCATCCGGAAGATCCACGAGCAGGGGCTGATTGCAATACTGGACGTGGAGCCTCAG
NM_003688.3         GAGACCATCCGGAAGATCCACGAGCAGGGGCTGATTGCAATACTGGACGTGGAGCCTCAG
                    ************************************************************

HsCD00038384        GCACTGAAGGTCCTGAGAACTGCAGAGTTTGCTCCTTTTGTTGTTTTCATTGCTGCACCA
NM_001126054.2      GCACTGAAGGTCCTGAGAACTGCAGAGTTTGCTCCTTTTGTTGTTTTCATTGCTGCACCA
NM_001126055.2      GCACTGAAGGTCCTGAGAACTGCAGAGTTTGCTCCTTTTGTTGTTTTCATTGCTGCACCA
NM_003688.3         GCACTGAAGGTCCTGAGAACTGCAGAGTTTGCTCCTTTTGTTGTTTTCATTGCTGCACCA
                    ************************************************************

HsCD00038384        ACTATTACTCCAGGTTTAAATGAGGATGAATCTCTTCAGCGTCTGCAGAAGGAGTCTGAC
NM_001126054.2      ACTATTACTCCAGGTTTAAATGAGGATGAATCTCTTCAGCGTCTGCAGAAGGAGTCTGAC
NM_001126055.2      ACTATTACTCCAGGTTTAAATGAGGATGAATCTCTTCAGCGTCTGCAGAAGGAGTCTGAC
NM_003688.3         ACTATTACTCCAGGTTTAAATGAGGATGAATCTCTTCAGCGTCTGCAGAAGGAGTCTGAC
                    ************************************************************

HsCD00038384        ATCTTACAGAGAACATATGCACACTACTTCGATCTCACAATTATCAACAATGAAATTGAT
NM_001126054.2      ATCTTACAGAGAACATATGCACACTACTTCGATCTCACAATTATCAACAATGAAATTGAT
NM_001126055.2      ATCTTACAGAGAACATATGCACACTACTTCGATCTCACAATTATCAACAATGAAATTGAT
NM_003688.3         ATCTTACAGAGAACATATGCACACTACTTCGATCTCACAATTATCAACAATGAAATTGAT
                    ************************************************************

HsCD00038384        GAGACAATCAGACATCTGGAGGAAGCTGTTGAGCTCGTGTGCACAGCCCCACAGTGGGTC
NM_001126054.2      GAGACAATCAGACATCTGGAGGAAGCTGTTGAGCTCGTGTGCACAGCCCCACAGTGGGTC
NM_001126055.2      GAGACAATCAGACATCTGGAGGAAGCTGTTGAGCTCGTGTGCACAGCCCCACAGTGGGTC
NM_003688.3         GAGACAATCAGACATCTGGAGGAAGCTGTTGAGCTCGTGTGCACAGCCCCACAGTGGGTC
                    ************************************************************

HsCD00038384        CTTGTCTCCTGGGTCTATTTG
NM_001126054.2      CCTGTCTCCTGGGTCTATTAG
NM_001126055.2      CCTGTCTCCTGGGTCTATTAG
NM_003688.3         CCTGTCTCCTGGGTCTATTAG
                    * *****************:*

Pathways

NCI : Syndecan-1-mediated signaling events
NCI : Syndecan-2-mediated signaling events
NCI : Syndecan-3-mediated signaling events
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Parkinson disease
Reactome : Cell-Cell communication
Reactome : Extracellular matrix organization
Reactome : Nephrin interactions
Reactome : Non-integrin membrane-ECM interactions
Reactome : Syndecan interactions

Clone

Cloning Information : 205140
HIP Master Clone ID : 148172
Original Clone ID : FLH205140.01L

Organism


TAX_ID : 9606
Species Specific ID: 8573

Genome

Chromosome : X
Map Location : Xp11.4
Ensembl : ENSG00000147044

Reagents

Labome : CASK-antibody