DNASU Plasmid Repository • 480.965.5697 | Email

TAF9 (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TAF9
Gene Name:  TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
Sequence             
Original Clone ID: FLH205271.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00038409

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 795nts         Open reading frame : 1 to 795
Reference Sequence Alignment

ATGGAGTCTGGCAAGACGGCTTCTCCCAAGAGCATGCCGAAAGATGCACAGATGATGGCA
CAAATCCTGAAGGATATGGGGATTACAGAATATGAGCCAAGAGTTATAAATCAGATGTTG
GAGTTTGCCTTCCGATATGTGACCACAATTCTAGATGATGCAAAAATTTATTCAAGCCAT
GCTAAGAAAGCTACTGTTGATGCAGATGATGTGCGATTGGCAATCCAGTGCCGCGCTGAT
CAGTCTTTTACCTCTCCTCCCCCAAGAGATTTTTTATTAGATATTGCAAGGCAAAGAAAT
CAAACCCCTTTGCCATTGATCAAGCCATATTCAGGTCCTAGGTTGCCACCTGATAGATAC
TGCTTAACAGCTCCAAACTATAGGCTGAAATCTTTACAGAAAAAGGCATCAACTTCTGCG
GGAAGAATAACAGTCCCGCGGTTAAGTGTTGGTTCAGTTACTAGCAGACCAAGTACTCCC
ACACTAGGCACACCAACCCCACAGACCATGTCTGTTTCAACTAAAGTAGGGACTCCCATG
TCCCTCACAGGTCAAAGGTTTACAGTACAGATGCCTACTTCTCAGTCTCCAGCTGTAAAA
GCTTCAATTCCTGCAACCTCAGCAGTTCAGAATGTTCTGATTAATCCATCATTAATCGGG
TCCAAAAACATTCTTATTACCACTAATATGATGTCATCACAAAATACTGCCAATGAATCA
TCAAATGCATTGAAAAGAAAACGTGAAGATGATGATGATGACGATGATGATGATGATGAC
TATGATAATCTATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 942
Start on reference sequence 148
Mutations:
None
Discrepancy:
g792a
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TAF9
Symbol Nomenclature : TAF9
SYNONYM : MGC:5067; STAF31/32; TAF2G; TAFII-31; TAFII-32; TAFII31; TAFII32; TAFIID32
Designation : RNA polymerase II TBP-associated factor subunit G|transcription initiation factor TFIID 31 kD subunit|transcription initiation factor TFIID 31 kDa subunit|transcription initiation factor TFIID 32 kDa subunit|transcription initiation factor TFIID subunit 9
Full Nomenclature : TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
GENEID : 6880
Locus Tag : AD-004
HGNC : 11542
MIM : 600822
Vega : OTTHUMG00000099359
Target GenBank: NM_003187

 

Reference Sequence Alignment

  

HsCD00038409        ATGGAGTCTGGCAAGACGGCTTCTCCCAAGAGCATGCCGAAAGATGCACAGATGATGGCA
NM_003187.4         ATGGAGTCTGGCAAGACGGCTTCTCCCAAGAGCATGCCGAAAGATGCACAGATGATGGCA
NM_001015892.1      ATGGAGTCTGGCAAGACGGCTTCTCCCAAGAGCATGCCGAAAGATGCACAGATGATGGCA
                    ************************************************************

HsCD00038409        CAAATCCTGAAGGATATGGGGATTACAGAATATGAGCCAAGAGTTATAAATCAGATGTTG
NM_003187.4         CAAATCCTGAAGGATATGGGGATTACAGAATATGAGCCAAGAGTTATAAATCAGATGTTG
NM_001015892.1      CAAATCCTGAAGGATATGGGGATTACAGAATATGAGCCAAGAGTTATAAATCAGATGTTG
                    ************************************************************

HsCD00038409        GAGTTTGCCTTCCGATATGTGACCACAATTCTAGATGATGCAAAAATTTATTCAAGCCAT
NM_003187.4         GAGTTTGCCTTCCGATATGTGACCACAATTCTAGATGATGCAAAAATTTATTCAAGCCAT
NM_001015892.1      GAGTTTGCCTTCCGATATGTGACCACAATTCTAGATGATGCAAAAATTTATTCAAGCCAT
                    ************************************************************

HsCD00038409        GCTAAGAAAGCTACTGTTGATGCAGATGATGTGCGATTGGCAATCCAGTGCCGCGCTGAT
NM_003187.4         GCTAAGAAAGCTACTGTTGATGCAGATGATGTGCGATTGGCAATCCAGTGCCGCGCTGAT
NM_001015892.1      GCTAAGAAAGCTACTGTTGATGCAGATGATGTGCGATTGGCAATCCAGTGCCGCGCTGAT
                    ************************************************************

HsCD00038409        CAGTCTTTTACCTCTCCTCCCCCAAGAGATTTTTTATTAGATATTGCAAGGCAAAGAAAT
NM_003187.4         CAGTCTTTTACCTCTCCTCCCCCAAGAGATTTTTTATTAGATATTGCAAGGCAAAGAAAT
NM_001015892.1      CAGTCTTTTACCTCTCCTCCCCCAAGAGATTTTTTATTAGATATTGCAAGGCAAAGAAAT
                    ************************************************************

HsCD00038409        CAAACCCCTTTGCCATTGATCAAGCCATATTCAGGTCCTAGGTTGCCACCTGATAGATAC
NM_003187.4         CAAACCCCTTTGCCATTGATCAAGCCATATTCAGGTCCTAGGTTGCCACCTGATAGATAC
NM_001015892.1      CAAACCCCTTTGCCATTGATCAAGCCATATTCAGGTCCTAGGTTGCCACCTGATAGATAC
                    ************************************************************

HsCD00038409        TGCTTAACAGCTCCAAACTATAGGCTGAAATCTTTACAGAAAAAGGCATCAACTTCTGCG
NM_003187.4         TGCTTAACAGCTCCAAACTATAGGCTGAAATCTTTACAGAAAAAGGCATCAACTTCTGCG
NM_001015892.1      TGCTTAACAGCTCCAAACTATAGGCTGAAATCTTTACAGAAAAAGGCATCAACTTCTGCG
                    ************************************************************

HsCD00038409        GGAAGAATAACAGTCCCGCGGTTAAGTGTTGGTTCAGTTACTAGCAGACCAAGTACTCCC
NM_003187.4         GGAAGAATAACAGTCCCGCGGTTAAGTGTTGGTTCAGTTACTAGCAGACCAAGTACTCCC
NM_001015892.1      GGAAGAATAACAGTCCCGCGGTTAAGTGTTGGTTCAGTTACTAGCAGACCAAGTACTCCC
                    ************************************************************

HsCD00038409        ACACTAGGCACACCAACCCCACAGACCATGTCTGTTTCAACTAAAGTAGGGACTCCCATG
NM_003187.4         ACACTAGGCACACCAACCCCACAGACCATGTCTGTTTCAACTAAAGTAGGGACTCCCATG
NM_001015892.1      ACACTAGGCACACCAACCCCACAGACCATGTCTGTTTCAACTAAAGTAGGGACTCCCATG
                    ************************************************************

HsCD00038409        TCCCTCACAGGTCAAAGGTTTACAGTACAGATGCCTACTTCTCAGTCTCCAGCTGTAAAA
NM_003187.4         TCCCTCACAGGTCAAAGGTTTACAGTACAGATGCCTACTTCTCAGTCTCCAGCTGTAAAA
NM_001015892.1      TCCCTCACAGGTCAAAGGTTTACAGTACAGATGCCTACTTCTCAGTCTCCAGCTGTAAAA
                    ************************************************************

HsCD00038409        GCTTCAATTCCTGCAACCTCAGCAGTTCAGAATGTTCTGATTAATCCATCATTAATCGGG
NM_003187.4         GCTTCAATTCCTGCAACCTCAGCAGTTCAGAATGTTCTGATTAATCCATCATTAATCGGG
NM_001015892.1      GCTTCAATTCCTGCAACCTCAGCAGTTCAGAATGTTCTGATTAATCCATCATTAATCGGG
                    ************************************************************

HsCD00038409        TCCAAAAACATTCTTATTACCACTAATATGATGTCATCACAAAATACTGCCAATGAATCA
NM_003187.4         TCCAAAAACATTCTTATTACCACTAATATGATGTCATCACAAAATACTGCCAATGAATCA
NM_001015892.1      TCCAAAAACATTCTTATTACCACTAATATGATGTCATCACAAAATACTGCCAATGAATCA
                    ************************************************************

HsCD00038409        TCAAATGCATTGAAAAGAAAACGTGAAGATGATGATGATGACGATGATGATGATGATGAC
NM_003187.4         TCAAATGCATTGAAAAGAAAACGTGAAGATGATGATGATGACGATGATGATGATGATGAC
NM_001015892.1      TCAAATGCATTGAAAAGAAAACGTGAAGATGATGATGATGACGATGATGATGATGATGAC
                    ************************************************************

HsCD00038409        TATGATAATCTATTG
NM_003187.4         TATGATAATCTGTAA
NM_001015892.1      TATGATAATCTGTAA
                    ***********.*:.

Pathways

NCI : C-MYC pathway
NCI : Direct p53 effectors
NCI : Validated targets of C-MYC transcriptional activation
Panther : General transcription regulation
Panther : Transcription regulation by bZIP transcription factor
Reactome : Chromatin modifying enzymes
Reactome : Chromatin organization
Reactome : Disease
Reactome : Gene Expression
Reactome : HATs acetylate histones
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Initiation
Reactome : Late Phase of HIV Life Cycle
Reactome : RNA Polymerase II HIV Promoter Escape
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Promoter Escape
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Initiation
Reactome : RNA Polymerase II Transcription Initiation And Promoter Clearance
Reactome : RNA Polymerase II Transcription Pre-Initiation And Promoter Opening
Reactome : Transcription
Reactome : Transcription of the HIV genome
WikiPathway : Eukaryotic Transcription Initiation

Protein

UniProt : Q16594
UniProt : Q9Y3D8
HPRD : 15983

Clone

Cloning Information : 205271
HIP Master Clone ID : 14232
Original Clone ID : FLH205271.01L

Organism


TAX_ID : 9606
Species Specific ID: 6880

Genome

Chromosome : 5
Map Location : 5q13.2
Ensembl : ENSG00000085231

Reagents

Labome : TAF9-antibody