DNASU Plasmid Repository • 480.965.5697 | Email

CDK9 (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDK9
Gene Name:  cyclin-dependent kinase 9
Sequence             
Original Clone ID: FLH205272.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00038410

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1119nts         Open reading frame : 1 to 1119
Reference Sequence Alignment

ATGGCAAAGCAGTACGACTCGGTGGAGTGCCCTTTTTGTGATGAAGTTTCCAAATACGAG
AAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAG
ACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCC
ATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAAC
TTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATAC
CTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAG
TTCACGTTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATC
CACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGAT
GGGGTCCTGAAGCTGGCAGACTTTGGGCTGGCCCGGGCCTTCAGCCTGGCCAAGAACAGC
CAGCCCAACCGCTACACCAACCGTGTGGTGACACTCTGGTACCGGCCCCCGGAGCTGTTG
CTCGGGGAGCGGGACTACGGCCCCCCCATTGACCTGTGGGGTGCTGGGTGCATCATGGCA
GAGATGTGGACCCGCAGCCCCATCATGCAGGGCAACACGGAGCAGCACCAACTCGCCCTC
ATCAGTCAGCTCTGCGGCTCCATCACCCCTGAGGTGTGGCCAAACGTGGACAACTATGAG
CTGTACGAAAAGCTGGAGCTGGTCAAGGGCCAGAAGCGGAAGGTGAAGGACAGGCTGAAG
GCCTATGTGCGTGACCCATACGCACTGGACCTCATCGACAAGCTGCTGGTGCTGGACCCT
GCCCAGCGCATCGACAGCGATGACGCCCTCAACCACGACTTCTTCTGGTCCGACCCCATG
CCCTCCGACCTCAAGGGCATGCTCTCCACCCACCTGACGTCCATGTTCGAGTACTTGGCA
CCACCGCGCCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGTCGCAATCCC
GCCACCACCAACCAGACGGAGTTTGAGCGCGTCTTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1183
Start on reference sequence 65
Mutations:
None
Discrepancy:
c367t
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDK9
Symbol Nomenclature : CDK9
SYNONYM : C-2k; CDC2L4; CTK1; PITALRE; TAK
Designation : CDC2-related kinase|cell division cycle 2-like protein kinase 4|cell division protein kinase 9|serine/threonine protein kinase PITALRE|serine/threonine-protein kinase PITALRE|tat-associated kinase complex catalytic subunit
Full Nomenclature : cyclin-dependent kinase 9
GENEID : 1025
Locus Tag : RP11-228B15.5
HGNC : 1780
MIM : 603251
Vega : OTTHUMG00000020715
Target GenBank: NM_001261

 

Reference Sequence Alignment

  

HsCD00038410      ATGGCAAAGCAGTACGACTCGGTGGAGTGCCCTTTTTGTGATGAAGTTTCCAAATACGAG
NM_001261.3       ATGGCAAAGCAGTACGACTCGGTGGAGTGCCCTTTTTGTGATGAAGTTTCCAAATACGAG
                  ************************************************************

HsCD00038410      AAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAG
NM_001261.3       AAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAG
                  ************************************************************

HsCD00038410      ACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCC
NM_001261.3       ACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCC
                  ************************************************************

HsCD00038410      ATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAAC
NM_001261.3       ATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAAC
                  ************************************************************

HsCD00038410      TTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATAC
NM_001261.3       TTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATAC
                  ************************************************************

HsCD00038410      CTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAG
NM_001261.3       CTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAG
                  ************************************************************

HsCD00038410      TTCACGTTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATC
NM_001261.3       TTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATC
                  ****** *****************************************************

HsCD00038410      CACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGAT
NM_001261.3       CACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGAT
                  ************************************************************

HsCD00038410      GGGGTCCTGAAGCTGGCAGACTTTGGGCTGGCCCGGGCCTTCAGCCTGGCCAAGAACAGC
NM_001261.3       GGGGTCCTGAAGCTGGCAGACTTTGGGCTGGCCCGGGCCTTCAGCCTGGCCAAGAACAGC
                  ************************************************************

HsCD00038410      CAGCCCAACCGCTACACCAACCGTGTGGTGACACTCTGGTACCGGCCCCCGGAGCTGTTG
NM_001261.3       CAGCCCAACCGCTACACCAACCGTGTGGTGACACTCTGGTACCGGCCCCCGGAGCTGTTG
                  ************************************************************

HsCD00038410      CTCGGGGAGCGGGACTACGGCCCCCCCATTGACCTGTGGGGTGCTGGGTGCATCATGGCA
NM_001261.3       CTCGGGGAGCGGGACTACGGCCCCCCCATTGACCTGTGGGGTGCTGGGTGCATCATGGCA
                  ************************************************************

HsCD00038410      GAGATGTGGACCCGCAGCCCCATCATGCAGGGCAACACGGAGCAGCACCAACTCGCCCTC
NM_001261.3       GAGATGTGGACCCGCAGCCCCATCATGCAGGGCAACACGGAGCAGCACCAACTCGCCCTC
                  ************************************************************

HsCD00038410      ATCAGTCAGCTCTGCGGCTCCATCACCCCTGAGGTGTGGCCAAACGTGGACAACTATGAG
NM_001261.3       ATCAGTCAGCTCTGCGGCTCCATCACCCCTGAGGTGTGGCCAAACGTGGACAACTATGAG
                  ************************************************************

HsCD00038410      CTGTACGAAAAGCTGGAGCTGGTCAAGGGCCAGAAGCGGAAGGTGAAGGACAGGCTGAAG
NM_001261.3       CTGTACGAAAAGCTGGAGCTGGTCAAGGGCCAGAAGCGGAAGGTGAAGGACAGGCTGAAG
                  ************************************************************

HsCD00038410      GCCTATGTGCGTGACCCATACGCACTGGACCTCATCGACAAGCTGCTGGTGCTGGACCCT
NM_001261.3       GCCTATGTGCGTGACCCATACGCACTGGACCTCATCGACAAGCTGCTGGTGCTGGACCCT
                  ************************************************************

HsCD00038410      GCCCAGCGCATCGACAGCGATGACGCCCTCAACCACGACTTCTTCTGGTCCGACCCCATG
NM_001261.3       GCCCAGCGCATCGACAGCGATGACGCCCTCAACCACGACTTCTTCTGGTCCGACCCCATG
                  ************************************************************

HsCD00038410      CCCTCCGACCTCAAGGGCATGCTCTCCACCCACCTGACGTCCATGTTCGAGTACTTGGCA
NM_001261.3       CCCTCCGACCTCAAGGGCATGCTCTCCACCCACCTGACGTCCATGTTCGAGTACTTGGCA
                  ************************************************************

HsCD00038410      CCACCGCGCCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGTCGCAATCCC
NM_001261.3       CCACCGCGCCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGTCGCAATCCC
                  ************************************************************

HsCD00038410      GCCACCACCAACCAGACGGAGTTTGAGCGCGTCTTCTTG
NM_001261.3       GCCACCACCAACCAGACGGAGTTTGAGCGCGTCTTCTGA
                  ************************************* .

Pathways

Reactome : Disease
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : HIV elongation arrest and recovery
Reactome : Host Interactions of HIV factors
Reactome : Interactions of Tat with host cellular proteins
Reactome : Late Phase of HIV Life Cycle
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Signal Transduction
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
WikiPathway : IL-9 signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy

Clone

Cloning Information : 205272
HIP Master Clone ID : 14341
Original Clone ID : FLH205272.01L

Organism


TAX_ID : 9606
Species Specific ID: 1025

Genome

Chromosome : 9
Map Location : 9q34.1
Ensembl : ENSG00000136807

Reagents

Labome : cdk9-antibody