DNASU Plasmid Repository • 480.965.5697 | Email

MAP2K3 (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAP2K3
Gene Name:  mitogen-activated protein kinase kinase 3
Sequence             
Original Clone ID: FLH205291.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00038423

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 957nts         Open reading frame : 1 to 957
Reference Sequence Alignment

ATGTCCAAGCCACCCGCACCCAACCCCACACCCCCCCGGAACCTGGACTCCCGGACCTTC
ATCACCATTGGAGACAGAAACTTTGAGGTGGAGGCTGATGACTTGGTGACCATCTCAGAA
CTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAGGTGCGGCACGCCCAGAGCGGCACCATC
ATGGCCGTGAAGCGGATCCGGGCCACCGTGAACTCACAGGAGCAGAAGCGGCTGCTCATG
GACCTGGACATCAACATGCGCACGGTCGACTGTTTCTACACTGTCACCTTCTACGGGGCA
CTATTCAGAGAGGGAGACGTGTGGATCTGCATGGAGCTCATGGACACATCCTTGGACAAG
TTCTACCGGAAGGTGCTGGATAAAAACATGACAATTCCAGAGGACATCCTTGGGGAGATT
GCTGTGTCTATCGTGCGGGCCCTGGAGCATCTGCACAGCAAGCTGTCGGTGATCCACAGA
GATGTGAAGCCCTCCAATGTCCTTATCAACAAGGAGGGCCATGTGAAGATGTGTGACTTT
GGCATCAGTGGCTACTTGGTGGACTCTGTGGCCAAGACGATGGATGCCGGCTGCAAGCCC
TACATGGCCCCTGAGAGGATCAACCCAGAGCTGAACCAGAAGGGCTACAATGTCAAGTCC
GACGTCTGGAGCCTGGGCATCACCATGATTGAGATGGCCATCCTGCGGTTCCCTTACGAG
TCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAGGTGGTGGAGGAGCCGTCCCCCCAGCTC
CCAGCCGACCGTTTCTCCCCCGAGTTTGTGGACTTCACTGCTCAGTGCCTGAGGAAGAAC
CCCGCAGAGCGTATGAGCTACCTGGAGCTGATGGAGCACCCCTTCTTCACCTTGCACAAA
ACCAAGAAGACGGACATTGCTGCCTTCGTGAAGGAGATCCTGGGAGAAGACTCATGG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1294
Start on reference sequence 338
Mutations:
None
Discrepancy:
a934g,K312E
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAP2K3
Symbol Nomenclature : MAP2K3
SYNONYM : MAPKK3; MEK3; MKK3; PRKMK3; SAPKK-2; SAPKK2
Designation : MAP kinase kinase 3|MAPK/ERK kinase 3|MAPKK 3|MEK 3|SAPK kinase 2|dual specificity mitogen-activated protein kinase kinase 3|stress-activated protein kinase kinase 2
Full Nomenclature : mitogen-activated protein kinase kinase 3
GENEID : 5606
HGNC : 6843
MIM : 602315
Vega : OTTHUMG00000134322
Target GenBank: NM_002756

 

Reference Sequence Alignment

  

HsCD00038423        ------------------------------------------------------------
XM_005256723.1      ------------------------------------------------------------
NM_002756.4         ------------------------------------------------------------
NM_145109.2         ATGGAGTCGCCCGCCTCGAGCCAGCCCGCCAGCATGCCCCAGTCCAAAGGAAAATCCAAG
XM_005256722.1      ------------------------------------------------------------
                                                                                

HsCD00038423        ---------------------------ATGTCCAAGCCACCCGCACCCAACCCCACACCC
XM_005256723.1      ---------------------------ATGTCCAAGCCACCCGCACCCAACCCCACACCC
NM_002756.4         ---------------------------ATGTCCAAGCCACCCGCACCCAACCCCACACCC
NM_145109.2         AGGAAGAAGGATCTACGGATATCCTGCATGTCCAAGCCACCCGCACCCAACCCCACACCC
XM_005256722.1      ---------------------------ATGTCCAAGCCACCCGCACCCAACCCCACACCC
                                               *********************************

HsCD00038423        CCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAG
XM_005256723.1      CCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAG
NM_002756.4         CCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAG
NM_145109.2         CCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAG
XM_005256722.1      CCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGACAGAAACTTTGAGGTGGAG
                    ************************************************************

HsCD00038423        GCTGATGACTTGGTGACCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAG
XM_005256723.1      GCTGATGACTTGGTGACCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAG
NM_002756.4         GCTGATGACTTGGTGACCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAG
NM_145109.2         GCTGATGACTTGGTGACCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAG
XM_005256722.1      GCTGATGACTTGGTGACCATCTCAGAACTGGGCCGTGGAGCCTATGGGGTGGTAGAGAAG
                    ************************************************************

HsCD00038423        GTGCGGCACGCCCAGAGCGGCACCATCATGGCCGTGAAGCGGATCCGGGCCACCGTGAAC
XM_005256723.1      GTGCGGCACGCCCAGAGCGGCACCATCATGGCCGTGAAGCGGATCCGGGCCACCGTGAAC
NM_002756.4         GTGCGGCACGCCCAGAGCGGCACCATCATGGCCGTGAAGCGGATCCGGGCCACCGTGAAC
NM_145109.2         GTGCGGCACGCCCAGAGCGGCACCATCATGGCCGTGAAGCGGATCCGGGCCACCGTGAAC
XM_005256722.1      GTGCGGCACGCCCAGAGCGGCACCATCATGGCCGTGAAGCGGATCCGGGCCACCGTGAAC
                    ************************************************************

HsCD00038423        TCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGT
XM_005256723.1      TCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGT
NM_002756.4         TCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGT
NM_145109.2         TCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGT
XM_005256722.1      TCACAGGAGCAGAAGCGGCTGCTCATGGACCTGGACATCAACATGCGCACGGTCGACTGT
                    ************************************************************

HsCD00038423        TTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATG
XM_005256723.1      TTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATG
NM_002756.4         TTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATG
NM_145109.2         TTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATG
XM_005256722.1      TTCTACACTGTCACCTTCTACGGGGCACTATTCAGAGAGGGAGACGTGTGGATCTGCATG
                    ************************************************************

HsCD00038423        GAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACA
XM_005256723.1      GAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACA
NM_002756.4         GAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACA
NM_145109.2         GAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACA
XM_005256722.1      GAGCTCATGGACACATCCTTGGACAAGTTCTACCGGAAGGTGCTGGATAAAAACATGACA
                    ************************************************************

HsCD00038423        ATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTG
XM_005256723.1      ATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTG
NM_002756.4         ATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTG
NM_145109.2         ATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTG
XM_005256722.1      ATTCCAGAGGACATCCTTGGGGAGATTGCTGTGTCTATCGTGCGGGCCCTGGAGCATCTG
                    ************************************************************

HsCD00038423        CACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAG
XM_005256723.1      CACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAG
NM_002756.4         CACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAG
NM_145109.2         CACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAG
XM_005256722.1      CACAGCAAGCTGTCGGTGATCCACAGAGATGTGAAGCCCTCCAATGTCCTTATCAACAAG
                    ************************************************************

HsCD00038423        GAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCC
XM_005256723.1      GAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCC
NM_002756.4         GAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCC
NM_145109.2         GAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCC
XM_005256722.1      GAGGGCCATGTGAAGATGTGTGACTTTGGCATCAGTGGCTACTTGGTGGACTCTGTGGCC
                    ************************************************************

HsCD00038423        AAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTG
XM_005256723.1      AAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTG
NM_002756.4         AAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTG
NM_145109.2         AAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTG
XM_005256722.1      AAGACGATGGATGCCGGCTGCAAGCCCTACATGGCCCCTGAGAGGATCAACCCAGAGCTG
                    ************************************************************

HsCD00038423        AACCAGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGCATCACCATGATTGAG
XM_005256723.1      AACCAGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGCATCACCATGATTGAG
NM_002756.4         AACCAGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGCATCACCATGATTGAG
NM_145109.2         AACCAGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGCATCACCATGATTGAG
XM_005256722.1      AACCAGAAGGGCTACAATGTCAAGTCCGACGTCTGGAGCCTGGGCATCACCATGATTGAG
                    ************************************************************

HsCD00038423        ATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAG
XM_005256723.1      ATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAG
NM_002756.4         ATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAG
NM_145109.2         ATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAG
XM_005256722.1      ATGGCCATCCTGCGGTTCCCTTACGAGTCCTGGGGGACCCCGTTCCAGCAGCTGAAGCAG
                    ************************************************************

HsCD00038423        GTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCCGACCGTTTCTCCCCCGAGTTTGTGGAC
XM_005256723.1      GTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCCGACCGTTTCTCCCCCGAGTTTGTGGAC
NM_002756.4         GTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCCGACCGTTTCTCCCCCGAGTTTGTGGAC
NM_145109.2         GTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCCGACCGTTTCTCCCCCGAGTTTGTGGAC
XM_005256722.1      GTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCCGACCGTTTCTCCCCCGAGTTTGTGGAC
                    ************************************************************

HsCD00038423        TTCACTGCTCAGTGCCTGAGGAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGATG
XM_005256723.1      TTCACTGCTCAGTGCCTGAGGAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGATG
NM_002756.4         TTCACTGCTCAGTGCCTGAGGAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGATG
NM_145109.2         TTCACTGCTCAGTGCCTGAGGAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGATG
XM_005256722.1      TTCACTGCTCAGTGCCTGAGGAAGAACCCCGCAGAGCGTATGAGCTACCTGGAGCTGATG
                    ************************************************************

HsCD00038423        GAGCACCCCTTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTTCGTGAAG
XM_005256723.1      GAGCACCCCTTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTTCGTGAAG
NM_002756.4         GAGCACCCCTTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTTCGTGAAG
NM_145109.2         GAGCACCCCTTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTTCGTGAAG
XM_005256722.1      GAGCACCCCTTCTTCACCTTGCACAAAACCAAGAAGACGGACATTGCTGCCTTCGTGAAG
                    ************************************************************

HsCD00038423        GAGATCCTGGGAGAAGACTCATGG
XM_005256723.1      GAGATCCTGGGAGAAGACTCATAG
NM_002756.4         GAGATCCTGGGAGAAGACTCATAG
NM_145109.2         GAGATCCTGGGAGAAGACTCATAG
XM_005256722.1      GAGATCCTGGGAGAAGACTCATAG
                    **********************.*

Pathways

NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : Cellular roles of Anthrax toxin
NCI : IL12-mediated signaling events
NCI : RAC1 signaling pathway
NCI : Regulation of p38-alpha and p38-beta
NCI : RhoA signaling pathway
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling mediated by p38-gamma and p38-delta
NCI : TNF receptor signaling pathway
NCI : Trk receptor signaling mediated by the MAPK pathway
NCI : p38 MAPK signaling pathway
Panther : Apoptosis signaling pathway
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Integrin signalling pathway
Panther : Oxidative stress response
Panther : Ras Pathway
Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : Oxidative Stress Induced Senescence
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : MAPK Cascade
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Physiological and Pathological Hypertrophy of the Heart
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Senescence and Autophagy
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TSH signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 205291
HIP Master Clone ID : 37124
Original Clone ID : FLH205291.01L

Organism


TAX_ID : 9606
Species Specific ID: 5606

Genome

Chromosome : 17
Map Location : 17q11.2
Ensembl : ENSG00000034152

Reagents

Labome : MKK3-antibody