DNASU Plasmid Repository • 480.965.5697 | Email

MAP2K5 (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAP2K5
Gene Name:  mitogen-activated protein kinase kinase 5
Sequence             
Original Clone ID: FLH205294.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038426

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1347nts         Open reading frame : 1 to 1347
Reference Sequence Alignment

ATGCTGTGGCTAGCCCTTGGCCCCTTTCCTGCCATGGAGAACCAGGTGCTGGTAATTCGC
ATCAAGATCCCAAATAGTGGCGCGGTGGACTGGACAGTGCACTCCGGGCCGCAGTTACTC
TTCAGGGATGTGCTGGATGTGATAGGCCAGGTTCTGCCTGAAGCAACAACTACAGCATTT
GAATATGAAGATGAAGATGGTGATCGAATTACAGTGAGAAGTGATGAGGAAATGAAGGCA
ATGCTGTCATATTATTATTCCACAGTAATGGAACAGCAAGTAAATGGACAGTTAATAGAG
CCTCTGCAGATATTTCCAAGAGCCTGCAAGCCTCCTGGGGAACGGAACATACATGGCCTG
AAGGTGAATACTCGGGCCGGACCCTCTCAACACAGCAGCCCAGCAGTCTCAGATTCACTT
CCAAGCAATAGCTTAAAGAAGTCTTCTGCTGAACTGAAAAAAATACTAGCCAATGGCCAG
ATGAATGAACAAGACATACGATATCGGGACACTCTTGGTCATGGCAACGGAGGCACAGTC
TACAAAGCATATCATGTCCCGAGTGGGAAAATATTAGCTGTAAAGGTCATACTACTAGAT
ATTACACTGGAACTTCAGAAGCAAATTATGTCTGAATTGGAAATTCTTTATAAGTGCGAT
TCATCATATATCATTGGATTTTATGGAGCATTTTTTGTAGAAAACAGGATTTCAATATGT
ACAGAATTCATGGATGGGGGATCTTTGGATGTATATAGGAAAATGCCAGAACATGTCCTT
GGAAGAATTGCAGTAGCAGTTGTTAAAGGCCTTACTTATTTGTGGAGTTTAAAGATTTTA
CATAGAGACGTGAAGCCCTCCAATATGCTAGTAAACACAAGAGGACAGGTTAAGCTGTGT
GATTTTGGAGTTAGCACTCAGCTGGTGAATTCTATAGCCAAGACGTATGTTGGAACAAAT
GCTTATATGGCGCCTGAAAGGATTTCAGGGGAGCAGTATGGAATTCATTCTGATGTCTGG
AGCTTAGGAATCTCTTTTATGGAGCTTGCTCTTGGGAGGTTTCCATATCCTCAGATTCAG
AAAAACCAGGGATCTTTAATGCCTCTCCAGCTTCTGCAGTGCATTGTTGATGAGGATTCG
CCCGTCCTTCCAGTTGGAGAGTTCTCGGAGCCATTTGTACATTTCATCACTCAGTGTATG
CGAAAACAGCCAAAAGAAAGGCCAGCACCTGAAGAATTGATGGGCCACCCGTTCATCGTG
CAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGGGTGTGCCGGGCGCTGGAGGAG
AGGCGGAGCCAGCAGGGGCCCCCGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1666
Start on reference sequence 320
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAP2K5
Symbol Nomenclature : MAP2K5
SYNONYM : HsT17454; MAPKK5; MEK5; PRKMK5
Designation : MAP kinase kinase 5|MAP kinase kinase MEK5b|MAPK/ERK kinase 5|MAPKK 5|MEK 5|dual specificity mitogen-activated protein kinase kinase 5
Full Nomenclature : mitogen-activated protein kinase kinase 5
GENEID : 5607
HGNC : 6845
MIM : 602520
Vega : OTTHUMG00000133264
Target GenBank: BC008838

 

Reference Sequence Alignment

  

HsCD00038426        ATGCTGTGGCTAGCCCTTGGCCCCTTTCCTGCCATGGAGAACCAGGTGCTGGTAATTCGC
NM_002757.3         ATGCTGTGGCTAGCCCTTGGCCCCTTTCCTGCCATGGAGAACCAGGTGCTGGTAATTCGC
NM_145160.2         ATGCTGTGGCTAGCCCTTGGCCCCTTTCCTGCCATGGAGAACCAGGTGCTGGTAATTCGC
NM_001206804.1      ------------------------------------------------------------
                                                                                

HsCD00038426        ATCAAGATCCCAAATAGTGGCGCGGTGGACTGGACAGTGCACTCCGGGCCGCAGTTACTC
NM_002757.3         ATCAAGATCCCAAATAGTGGCGCGGTGGACTGGACAGTGCACTCCGGGCCGCAGTTACTC
NM_145160.2         ATCAAGATCCCAAATAGTGGCGCGGTGGACTGGACAGTGCACTCCGGGCCGCAGTTACTC
NM_001206804.1      ------------------------------------------------ATGATGGAGGGT
                                                                    . *.:* :.   

HsCD00038426        TTCAGGGATGTGCTGGATGTGATAGGCCAGGTTCTGCCTGAAGCAACAACTACAGCATTT
NM_002757.3         TTCAGGGATGTGCTGGATGTGATAGGCCAGGTTCTGCCTGAAGCAACAACTACAGCATTT
NM_145160.2         TTCAGGGATGTGCTGGATGTGATAGGCCAGGTTCTGCCTGAAGCAACAACTACAGCATTT
NM_001206804.1      CACTTTCCCCAGAGCGATGTGATAGGCCAGGTTCTGCCTGAAGCAACAACTACAGCATTT
                     :*:   .  :*.  *********************************************

HsCD00038426        GAATATGAAGATGAAGATGGTGATCGAATTACAGTGAGAAGTGATGAGGAAATGAAGGCA
NM_002757.3         GAATATGAAGATGAAGATGGTGATCGAATTACAGTGAGAAGTGATGAGGAAATGAAGGCA
NM_145160.2         GAATATGAAGATGAAGATGGTGATCGAATTACAGTGAGAAGTGATGAGGAAATGAAGGCA
NM_001206804.1      GAATATGAAGATGAAGATGGTGATCGAATTACAGTGAGAAGTGATGAGGAAATGAAGGCA
                    ************************************************************

HsCD00038426        ATGCTGTCATATTATTATTCCACAGTAATGGAACAGCAAGTAAATGGACAGTTAATAGAG
NM_002757.3         ATGCTGTCATATTATTATTCCACAGTAATGGAACAGCAAGTAAATGGACAGTTAATAGAG
NM_145160.2         ATGCTGTCATATTATTATTCCACAGTAATGGAACAGCAAGTAAATGGACAGTTAATAGAG
NM_001206804.1      ATGCTGTCATATTATTATTCCACAGTAATGGAACAGCAAGTAAATGGACAGTTAATAGAG
                    ************************************************************

HsCD00038426        CCTCTGCAGATATTTCCAAGAGCCTGCAAGCCTCCTGGGGAACGGAACATACATGGCCTG
NM_002757.3         CCTCTGCAGATATTTCCAAGAGCCTGCAAGCCTCCTGGGGAACGGAACATACATGGCCTG
NM_145160.2         CCTCTGCAGATATTTCCAAGAGCCTGCAAGCCTCCTGGGGAACGGAACATACATGGCCTG
NM_001206804.1      CCTCTGCAGATATTTCCAAGAGCCTGCAAGCCTCCTGGGGAACGGAACATACATGGCCTG
                    ************************************************************

HsCD00038426        AAGGTGAATACTCGGGCCGGACCCTCTCAACACAGCAGCCCAGCAGTCTCAGATTCACTT
NM_002757.3         AAGGTGAATACTCGGGCCGGACCCTCTCAACACAGCAGCCCAGCAGTCTCAGATTCACTT
NM_145160.2         AAGGTGAATACTCGGGCCGGACCCTCTCAACACAGCAGCCCAGCAGTCTCAGATTCACTT
NM_001206804.1      AAGGTGAATACTCGGGCCGGACCCTCTCAACACAGCAGCCCAGCAGTCTCAGATTCACTT
                    ************************************************************

HsCD00038426        CCAAGCAATAGCTTAAAGAAGTCTTCTGCTGAACTGAAAAAAATACTAGCCAATGGCCAG
NM_002757.3         CCAAGCAATAGCTTAAAGAAGTCTTCTGCTGAACTGAAAAAAATACTAGCCAATGGCCAG
NM_145160.2         CCAAGCAATAGCTTAAAGAAGTCTTCTGCTGAACTGAAAAAAATACTAGCCAATGGCCAG
NM_001206804.1      CCAAGCAATAGCTTAAAGAAGTCTTCTGCTGAACTGAAAAAAATACTAGCCAATGGCCAG
                    ************************************************************

HsCD00038426        ATGAATGAACAAGACATACGATATCGGGACACTCTTGGTCATGGCAACGGAGGCACAGTC
NM_002757.3         ATGAATGAACAAGACATACGATATCGGGACACTCTTGGTCATGGCAACGGAGGCACAGTC
NM_145160.2         ATGAATGAACAAGACATACGATATCGGGACACTCTTGGTCATGGCAACGGAGGCACAGTC
NM_001206804.1      ATGAATGAACAAGACATACGATATCGGGACACTCTTGGTCATGGCAACGGAGGCACAGTC
                    ************************************************************

HsCD00038426        TACAAAGCATATCATGTCCCGAGTGGGAAAATATTAGCTGTAAAGGTCATACTACTAGAT
NM_002757.3         TACAAAGCATATCATGTCCCGAGTGGGAAAATATTAGCTGTAAAGGTCATACTACTAGAT
NM_145160.2         TACAAAGCATATCATGTCCCGAGTGGGAAAATATTAGCTGTAAAGGTCATACTACTAGAT
NM_001206804.1      TACAAAGCATATCATGTCCCGAGTGGGAAAATATTAGCTGTAAAGGTCATACTACTAGAT
                    ************************************************************

HsCD00038426        ATTACACTGGAACTTCAGAAGCAAATTATGTCTGAATTGGAAATTCTTTATAAGTGCGAT
NM_002757.3         ATTACACTGGAACTTCAGAAGCAAATTATGTCTGAATTGGAAATTCTTTATAAGTGCGAT
NM_145160.2         ATTACACTGGAACTTCAGAAGCAAATTATGTCTGAATTGGAAATTCTTTATAAGTGCGAT
NM_001206804.1      ATTACACTGGAACTTCAGAAGCAAATTATGTCTGAATTGGAAATTCTTTATAAGTGCGAT
                    ************************************************************

HsCD00038426        TCATCATATATCATTGGATTTTATGGAGCATTTTTTGTAGAAAACAGGATTTCAATATGT
NM_002757.3         TCATCATATATCATTGGATTTTATGGAGCATTTTTTGTAGAAAACAGGATTTCAATATGT
NM_145160.2         TCATCATATATCATTGGATTTTATGGAGCATTTTTTGTAGAAAACAGGATTTCAATATGT
NM_001206804.1      TCATCATATATCATTGGATTTTATGGAGCATTTTTTGTAGAAAACAGGATTTCAATATGT
                    ************************************************************

HsCD00038426        ACAGAATTCATGGATGGGGGATCTTTGGATGTATATAGGAAAATGCCAGAACATGTCCTT
NM_002757.3         ACAGAATTCATGGATGGGGGATCTTTGGATGTATATAGGAAAATGCCAGAACATGTCCTT
NM_145160.2         ACAGAATTCATGGATGGGGGATCTTTGGATGTATATAGGAAAATGCCAGAACATGTCCTT
NM_001206804.1      ACAGAATTCATGGATGGGGGATCTTTGGATGTATATAGGAAAATGCCAGAACATGTCCTT
                    ************************************************************

HsCD00038426        GGAAGAATTGCAGTAGCAGTTGTTAAAGGCCTTACTTATTTGTGGAGTTTAAAGATTTTA
NM_002757.3         GGAAGAATTGCAGTAGCAGTTGTTAAAGGCCTTACTTATTTGTGGAGTTTAAAGATTTTA
NM_145160.2         GGAAGAATTGCAGTAGCAGTTGTTAAAGGCCTTACTTATTTGTGGAGTTTAAAGATTTTA
NM_001206804.1      GGAAGAATTGCAGTAGCAGTTGTTAAAGGCCTTACTTATTTGTGGAGTTTAAAGATTTTA
                    ************************************************************

HsCD00038426        CATAGAGACGTGAAGCCCTCCAATATGCTAGTAAACACAAGAGGACAGGTTAAGCTGTGT
NM_002757.3         CATAGAGACGTGAAGCCCTCCAATATGCTAGTAAACACAAGAGGACAGGTTAAGCTGTGT
NM_145160.2         CATAGAGACGTGAAGCCCTCCAATATGCTAGTAAACACAAGAGGACAGGTTAAGCTGTGT
NM_001206804.1      CATAGAGACGTGAAGCCCTCCAATATGCTAGTAAACACAAGAGGACAGGTTAAGCTGTGT
                    ************************************************************

HsCD00038426        GATTTTGGAGTTAGCACTCAGCTGGTGAATTCTATAGCCAAGACGTATGTTGGAACAAAT
NM_002757.3         GATTTTGGAGTTAGCACTCAGCTGGTGAATTCTATAGCCAAGACGTATGTTGGAACAAAT
NM_145160.2         GATTTTGGAGTTAGCACTCAGCTGGTGAATTCTATAGCCAAGACGTATGTTGGAACAAAT
NM_001206804.1      GATTTTGGAGTTAGCACTCAGCTGGTGAATTCTATAGCCAAGACGTATGTTGGAACAAAT
                    ************************************************************

HsCD00038426        GCTTATATGGCGCCTGAAAGGATTTCAGGGGAGCAGTATGGAATTCATTCTGATGTCTGG
NM_002757.3         GCTTATATGGCGCCTGAAAGGATTTCAGGGGAGCAGTATGGAATTCATTCTGATGTCTGG
NM_145160.2         GCTTATATGGCGCCTGAAAGGATTTCAGGGGAGCAGTATGGAATTCATTCTGATGTCTGG
NM_001206804.1      GCTTATATGGCGCCTGAAAGGATTTCAGGGGAGCAGTATGGAATTCATTCTGATGTCTGG
                    ************************************************************

HsCD00038426        AGCTTAGGAATCTCTTTTATGGAGCTTGCTCTTGGGAGGTTTCCATATCCTCAGATTCAG
NM_002757.3         AGCTTAGGAATCTCTTTTATG------------------------------GAGATTCAG
NM_145160.2         AGCTTAGGAATCTCTTTTATGGAGCTTGCTCTTGGGAGGTTTCCATATCCTCAGATTCAG
NM_001206804.1      AGCTTAGGAATCTCTTTTATGGAGCTTGCTCTTGGGAGGTTTCCATATCCTCAGATTCAG
                    *********************                               ********

HsCD00038426        AAAAACCAGGGATCTTTAATGCCTCTCCAGCTTCTGCAGTGCATTGTTGATGAGGATTCG
NM_002757.3         AAAAACCAGGGATCTTTAATGCCTCTCCAGCTTCTGCAGTGCATTGTTGATGAGGATTCG
NM_145160.2         AAAAACCAGGGATCTTTAATGCCTCTCCAGCTTCTGCAGTGCATTGTTGATGAGGATTCG
NM_001206804.1      AAAAACCAGGGATCTTTAATGCCTCTCCAGCTTCTGCAGTGCATTGTTGATGAGGATTCG
                    ************************************************************

HsCD00038426        CCCGTCCTTCCAGTTGGAGAGTTCTCGGAGCCATTTGTACATTTCATCACTCAGTGTATG
NM_002757.3         CCCGTCCTTCCAGTTGGAGAGTTCTCGGAGCCATTTGTACATTTCATCACTCAGTGTATG
NM_145160.2         CCCGTCCTTCCAGTTGGAGAGTTCTCGGAGCCATTTGTACATTTCATCACTCAGTGTATG
NM_001206804.1      CCCGTCCTTCCAGTTGGAGAGTTCTCGGAGCCATTTGTACATTTCATCACTCAGTGTATG
                    ************************************************************

HsCD00038426        CGAAAACAGCCAAAAGAAAGGCCAGCACCTGAAGAATTGATGGGCCACCCGTTCATCGTG
NM_002757.3         CGAAAACAGCCAAAAGAAAGGCCAGCACCTGAAGAATTGATGGGCCACCCGTTCATCGTG
NM_145160.2         CGAAAACAGCCAAAAGAAAGGCCAGCACCTGAAGAATTGATGGGCCACCCGTTCATCGTG
NM_001206804.1      CGAAAACAGCCAAAAGAAAGGCCAGCACCTGAAGAATTGATGGGCCACCCGTTCATCGTG
                    ************************************************************

HsCD00038426        CAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGGGTGTGCCGGGCGCTGGAGGAG
NM_002757.3         CAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGGGTGTGCCGGGCGCTGGAGGAG
NM_145160.2         CAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGGGTGTGCCGGGCGCTGGAGGAG
NM_001206804.1      CAGTTCAATGATGGAAATGCCGCCGTGGTGTCCATGTGGGTGTGCCGGGCGCTGGAGGAG
                    ************************************************************

HsCD00038426        AGGCGGAGCCAGCAGGGGCCCCCGTTG
NM_002757.3         AGGCGGAGCCAGCAGGGGCCCCCGTGA
NM_145160.2         AGGCGGAGCCAGCAGGGGCCCCCGTGA
NM_001206804.1      AGGCGGAGCCAGCAGGGGCCCCCGTGA
                    ************************* .

Pathways

NCI : ErbB1 downstream signaling
NCI : Trk receptor signaling mediated by the MAPK pathway
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Signal Transduction
Reactome : Signalling by NGF
Reactome : Signalling to ERK5
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy

Protein

SMART domain : TyrKc : Tyrosine kinase, catalytic domain
SMART domain : S_TKc : Serine/Threonine protein kinases, catalytic domain
SMART domain : PB1 : PB1 domain
UniProt : B4DE43
UniProt : Q13163
HPRD : 03951

Clone

Cloning Information : 205294
HIP Master Clone ID : 53438
Original Clone ID : FLH205294.01L

Organism


TAX_ID : 9606
Species Specific ID: 5607

Genome

Chromosome : 15
Map Location : 15q23
Ensembl : ENSG00000137764

Reagents

Labome : MEK5-antibody