DNASU Plasmid Repository • 480.965.5697 | Email

ATM (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ATM
Gene Name:  ataxia telangiectasia mutated
Sequence             
Original Clone ID: FLH205297.01L
Keyword: potential short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038428

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 417nts         Open reading frame : 1 to 417
Reference Sequence Alignment

ATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGACCTCTGTGACTTT
TCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTTCCATCGCATGTGGTTAAAGCA
ACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCATTTTAGAAATTCTT
TCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATATGTGAGCAAGCAGCTGAA
ACAAATAATGTTTATAAGAAGCACAGAATTCTTAAAATATATCACCTGTTTGTTAGTTTA
TTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCTTGGGCCTTTGTTCTTCGAGACGTT
ATTTATACTTTGATTCACTATATCAACCAAAGGAAATTAACCATTTTCTCTCAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 490
Start on reference sequence 74
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ATM
Symbol Nomenclature : ATM
SYNONYM : AT1; ATA; ATC; ATD; ATDC; ATE; TEL1; TELO1
Designation : A-T mutated|AT mutated|TEL1, telomere maintenance 1, homolog|serine-protein kinase ATM
Full Nomenclature : ataxia telangiectasia mutated
GENEID : 472
HGNC : 795
MIM : 607585
Vega : OTTHUMG00000166480
Target GenBank: BC007023

 

Reference Sequence Alignment

  

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ATGAGTCTAGTACTTAATGATCTGCTTATCTGCTGCCGTCAACTAGAACATGATAGAGCT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ACAGAACGAAAGAAAGAAGTTGAGAAATTTAAGCGCCTGATTCGAGATCCTGAAACAATT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AAACATCTAGATCGGCATTCAGATTCCAAACAAGGAAAATATTTGAATTGGGATGCTGTT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TTTAGATTTTTACAGAAATATATTCAGAAAGAAACAGAATGTCTGAGAATAGCAAAACCA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AATGTATCAGCCTCAACACAAGCCTCCAGGCAGAAAAAGATGCAGGAAATCAGTAGTTTG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GTCAAATACTTCATCAAATGTGCAAACAGAAGAGCACCTAGGCTAAAATGTCAAGAACTC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TTAAATTATATCATGGATACAGTGAAAGATTCATCTAATGGTGCTATTTACGGAGCTGAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TGTAGCAACATACTACTCAAAGACATTCTTTCTGTGAGAAAATACTGGTGTGAAATATCT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CAGCAACAGTGGTTAGAATTGTTCTCTGTGTACTTCAGGCTCTATCTGAAACCTTCACAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GATGTTCATAGAGTTTTAGTGGCTAGAATAATTCATGCTGTTACCAAAGGATGCTGTTCT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CAGACTGACGGATTAAATTCCAAATTTTTGGACTTTTTTTCCAAGGCTATTCAGTGTGCG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AGACAAGAAAAGAGCTCTTCAGGTCTAAATCATATCTTAGCAGCTCTTACTATCTTCCTC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AAGACTTTGGCTGTCAACTTTCGAATTCGAGTGTGTGAATTAGGAGATGAAATTCTTCCC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ACTTTGCTTTATATTTGGACTCAACATAGGCTTAATGATTCTTTAAAAGAAGTCATTATT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GAATTATTTCAACTGCAAATTTATATCCATCATCCGAAAGGAGCCAAAACCCAAGAAAAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GGTGCTTATGAATCAACAAAATGGAGAAGTATTTTATACAACTTATATGATCTGCTAGTG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AATGAGATAAGTCATATAGGAAGTAGAGGAAAGTATTCTTCAGGATTTCGTAATATTGCC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GTCAAAGAAAATTTGATTGAATTGATGGCAGATATCTGTCACCAGGTTTTTAATGAAGAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ACCAGATCCTTGGAGATTTCTCAATCTTACACTACTACACAAAGAGAATCTAGTGATTAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AGTGTCCCTTGCAAAAGGAAGAAAATAGAACTAGGCTGGGAAGTAATAAAAGATCACCTT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CAGAAGTCACAGAATGATTTTGATCTTGTGCCTTGGCTACAGATTGCAACCCAATTAATA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TCAAAGTATCCTGCAAGTTTACCTAACTGTGAGCTGTCTCCATTACTGATGATACTATCT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CAGCTTCTACCCCAACAGCGACATGGGGAACGTACACCATATGTGTTACGATGCCTTACG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GAAGTTGCATTGTGTCAAGACAAGAGGTCAAACCTAGAAAGCTCACAAAAGTCAGATTTA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TTAAAACTCTGGAATAAAATTTGGTGTATTACCTTTCGTGGTATAAGTTCTGAGCAAATA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CAAGCTGAAAACTTTGGCTTACTTGGAGCCATAATTCAGGGTAGTTTAGTTGAGGTTGAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AGAGAATTCTGGAAGTTATTTACTGGGTCAGCCTGCAGACCTTCATGTCCTGCAGTATGC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TGTTTGACTTTGGCACTGACCACCAGTATAGTTCCAGGAACGGTAAAAATGGGAATAGAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CAAAATATGTGTGAAGTAAATAGAAGCTTTTCTTTAAAGGAATCAATAATGAAATGGCTC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TTATTCTATCAGTTAGAGGGTGACTTAGAAAATAGCACAGAAGTGCCTCCAATTCTTCAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AGTAATTTTCCTCATCTTGTACTGGAGAAAATTCTTGTGAGTCTCACTATGAAAAACTGT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AAAGCTGCAATGAATTTTTTCCAAAGCGTGCCAGAATGTGAACACCACCAAAAAGATAAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GAAGAACTTTCATTCTCAGAAGTAGAAGAACTATTTCTTCAGACAACTTTTGACAAGATG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GACTTTTTAACCATTGTGAGAGAATGTGGTATAGAAAAGCACCAGTCCAGTATTGGCTTC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TCTGTCCACCAGAATCTCAAGGAATCACTGGATCGCTGTCTTCTGGGATTATCAGAACAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTTCTGAATAATTACTCATCTGAGATTACAAATTCAGAAACTCTTGTCCGGTGTTCACGT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTTTTGGTGGGTGTCCTTGGCTGCTACTGTTACATGGGTGTAATAGCTGAAGAGGAAGCA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TATAAGTCAGAATTATTCCAGAAAGCCAAGTCTCTAATGCAATGTGCAGGAGAAAGTATC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ACTCTGTTTAAAAATAAGACAAATGAGGAATTCAGAATTGGTTCCTTGAGAAATATGATG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CAGCTATGTACACGTTGCTTGAGCAACTGTACCAAGAAGAGTCCAAATAAGATTGCATCT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GGCTTTTTCCTGCGATTGTTAACATCAAAGCTAATGAATGACATTGCAGATATTTGTAAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AGTTTAGCATCCTTCATCAAAAAGCCATTTGACCGTGGAGAAGTAGAATCAATGGAAGAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GATACTAATGGAAATCTAATGGAGGTGGAGGATCAGTCATCCATGAATCTATTTAACGAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TACCCTGATAGTAGTGTTAGTGATGCAAACGAACCTGGAGAGAGCCAAAGTACCATAGGT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GCCATTAATCCTTTAGCTGAAGAATATCTGTCAAAGCAAGATCTACTTTTCTTAGACATG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTCAAGTTCTTGTGTTTGTGTGTAACTACTGCTCAGACCAATACTGTGTCCTTTAGGGCA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GCTGATATTCGGAGGAAATTGTTAATGTTAATTGATTCTAGCACGCTAGAACCTACCAAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TCCCTCCACCTGCATATGTATCTAATGCTTTTAAAGGAGCTTCCTGGAGAAGAGTACCCC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TTGCCAATGGAAGATGTTCTTGAACTTCTGAAACCACTATCCAATGTGTGTTCTTTGTAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CGTCGTGACCAAGATGTTTGTAAAACTATTTTAAACCATGTCCTTCATGTAGTGAAAAAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTAGGTCAAAGCAATATGGACTCTGAGAACACAAGGGATGCTCAAGGACAGTTTCTTACA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GTAATTGGAGCATTTTGGCATCTAACAAAGGAGAGGAAATATATATTCTCTGTAAGAATG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GCCCTAGTAAATTGCCTTAAAACTTTGCTTGAGGCTGATCCTTATTCAAAATGGGCCATT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTTAATGTAATGGGAAAAGACTTTCCTGTAAATGAAGTATTTACACAATTTCTTGCTGAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AATCATCACCAAGTTCGCATGTTGGCTGCAGAGTCAATCAATAGATTGTTCCAGGACACG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AAGGGAGATTCTTCCAGGTTACTGAAAGCACTTCCTTTGAAGCTTCAGCAAACAGCTTTT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GAAAATGCATACTTGAAAGCTCAGGAAGGAATGAGAGAAATGTCCCATAGTGCTGAGAAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CCTGAAACTTTGGATGAAATTTATAATAGAAAATCTGTTTTACTGACGTTGATAGCTGTG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GTTTTATCCTGTAGCCCTATCTGCGAAAAACAGGCTTTGTTTGCCCTGTGTAAATCTGTG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AAAGAGAATGGATTAGAACCTCACCTTGTGAAAAAGGTTTTAGAGAAAGTTTCTGAAACT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TTTGGATATAGACGTTTAGAAGACTTTATGGCATCTCATTTAGATTATCTGGTTTTGGAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TGGCTAAATCTTCAAGATACTGAATACAACTTATCTTCTTTTCCTTTTATTTTATTAAAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TACACAAATATTGAGGATTTCTATAGATCTTGTTATAAGGTTTTGATTCCACATCTGGTG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ATTAGAAGTCATTTTGATGAGGTGAAGTCCATTGCTAATCAGATTCAAGAGGACTGGAAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AGTCTTCTAACAGACTGCTTTCCAAAGATTCTTGTAAATATTCTTCCTTATTTTGCCTAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GAGGGTACCAGAGACAGTGGGATGGCACAGCAAAGAGAGACTGCTACCAAGGTCTATGAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ATGCTTAAAAGTGAAAACTTATTGGGAAAACAGATTGATCACTTATTCATTAGTAATTTA
                                                                              

HsCD00038428      ------------------------ATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGT
NM_000051.3       CCAGAGATTGTGGTGGAGTTATTGATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGT
                                          ************************************

HsCD00038428      CAGAGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCAT
NM_000051.3       CAGAGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCAT
                  ************************************************************

HsCD00038428      TTTCCATCGCATGTGGTTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAG
NM_000051.3       TTTCCATCGCATGTGATTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAG
                  ***************.********************************************

HsCD00038428      TTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTT
NM_000051.3       TTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTT
                  ************************************************************

HsCD00038428      GCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAA
NM_000051.3       GCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAA
                  ************************************************************

HsCD00038428      ATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCT
NM_000051.3       ATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCT
                  ************************************************************

HsCD00038428      TGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAG----
NM_000051.3       TGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAGGCCT
                  ********************************************************    

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TCTTGTATCATGGATGTGTCATTACGTAGCTTCTCCCTTTGTTGTGACTTATTAAGTCAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GTTTGCCAGACAGCCGTGACTTACTGTAAGGATGCTCTAGAAAACCATCTTCATGTTATT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GTTGGTACACTTATACCCCTTGTGTATGAGCAGGTGGAGGTTCAGAAACAGGTATTGGAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TTGTTGAAATACTTAGTGATAGATAACAAGGATAATGAAAACCTCTATATCACGATTAAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTTTTAGATCCTTTTCCTGACCATGTTGTTTTTAAGGATTTGCGTATTACTCAGCAAAAA
                                                                              

HsCD00038428      ------------------------------------GAAATTAACCATTTTCTCTCAGTT
NM_000051.3       ATCAAATACAGTAGAGGACCCTTTTCACTCTTGGAGGAAATTAACCATTTTCTCTCAGTA
                                                      ***********************:

HsCD00038428      G-----------------------------------------------------------
NM_000051.3       AGTGTTTATGATGCACTTCCATTGACAAGACTTGAAGGACTAAAGGATCTTCGAAGACAA
                  .                                                           

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTGGAACTACATAAAGATCAGATGGTGGACATTATGAGAGCTTCTCAGGATAATCCGCAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GATGGGATTATGGTGAAACTAGTTGTCAATTTGTTGCAGTTATCCAAGATGGCAATAAAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CACACTGGTGAAAAAGAAGTTCTAGAGGCTGTTGGAAGCTGCTTGGGAGAAGTGGGTCCT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ATAGATTTCTCTACCATAGCTATACAACATAGTAAAGATGCATCTTATACCAAGGCCCTT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AAGTTATTTGAAGATAAAGAACTTCAGTGGACCTTCATAATGCTGACCTACCTGAATAAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ACACTGGTAGAAGATTGTGTCAAAGTTCGATCAGCAGCTGTTACCTGTTTGAAAAACATT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TTAGCCACAAAGACTGGACATAGTTTCTGGGAGATTTATAAGATGACAACAGATCCAATG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTGGCCTATCTACAGCCTTTTAGAACATCAAGAAAAAAGTTTTTAGAAGTACCCAGATTT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GACAAAGAAAACCCTTTTGAAGGCCTGGATGATATAAATCTGTGGATTCCTCTAAGTGAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AATCATGACATTTGGATAAAGACACTGACTTGTGCTTTTTTGGACAGTGGAGGCACAAAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TGTGAAATTCTTCAATTATTAAAGCCAATGTGTGAAGTGAAAACTGACTTTTGTCAGACT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GTACTTCCATACTTGATTCATGATATTTTACTCCAAGATACAAATGAATCATGGAGAAAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTGCTTTCTACACATGTTCAGGGATTTTTCACCAGCTGTCTTCGACACTTCTCGCAAACG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AGCCGATCCACAACCCCTGCAAACTTGGATTCAGAGTCAGAGCACTTTTTCCGATGCTGT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TTGGATAAAAAATCACAAAGAACAATGCTTGCTGTTGTGGACTACATGAGAAGACAAAAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AGACCTTCTTCAGGAACAATTTTTAATGATGCTTTCTGGCTGGATTTAAATTATCTAGAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GTTGCCAAGGTAGCTCAGTCTTGTGCTGCTCACTTTACAGCTTTACTCTATGCAGAAATC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TATGCAGATAAGAAAAGTATGGATGATCAAGAGAAAAGAAGTCTTGCATTTGAAGAAGGA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AGCCAGAGTACAACTATTTCTAGCTTGAGTGAAAAAAGTAAAGAAGAAACTGGAATAAGT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TTACAGGATCTTCTCTTAGAAATCTACAGAAGTATAGGGGAGCCAGATAGTTTGTATGGC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TGTGGTGGAGGGAAGATGTTACAACCCATTACTAGACTACGAACATATGAACACGAAGCA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ATGTGGGGCAAAGCCCTAGTAACATATGACCTCGAAACAGCAATCCCCTCATCAACACGC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CAGGCAGGAATCATTCAGGCCTTGCAGAATTTGGGACTCTGCCATATTCTTTCCGTCTAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TTAAAAGGATTGGATTATGAAAATAAAGACTGGTGTCCTGAACTAGAAGAACTTCATTAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CAAGCAGCATGGAGGAATATGCAGTGGGACCATTGCACTTCCGTCAGCAAAGAAGTAGAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GGAACCAGTTACCATGAATCATTGTACAATGCTCTACAATCTCTAAGAGACAGAGAATTC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TCTACATTTTATGAAAGTCTCAAATATGCCAGAGTAAAAGAAGTGGAAGAGATGTGTAAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CGCAGCCTTGAGTCTGTGTATTCGCTCTATCCCACACTTAGCAGGTTGCAGGCCATTGGA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GAGCTGGAAAGCATTGGGGAGCTTTTCTCAAGATCAGTCACACATAGACAACTCTCTGAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GTATATATTAAGTGGCAGAAACACTCCCAGCTTCTCAAGGACAGTGATTTTAGTTTTCAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GAGCCTATCATGGCTCTACGCACAGTCATTTTGGAGATCCTGATGGAAAAGGAAATGGAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AACTCACAAAGAGAATGTATTAAGGACATTCTCACCAAACACCTTGTAGAACTCTCTATA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTGGCCAGAACTTTCAAGAACACTCAGCTCCCTGAAAGGGCAATATTTCAAATTAAACAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TACAATTCAGTTAGCTGTGGAGTCTCTGAGTGGCAGCTGGAAGAAGCACAAGTATTCTGG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GCAAAAAAGGAGCAGAGTCTTGCCCTGAGTATTCTCAAGCAAATGATCAAGAAGTTGGAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GCCAGCTGTGCAGCGAACAATCCCAGCCTAAAACTTACATACACAGAATGTCTGAGGGTT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TGTGGCAACTGGTTAGCAGAAACGTGCTTAGAAAATCCTGCGGTCATCATGCAGACCTAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTAGAAAAGGCAGTAGAAGTTGCTGGAAATTATGATGGAGAAAGTAGTGATGAGCTAAGA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AATGGAAAAATGAAGGCATTTCTCTCATTAGCCCGGTTTTCAGATACTCAATACCAAAGA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ATTGAAAACTACATGAAATCATCGGAATTTGAAAACAAGCAAGCTCTCCTGAAAAGAGCC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AAAGAGGAAGTAGGTCTCCTTAGGGAACATAAAATTCAGACAAACAGATACACAGTAAAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GTTCAGCGAGAGCTGGAGTTGGATGAATTAGCCCTGCGTGCACTGAAAGAGGATCGTAAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CGCTTCTTATGTAAAGCAGTTGAAAATTATATCAACTGCTTATTAAGTGGAGAAGAACAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GATATGTGGGTATTCCGACTTTGTTCCCTCTGGCTTGAAAATTCTGGAGTTTCTGAAGTC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AATGGCATGATGAAGAGAGACGGAATGAAGATTCCAACATATAAATTTTTGCCTCTTATG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TACCAATTGGCTGCTAGAATGGGGACCAAGATGATGGGAGGCCTAGGATTTCATGAAGTC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTCAATAATCTAATCTCTAGAATTTCAATGGATCACCCCCATCACACTTTGTTTATTATA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CTGGCCTTAGCAAATGCAAACAGAGATGAATTTCTGACTAAACCAGAGGTAGCCAGAAGA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AGCAGAATAACTAAAAATGTGCCTAAACAAAGCTCTCAGCTTGATGAGGATCGAACAGAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GCTGCAAATAGAATAATATGTACTATCAGAAGTAGGAGACCTCAGATGGTCAGAAGTGTT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GAGGCACTTTGTGATGCTTATATTATATTAGCAAACTTAGATGCCACTCAGTGGAAGACT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CAGAGAAAAGGCATAAATATTCCAGCAGACCAGCCAATTACTAAACTTAAGAATTTAGAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GATGTTGTTGTCCCTACTATGGAAATTAAGGTGGACCACACAGGAGAATATGGAAATCTG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GTGACTATACAGTCATTTAAAGCAGAATTTCGCTTAGCAGGAGGTGTAAATTTACCAAAA
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ATAATAGATTGTGTAGGTTCCGATGGCAAGGAGAGGAGACAGCTTGTTAAGGGCCGTGAT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GACCTGAGACAAGATGCTGTCATGCAACAGGTCTTCCAGATGTGTAATACATTACTGCAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AGAAACACGGAAACTAGGAAGAGGAAATTAACTATCTGTACTTATAAGGTGGTTCCCCTC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TCTCAGCGAAGTGGTGTTCTTGAATGGTGCACAGGAACTGTCCCCATTGGTGAATTTCTT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GTTAACAATGAAGATGGTGCTCATAAAAGATACAGGCCAAATGATTTCAGTGCCTTTCAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TGCCAAAAGAAAATGATGGAGGTGCAAAAAAAGTCTTTTGAAGAGAAATATGAAGTCTTC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ATGGATGTTTGCCAAAATTTTCAACCAGTTTTCCGTTACTTCTGCATGGAAAAATTCTTG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GATCCAGCTATTTGGTTTGAGAAGCGATTGGCTTATACGCGCAGTGTAGCTACTTCTTCT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ATTGTTGGTTACATACTTGGACTTGGTGATAGACATGTACAGAATATCTTGATAAATGAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CAGTCAGCAGAACTTGTACATATAGATCTAGGTGTTGCTTTTGAACAGGGCAAAATCCTT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CCTACTCCTGAGACAGTTCCTTTTAGACTCACCAGAGATATTGTGGATGGCATGGGCATT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ACGGGTGTTGAAGGTGTCTTCAGAAGATGCTGTGAGAAAACCATGGAAGTGATGAGAAAC
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       TCTCAGGAAACTCTGTTAACCATTGTAGAGGTCCTTCTATATGATCCACTCTTTGACTGG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       ACCATGAATCCTTTGAAAGCTTTGTATTTACAGCAGAGGCCGGAAGATGAAACTGAGCTT
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       CACCCTACTCTGAATGCAGATGACCAAGAATGCAAACGAAATCTCAGTGATATTGACCAG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       AGTTTCAACAAAGTAGCTGAACGTGTCTTAATGAGACTACAAGAGAAACTGAAAGGAGTG
                                                                              

HsCD00038428      ------------------------------------------------------------
NM_000051.3       GAAGAAGGCACTGTGCTCAGTGTTGGTGGACAAGTGAATTTGCTCATACAGCAGGCCATA
                                                                              

HsCD00038428      ---------------------------------------------------
NM_000051.3       GACCCCAAAAATCTCAGCCGACTTTTCCCAGGATGGAAAGCTTGGGTGTGA
                                                                     

Pathways

NCI : ATM pathway
NCI : BARD1 signaling events
NCI : Canonical NF-kappaB pathway
NCI : E2F transcription factor network
NCI : Fanconi anemia pathway
NCI : Regulation of Telomerase
NCI : Validated transcriptional targets of deltaNp63 isoforms
NCI : p38 MAPK signaling pathway
NCI : p53 pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cellular Senescence
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Fanconi Anemia pathway
Reactome : G1/S DNA Damage Checkpoints
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of the Fanconi anemia pathway
Reactome : Stabilization of p53
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : G1 to S cell cycle control
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Ovarian Infertility Genes
WikiPathway : TP53 network
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

UniProt : Q13315
HPRD : 06347

Clone

Cloning Information : 205297
HIP Master Clone ID : 57092
Original Clone ID : FLH205297.01L

Organism


TAX_ID : 9606
Species Specific ID: 472

Genome

Chromosome : 11
Map Location : 11q22-q23
Ensembl : ENSG00000149311

Reagents

Labome : ATM-antibody