DNASU Plasmid Repository • 480.965.5697 | Email

CDK5 (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDK5
Gene Name:  cyclin-dependent kinase 5
Sequence             
Original Clone ID: FLH205302.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038433

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 879nts         Open reading frame : 1 to 879
Reference Sequence Alignment

ATGCAGAAATACGAGAAACTGGAAAAGATTGGGGAAGGCACCTACGGAACTGTGTTCAAG
GCCAAAAACCGGGAGACTCATGAGATCGTGGCTCTGAAACGGGTGAGGCTGGATGACGAT
GATGAGGGTGTGCCGAGTTCCGCCCTCCGGGAGATCTGCCTACTCAAGGAGCTGAAGCAC
AAGAACATCGTCAGGCTTCATGACGTCCTGCACAGCGACAAGAAGCTGACTTTGGTTTTT
GAATTCTGTGACCAGGACCTGAAGAAGTATTTTGACAGTTGCAATGGTGACCTCGATCCT
GAGATTGTAAAGTCATTCCTCTTCCAGCTACTAAAAGGGCTGGGATTCTGTCATAGCCGC
AATGTGCTACACAGGGACCTGAAGCCCCAGAACCTGCTAATAAACAGGAATGGGGAGCTG
AAATTGGCTGATTTTGGCCTGGCTCGAGCCTTTGGGATTCCCGTCCGCTGTTACTCAGCT
GAGGTGGTCACACTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCC
ACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCCAATGCTGGGCGG
CCTCTTTTTCCCGGCAATGATGTCGATGACCAGTTGAAGAGGATCTTCCGACTGCTGGGG
ACGCCCACCGAGGAGCAGTGGCCCTCTATGACCAAGCTGCCAGACTATAAGCCCTATCCG
ATGTACCCGGCCACAACATCCCTGGTGAACGTCGTGCCCAAACTCAATGCCACAGGGAGG
GATCTGCTGCAGAACCTTCTGAAGTGTAACCCTGTCCAGCGTATCTCAGCAGAAGAGGCC
CTGCAGCACCCCTACTTCTCCGACTTCTGTCCGCCCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 904
Start on reference sequence 26
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDK5
Symbol Nomenclature : CDK5
SYNONYM : PSSALRE
Designation : TPKII catalytic subunit|cell division protein kinase 5|protein kinase CDK5 splicing|serine/threonine-protein kinase PSSALRE|tau protein kinase II catalytic subunit
Full Nomenclature : cyclin-dependent kinase 5
GENEID : 1020
HGNC : 1774
MIM : 123831
Target GenBank: BC005115

 

Reference Sequence Alignment

  

HsCD00038433      ATGCAGAAATACGAGAAACTGGAAAAGATTGGGGAAGGCACCTACGGAACTGTGTTCAAG
NM_004935.3       ATGCAGAAATACGAGAAACTGGAAAAGATTGGGGAAGGCACCTACGGAACTGTGTTCAAG
                  ************************************************************

HsCD00038433      GCCAAAAACCGGGAGACTCATGAGATCGTGGCTCTGAAACGGGTGAGGCTGGATGACGAT
NM_004935.3       GCCAAAAACCGGGAGACTCATGAGATCGTGGCTCTGAAACGGGTGAGGCTGGATGACGAT
                  ************************************************************

HsCD00038433      GATGAGGGTGTGCCGAGTTCCGCCCTCCGGGAGATCTGCCTACTCAAGGAGCTGAAGCAC
NM_004935.3       GATGAGGGTGTGCCGAGTTCCGCCCTCCGGGAGATCTGCCTACTCAAGGAGCTGAAGCAC
                  ************************************************************

HsCD00038433      AAGAACATCGTCAGGCTTCATGACGTCCTGCACAGCGACAAGAAGCTGACTTTGGTTTTT
NM_004935.3       AAGAACATCGTCAGGCTTCATGACGTCCTGCACAGCGACAAGAAGCTGACTTTGGTTTTT
                  ************************************************************

HsCD00038433      GAATTCTGTGACCAGGACCTGAAGAAGTATTTTGACAGTTGCAATGGTGACCTCGATCCT
NM_004935.3       GAATTCTGTGACCAGGACCTGAAGAAGTATTTTGACAGTTGCAATGGTGACCTCGATCCT
                  ************************************************************

HsCD00038433      GAGATTGTAAAGTCATTCCTCTTCCAGCTACTAAAAGGGCTGGGATTCTGTCATAGCCGC
NM_004935.3       GAGATTGTAAAGTCATTCCTCTTCCAGCTACTAAAAGGGCTGGGATTCTGTCATAGCCGC
                  ************************************************************

HsCD00038433      AATGTGCTACACAGGGACCTGAAGCCCCAGAACCTGCTAATAAACAGGAATGGGGAGCTG
NM_004935.3       AATGTGCTACACAGGGACCTGAAGCCCCAGAACCTGCTAATAAACAGGAATGGGGAGCTG
                  ************************************************************

HsCD00038433      AAATTGGCTGATTTTGGCCTGGCTCGAGCCTTTGGGATTCCCGTCCGCTGTTACTCAGCT
NM_004935.3       AAATTGGCTGATTTTGGCCTGGCTCGAGCCTTTGGGATTCCCGTCCGCTGTTACTCAGCT
                  ************************************************************

HsCD00038433      GAGGTGGTCACACTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCC
NM_004935.3       GAGGTGGTCACACTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCC
                  ************************************************************

HsCD00038433      ACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCCAATGCTGGGCGG
NM_004935.3       ACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCCAATGCTGGGCGG
                  ************************************************************

HsCD00038433      CCTCTTTTTCCCGGCAATGATGTCGATGACCAGTTGAAGAGGATCTTCCGACTGCTGGGG
NM_004935.3       CCTCTTTTTCCCGGCAATGATGTCGATGACCAGTTGAAGAGGATCTTCCGACTGCTGGGG
                  ************************************************************

HsCD00038433      ACGCCCACCGAGGAGCAGTGGCCCTCTATGACCAAGCTGCCAGACTATAAGCCCTATCCG
NM_004935.3       ACGCCCACCGAGGAGCAGTGGCCCTCTATGACCAAGCTGCCAGACTATAAGCCCTATCCG
                  ************************************************************

HsCD00038433      ATGTACCCGGCCACAACATCCCTGGTGAACGTCGTGCCCAAACTCAATGCCACAGGGAGG
NM_004935.3       ATGTACCCGGCCACAACATCCCTGGTGAACGTCGTGCCCAAACTCAATGCCACAGGGAGG
                  ************************************************************

HsCD00038433      GATCTGCTGCAGAACCTTCTGAAGTGTAACCCTGTCCAGCGTATCTCAGCAGAAGAGGCC
NM_004935.3       GATCTGCTGCAGAACCTTCTGAAGTGTAACCCTGTCCAGCGTATCTCAGCAGAAGAGGCC
                  ************************************************************

HsCD00038433      CTGCAGCACCCCTACTTCTCCGACTTCTGTCCGCCCTTG
NM_004935.3       CTGCAGCACCCCTACTTCTCCGACTTCTGTCCGCCCTAG
                  *************************************:*

Pathways

NCI : EPHA forward signaling
NCI : Glucocorticoid receptor regulatory network
NCI : Lissencephaly gene (LIS1) in neuronal migration and development
NCI : Reelin signaling pathway
NCI : Trk receptor signaling mediated by the MAPK pathway
Panther : Axon guidance mediated by semaphorins
Reactome : Axon guidance
Reactome : CRMPs in Sema3A signaling
Reactome : DARPP-32 events
Reactome : Developmental Biology
Reactome : Factors involved in megakaryocyte development and platelet production
Reactome : Hemostasis
Reactome : Opioid Signalling
Reactome : Semaphorin interactions
Reactome : Signal Transduction
Reactome : Signaling by GPCR
WikiPathway : Alzheimers Disease
WikiPathway : DNA damage response
WikiPathway : Nicotine Activity on Dopaminergic Neurons
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 205302
HIP Master Clone ID : 86981
Original Clone ID : FLH205302.01L

Organism


TAX_ID : 9606
Species Specific ID: 1020

Genome

Chromosome : 7
Map Location : 7q36

Reagents

Labome : Cdk5-antibody