DNASU Plasmid Repository • 480.965.5697 | Email

AK2 (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AK2
Gene Name:  adenylate kinase 2
Sequence             
Original Clone ID: FLH205307.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038436

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 720nts         Open reading frame : 1 to 720
Reference Sequence Alignment

ATGGCTCCCAGCGTGCCAGCGGCAGAACCCGAGTATCCTAAAGGCATCCGGGCCGTGCTG
CTGGGGCCTCCCGGGGCCGGTAAAGGGACCCAGGCACCCAGATTGGCTGAAAACTTCTGT
GTCTGCCATTTAGCTACTGGGGACATGCTGAGGGCCATGGTGGCTTCTGGCTCAGAGCTA
GGAAAAAAGCTGAAGGCAACTATGGATGCTGGGAAACTGGTGAGTGATGAAATGGTAGTG
GAGCTCATTGAGAAGAATTTGGAGACCCCCTTGTGCAAAAATGGTTTTCTTCTGGATGGC
TTCCCTCGGACTGTGAGGCAGGCAGAAATGCTCGATGACCTCATGGAGAAGAGGAAAGAG
AAGCTTGATTCTGTGATTGAATTCAGCATCCCAGACTCTCTGCTGATCCGAAGAATCACA
GGAAGGCTGATTCACCCCAAGAGTGGCCGTTCCTACCACGAGGAGTTCAACCCTCCAAAA
GAGCCCATGAAAGATGACATCACCGGGGAACCCTTGATCCGTCGATCAGATGATAATGAA
AAGGCCTTGAAAATCCGCCTGCAAGCCTACCACACTCAAACCACCCCACTCATAGAGTAC
TACAGGAAACGGGGGATCCACTCCGCCATCGATGCATCCCAGACCCCCGATGTCGTGTTC
GCAAGCATCCTAGCAGCCTTCTCCAAAGCCACATGTAAAGACTTGGTTATGTTTATCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 740
Start on reference sequence 21
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : AK2
Symbol Nomenclature : AK2
SYNONYM : ADK2; AK 2
Designation : ATP-AMP transphosphorylase 2|ATP:AMP phosphotransferase|adenylate kinase 2, mitochondrial|adenylate kinase isoenzyme 2, mitochondrial|adenylate monophosphate kinase
Full Nomenclature : adenylate kinase 2
GENEID : 204
HGNC : 362
MIM : 103020
Vega : OTTHUMG00000004131
Target GenBank: BC009405

 

Reference Sequence Alignment

  

HsCD00038436        ATGGCTCCCAGCGTGCCAGCGGCAGAACCCGAGTATCCTAAAGGCATCCGGGCCGTGCTG
NM_001625.3         ATGGCTCCCAGCGTGCCAGCGGCAGAACCCGAGTATCCTAAAGGCATCCGGGCCGTGCTG
NM_013411.4         ATGGCTCCCAGCGTGCCAGCGGCAGAACCCGAGTATCCTAAAGGCATCCGGGCCGTGCTG
NM_001199199.1      ATGGCTCCCAGCGTGCCAGCGGCAGAACCCGAGTATCCTAAAGGCATCCGGGCCGTGCTG
                    ************************************************************

HsCD00038436        CTGGGGCCTCCCGGGGCCGGTAAAGGGACCCAGGCACCCAGATTGGCTGAAAACTTCTGT
NM_001625.3         CTGGGGCCTCCCGGGGCCGGTAAAGGGACCCAGGCACCCAGATTGGCTGAAAACTTCTGT
NM_013411.4         CTGGGGCCTCCCGGGGCCGGTAAAGGGACCCAGGCACCCAGATTGGCTGAAAACTTCTGT
NM_001199199.1      CTGGGGCCTCCCGGGGCCGGTAAAGGGACCCAGGCACCCAGATTGGCTGAAAACTTCTGT
                    ************************************************************

HsCD00038436        GTCTGCCATTTAGCTACTGGGGACATGCTGAGGGCCATGGTGGCTTCTGGCTCAGAGCTA
NM_001625.3         GTCTGCCATTTAGCTACTGGGGACATGCTGAGGGCCATGGTGGCTTCTGGCTCAGAGCTA
NM_013411.4         GTCTGCCATTTAGCTACTGGGGACATGCTGAGGGCCATGGTGGCTTCTGGCTCAGAGCTA
NM_001199199.1      GTCTGCCATTTAGCTACTGGGGACATGCTGAGGGCCATGGTGGCTTCTGGCTCAGAGCTA
                    ************************************************************

HsCD00038436        GGAAAAAAGCTGAAGGCAACTATGGATGCTGGGAAACTGGTGAGTGATGAAATGGTAGTG
NM_001625.3         GGAAAAAAGCTGAAGGCAACTATGGATGCTGGGAAACTGGTGAGTGATGAAATGGTAGTG
NM_013411.4         GGAAAAAAGCTGAAGGCAACTATGGATGCTGGGAAACTGGTGAGTGATGAAATGGTAGTG
NM_001199199.1      GGAAAAAAGCTGAAGGCAACTATGGATGCTGGGAAACTGGTGAGTGATGAAATGGTAGTG
                    ************************************************************

HsCD00038436        GAGCTCATTGAGAAGAATTTGGAGACCCCCTTGTGCAAAAATGGTTTTCTTCTGGATGGC
NM_001625.3         GAGCTCATTGAGAAGAATTTGGAGACCCCCTTGTGCAAAAATGGTTTTCTTCTGGATGGC
NM_013411.4         GAGCTCATTGAGAAGAATTTGGAGACCCCCTTGTGCAAAAATGGTTTTCTTCTGGATGGC
NM_001199199.1      GAGCTCATTGAGAAGAATTTGGAGACCCCCTTGTGCAAAAATGGTTTTCTTCTGGATGGC
                    ************************************************************

HsCD00038436        TTCCCTCGGACTGTGAGGCAGGCAGAAATGCTCGATGACCTCATGGAGAAGAGGAAAGAG
NM_001625.3         TTCCCTCGGACTGTGAGGCAGGCAGAAATGCTCGATGACCTCATGGAGAAGAGGAAAGAG
NM_013411.4         TTCCCTCGGACTGTGAGGCAGGCAGAAATGCTCGATGACCTCATGGAGAAGAGGAAAGAG
NM_001199199.1      TTCCCTCGGACTGTGAGGCAGGCAGAAATGCTCGATGACCTCATGGAGAAGAGGAAAGAG
                    ************************************************************

HsCD00038436        AAGCTTGATTCTGTGATTGAATTCAGCATCCCAGACTCTCTGCTGATCCGAAGAATCACA
NM_001625.3         AAGCTTGATTCTGTGATTGAATTCAGCATCCCAGACTCTCTGCTGATCCGAAGAATCACA
NM_013411.4         AAGCTTGATTCTGTGATTGAATTCAGCATCCCAGACTCTCTGCTGATCCGAAGAATCACA
NM_001199199.1      AAGCTTGATTCTGTGATTGAATTCAGCATCCCAGACTCTCTGCT----------------
                    ********************************************                

HsCD00038436        GGAAGGCTGATTCACCCCAAGAGTGGCCGTTCCTACCACGAGGAGTTCAACCCTCCAAAA
NM_001625.3         GGAAGGCTGATTCACCCCAAGAGTGGCCGTTCCTACCACGAGGAGTTCAACCCTCCAAAA
NM_013411.4         GGAAGGCTGATTCACCCCAAGAGTGGCCGTTCCTACCACGAGGAGTTCAACCCTCCAAAA
NM_001199199.1      --------GATTCACCCCAAGAGTGGCCGTTCCTACCACGAGGAGTTCAACCCTCCAAAA
                            ****************************************************

HsCD00038436        GAGCCCATGAAAGATGACATCACCGGGGAACCCTTGATCCGTCGATCAGATGATAATGAA
NM_001625.3         GAGCCCATGAAAGATGACATCACCGGGGAACCCTTGATCCGTCGATCAGATGATAATGAA
NM_013411.4         GAGCCCATGAAAGATGACATCACCGGGGAACCCTTGATCCGTCGATCAGATGATAATGAA
NM_001199199.1      GAGCCCATGAAAGATGACATCACCGGGGAACCCTTGATCCGTCGATCAGATGATAATGAA
                    ************************************************************

HsCD00038436        AAGGCCTTGAAAATCCGCCTGCAAGCCTACCACACTCAAACCACCCCACTCATAGAGTAC
NM_001625.3         AAGGCCTTGAAAATCCGCCTGCAAGCCTACCACACTCAAACCACCCCACTCATAGAGTAC
NM_013411.4         AAGGCCTTGAAAATCCGCCTGCAAGCCTACCACACTCAAACCACCCCACTCATAGAGTAC
NM_001199199.1      AAGGCCTTGAAAATCCGCCTGCAAGCCTACCACACTCAAACCACCCCACTCATAGAGTAC
                    ************************************************************

HsCD00038436        TACAGGAAACGGGGGATCCACTCCGCCATCGATGCATCCCAGACCCCCGATGTCGTGTTC
NM_001625.3         TACAGGAAACGGGGGATCCACTCCGCCATCGATGCATCCCAGACCCCCGATGTCGTGTTC
NM_013411.4         TACAGGAAACGGGGGATCCACTCCGCCATCGATGCATCCCAGACCCCCGATGTCGTGTTC
NM_001199199.1      TACAGGAAACGGGGGATCCACTCCGCCATCGATGCATCCCAGACCCCCGATGTCGTGTTC
                    ************************************************************

HsCD00038436        GCAAGCATCCTAGCAGCCTTCTCCAAAGCCACATGTAAAGACTTGGTTATGTTTATCTTG
NM_001625.3         GCAAGCATCCTAGCAGCCTTCTCCAAAGCCACATGTAAAGACTTGGTTATGTTTATCTAA
NM_013411.4         GCAAGCATCCTAGCAGCCTTCTCCAAAGCCACATCCTAG---------------------
NM_001199199.1      GCAAGCATCCTAGCAGCCTTCTCCAAAGCCACATCCTAG---------------------
                    **********************************  :*.                     

Pathways

Panther : De novo purine biosynthesis
Reactome : Metabolism
Reactome : Metabolism of nucleotides
Reactome : Synthesis and interconversion of nucleotide di- and triphosphates

Protein

UniProt : P54819
HPRD : 00047

Clone

Cloning Information : 205307
HIP Master Clone ID : 117730
Original Clone ID : FLH205307.01L

Organism


TAX_ID : 9606
Species Specific ID: 204

Genome

Chromosome : 1
Map Location : 1p34
Ensembl : ENSG00000004455

Reagents

Labome : AK2-antibody