DNASU Plasmid Repository • 480.965.5697 | Email

deoR (Shigella flexneri) in pET21_NESG (His-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  deoR
Gene Name:  DNA-binding transcriptional repressor DeoR
Sequence             
Original Clone ID: SfR254-21.1
Keyword: None
Species: Shigella flexneri
Type: cDNA
Vector Name: pET21_NESG               Format:  FUSION
Source: Northeast Structural Genomics Consortium
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Northeast Structural Genomics Consortium
SfCD00384934

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI/NESG

 

Insert sequence: 756nts         Open reading frame : 51 to 806

AATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGAAACAC
GTCGCGAAGAGCGTATCGGGCAGCTGCTGCAAGAATTAAAACGCAGCGATAAGTTACATC
TTAAAGACGCCGCCGCCCTGCTTGGGGTTTCGGAGATGACGATTCGTCGCGATCTGAACA
ACCACAGTGCGCCCGTCGTTTTGCTCGGCGGCTATATTGTTCTGGAACCGCGCAGTGCCA
GCCATTACCTGTTAAGCGATCAAAAATCCCGCCTGGTGGAAGAAAAACGCCGGGCGGCAA
AACTGGCTGCGACACTGGTAGAACCCGATCAGACCCTCTTTTTTGACTGTGGCACCACCA
CGCCGTGGATTATTGAAGCGATTGATAATGAAATCCCTTTTACCGCCGTTTGTTATTCGC
TAAATACCTTTCTGGCGCTGAAAGAGAAACCCCATTGCCGCGCATTTCTGTGCGGTGGTG
AATTTCACGCCAGCAACGCCATTTTCAAACCCATCGATTTTCAGCAAACGTTGAATAATT
TTTGCCCGGATATCGCTTTTTATTCCGCGGCGGGCGTGCATGTCAGTAAAGGCGCTACCT
GTTTTAATCTTGAAGAGTTGCCGGTAAAACACTGGGCCATGTCGATGGCGCAAAAGCATG
TGCTGGTTGTCGACCACAGTAAATTTGGCAAGGTGCGTCCGGCGCGCATGGGTGACCTGA
AACGCTTTGATATTGTGGTGAGTGATTGTTGCCCGGAAGATGAGTATGTGAAGTACGCGC
AGACGCACCGTATTAAGTTGATGTATCTCGAGCACCACCACCACCACCACTGAGATCCGG
CTGCTAACAAAGCCC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
AAGGAGATATACAT

3' Linker Sequence:
CTCGAGCACCACCACCACCACCACTGA

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in SfR254
Recommended expression in: E. coli BL21
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pET21_NESG

pET21_NESG in advanced viewed

Synonyms: pET21, pET21-modified, pET21Cc, pET21_NESG
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 lac promoter, adds C-terminal 6xHis tag; ampicillin resistance; restriction enzyme cloning.
Comments: Modified Novagen pET vector-common MCS
Size (bp): 5415
Parent Vector: None
Empty Vector: EvNO00336944
Properties: bacterial expression, in vitro transcription, multiple cloning site, with tag/fusion/marker
Author Name: Northeast Structural Genomics Consortium
Gaetano T. Montleione
Thomas B. Acton
Publications: PMID: 15808222
Title: Robotic cloning and Protein Production Platform of the Northeast Structural Genomics Consortium

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS MCS (includes SphI, XbaI, BamHI, EcoRI, XhoI) 157 253
bacterial origin ori pBR322-type bacterial origin of replication 3180 3862
gene fragment ROP ROP 2580 2756
primer T7 forward T7 forward sequencing primer 283 298
primer T7 reverse T7 reverse sequencing primer 66 84
promoter T7 T7 promoter 280 299
repressor binding site lacO lacO regulatory sequence 258 280
repressor protein gene LacI LacI 752 1768
selectable marker AmpR ampicillin resistance gene 3960 4619
ssDNA origin f1 ori f1 origin 5081 5387
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 termination sequence 68 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : deoR
GENEID : 1077252
Locus Tag : S0836
GI : 30062322
Target GenBank: None

 

Protein

SMART domain : DeoRC : DeoR C terminal sensor domain
SMART domain : HTH_DEOR : helix_turn_helix, Deoxyribose operon repressor
Structural Annotation Wiki : TOPSAN
UniProt : Q83S23_SHIFL
UniProt : E3XZW5
UniProt : Q83S23

Clone

Cloning Information : 539056
HIP Master Clone ID : 449376
Original Clone ID : SfR254-21.1

Experimental

TargetTrack - Experimental data : SfR254

Organism


TAX_ID : 198215
Species Specific ID: 1077252

Reagents

Labome : deoR-cDNA