DNASU Plasmid Repository • 480.965.5697 | Email

MAD2L1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAD2L1
Gene Name:  MAD2 mitotic arrest deficient-like 1 (yeast)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH021724.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000385

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 618nts        
Open reading frame : 1 to 618
Reference Sequence Alignment

ATGGCGCTGCAGCTCTCCCGGGAGCAGGGAATCACCCTGCGCGGGAGCGCCGAAATCGTG
GCCGAGTTCTTCTCATTCGGCATCAACAGCATTTTATATCAGCGTGGCATATATCCATCT
GAAACCTTTACTCGAGTGCAGAAATACGGACTCACCTTGCTTGTAACTACTGATCTTGAG
CTCATAAAATACCTAAATAATGTGGTGGAACAACTGAAAGATTGGTTATACAAGTGTTCA
GTTCAGAAACTGGTTGTAGTTATCTCAAATATTGAAAGTGGTGAGGTCCTGGAAAGATGG
CAGTTTGATATTGAGTGTGACAAGACTGCAAAAGATGACAGTGCACCCAGAGAAAAGTCT
CAGAAAGCTATCCAGGATGAAATCCGTTCAGTGATCAGACAGATCACAGCTACGGTGACA
TTTCTGCCACTGTTGGAAGTTTCTTGTTCATTTGATCTGCTGATTTATACAGACAAAGAT
TTGGTTGTACCTGAAAAATGGGAAGAGTCGGGACCACAGTTTATTACCAATTCTGAGGAA
GTCCGCCTTCGTTCATTTACTACTACAATCCACAAAGTAAATAGCATGGTGGCCTACAAA
ATTCCTGTCAATGACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 692
Start on reference sequence 75
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 9 42
recombination site loxP site loxP recombination site 1015 1048
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAD2L1
Symbol Nomenclature : MAD2L1
SYNONYM : HSMAD2; MAD2
Designation : MAD2 (mitotic arrest deficient, yeast, homolog)-like 1|MAD2-like protein 1|mitotic arrest deficient 2-like protein 1|mitotic arrest deficient, yeast, homolog-like 1|mitotic spindle assembly checkpoint protein MAD2A
Full Nomenclature : MAD2 mitotic arrest deficient-like 1 (yeast)
GENEID : 4085
GI : 61365561
GenBank Accession : AY890787
HGNC : 6763
MIM : 601467
Target GenBank: NM_002358

 

Reference Sequence Alignment

  

HsCD00000385      ATGGCGCTGCAGCTCTCCCGGGAGCAGGGAATCACCCTGCGCGGGAGCGCCGAAATCGTG
NM_002358.3       ATGGCGCTGCAGCTCTCCCGGGAGCAGGGAATCACCCTGCGCGGGAGCGCCGAAATCGTG
                  ************************************************************

HsCD00000385      GCCGAGTTCTTCTCATTCGGCATCAACAGCATTTTATATCAGCGTGGCATATATCCATCT
NM_002358.3       GCCGAGTTCTTCTCATTCGGCATCAACAGCATTTTATATCAGCGTGGCATATATCCATCT
                  ************************************************************

HsCD00000385      GAAACCTTTACTCGAGTGCAGAAATACGGACTCACCTTGCTTGTAACTACTGATCTTGAG
NM_002358.3       GAAACCTTTACTCGAGTGCAGAAATACGGACTCACCTTGCTTGTAACTACTGATCTTGAG
                  ************************************************************

HsCD00000385      CTCATAAAATACCTAAATAATGTGGTGGAACAACTGAAAGATTGGTTATACAAGTGTTCA
NM_002358.3       CTCATAAAATACCTAAATAATGTGGTGGAACAACTGAAAGATTGGTTATACAAGTGTTCA
                  ************************************************************

HsCD00000385      GTTCAGAAACTGGTTGTAGTTATCTCAAATATTGAAAGTGGTGAGGTCCTGGAAAGATGG
NM_002358.3       GTTCAGAAACTGGTTGTAGTTATCTCAAATATTGAAAGTGGTGAGGTCCTGGAAAGATGG
                  ************************************************************

HsCD00000385      CAGTTTGATATTGAGTGTGACAAGACTGCAAAAGATGACAGTGCACCCAGAGAAAAGTCT
NM_002358.3       CAGTTTGATATTGAGTGTGACAAGACTGCAAAAGATGACAGTGCACCCAGAGAAAAGTCT
                  ************************************************************

HsCD00000385      CAGAAAGCTATCCAGGATGAAATCCGTTCAGTGATCAGACAGATCACAGCTACGGTGACA
NM_002358.3       CAGAAAGCTATCCAGGATGAAATCCGTTCAGTGATCAGACAGATCACAGCTACGGTGACA
                  ************************************************************

HsCD00000385      TTTCTGCCACTGTTGGAAGTTTCTTGTTCATTTGATCTGCTGATTTATACAGACAAAGAT
NM_002358.3       TTTCTGCCACTGTTGGAAGTTTCTTGTTCATTTGATCTGCTGATTTATACAGACAAAGAT
                  ************************************************************

HsCD00000385      TTGGTTGTACCTGAAAAATGGGAAGAGTCGGGACCACAGTTTATTACCAATTCTGAGGAA
NM_002358.3       TTGGTTGTACCTGAAAAATGGGAAGAGTCGGGACCACAGTTTATTACCAATTCTGAGGAA
                  ************************************************************

HsCD00000385      GTCCGCCTTCGTTCATTTACTACTACAATCCACAAAGTAAATAGCATGGTGGCCTACAAA
NM_002358.3       GTCCGCCTTCGTTCATTTACTACTACAATCCACAAAGTAAATAGCATGGTGGCCTACAAA
                  ************************************************************

HsCD00000385      ATTCCTGTCAATGACTTG
NM_002358.3       ATTCCTGTCAATGACTGA
                  **************** .

Pathways

Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Amplification of signal from unattached kinetochores via a MAD2 inhibitory signal
Reactome : Amplification of signal from the kinetochores
Reactome : APC-Cdc20 mediated degradation of Nek2A
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Inactivation of APC/C via direct inhibition of the APC/C complex
Reactome : Inhibition of the proteolytic activity of APC/C required for the onset of anaphase by mitotic spindle checkpoint components
Reactome : M Phase
Reactome : Mitotic Anaphase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Metaphase and Anaphase
Reactome : Mitotic Prometaphase
Reactome : Mitotic Spindle Checkpoint
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of mitotic cell cycle
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : Separation of Sister Chromatids
WikiPathway : Cell cycle

Protein

UniProt : Q13257
HPRD : 03274

Clone

Cloning Information : 21724
HIP Master Clone ID : 40284
Original Clone ID : FLH021724.01L

Organism


TAX_ID : 9606
Species Specific ID: 4085

Genome

Chromosome : 4
Map Location : 4q27

Reagents

Labome : Mad2-antibody