DNASU Plasmid Repository • 480.965.5697 | Email

TBK1 (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TBK1
Gene Name:  TANK-binding kinase 1
Sequence             
Original Clone ID: FLH205403.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038512

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2190nts         Open reading frame : 1 to 2190
Reference Sequence Alignment

ATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACT
GCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTT
AATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAA
AAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGA
CATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAA
CCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTG
GGTGGAATGAATCATCTACGAGAGAATGGTATAGTGCACCGTGATATCAAGCCAGGAAAT
ATCATGCGTGTTATAGGGGAAGATGGACAGTCTGTGTACAAACTCACAGATTTTGGTGCA
GCTAGAGAATTAGAAGATGATGAGCAGTTTGTTTCTCTGTATGGCACAGAAGAATATTTG
CACCCTGATATGTATGAGAGAGCAGTGCTAAGAAAAGATCATCAGAAGAAATATGGAGCA
ACAGTTGATCTTTGGAGCATTGGGGTAACATTTTACCATGCAGCTACTGGATCACTGCCA
TTTAGACCCTTTGAAGGGCCTCGTAGGAATAAAGAAGTGATGTATAAAATAATTACAGGA
AAGCCTTCTGGTGCAATATCTGGAGTACAGAAAGCAGAAAATGGACCAATTGACTGGAGT
GGAGACATGCCTGTTTCTTGCAGTCTTTCTCGGGGTCTTCAGGTTCTACTTACCCCTGTT
CTTGCAAACATCCTTGAAGCAGATCAGGAAAAGTGTTGGGGTTTTGACCAGTTTTTTGCA
GAAACTAGTGATATACTTCACCGAATGGTAATTCATGTTTTTTCGCTACAACAAATGACA
GCTCATAAGATTTATATACATAGCTATAATACTGCTACTATATTTCATGAACTGGTATAT
AAACAAACCAAAATTATTTCTTCAAATCAAGAACTTATCTACGAAGGGCGACGCTTAGTC
TTAGAACCTGGAAGGCTGGCACAACATTTCCCTAAAACTACTGAGGAAAACCCTATATTT
GTAGTAAGCCGGGAACCTCTGGATACCATAGGATTAATATATGAAAAAATTTCCCTCCCT
AAAGTACATCCACGTTATGATTTAGACGGGGATGCTAGCATGGCTAAGGCAATAACAGGG
GTTGTGTGTTATGCCTGCAGAATTGCCAGTACCTTACTGCTTTATCAGGAATTAATGCGA
AAGGGGATACGATGGCTGATTGAATTAATTAAAGATGATTACAATGAAACTGTTCACAAA
AAGACAGAAGTTGTGATCACATTGGATTTCTGTATCAGAAACATTGAAAAAACTGTGAAA
GTATATGAAAAGTTGATGAAGATCAACCTGGAAGCGGCAGAGTTAGGTGAAATTTCAGAC
ATACACACCAAATTGTTGAGACTTTCCAGTTCTCAGGGAACAATAGAAACCAGTCTTCAG
GATATCGACAGCAGATTATCTCCAGGTGGATCACTGGCAGACGCATGGGCACATCAAGAA
GGCACTCATCCGAAAGACAGAAATGTAGAAAAACTACAAGTCCTGTTAAATTGCATGACA
GAGATTTACTATCAGTTCAAAAAAGACCAAGCAGAACGTAGATTAGCTTATAATGAAGAA
CAAATCCACAAATTTGATAAGCAAAAACTGTATTACCATGCCACAAAAGCTATGACGCAC
TTTACAGATGAATGTGTTAAAAAGTATGAGGCATTTTTGAATAAGTCAGAAGAATGGATA
AGAAAGATGCTTCATCTTAGGAAACAGTTATTATCGCTGACTAATCAGTGTTTTGATATT
GAAGAAGAAGTATCAAAATATCAAGAATATACTAATGAGTTACAAGAAACTCTGCCTCAG
AAAATGTTTACAGCTTCCAGTGGAATCAAACATACCATGACCCCAATTTATCCAAGTTCT
AACACATTAGTAGAAATGACTCTTGGTATGAAGAAATTAAAGGAAGAGATGGAAGGGGTG
GTTAAAGAACTTGCTGAAAATAACCACATTTTAGAAAGGTTTGGCTCTTTAACCATGGAT
GGTGGCCTTCGCAACGTTGACTGTCTTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 2294
Start on reference sequence 105
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TBK1
Symbol Nomenclature : TBK1
SYNONYM : NAK; T2K
Designation : NF-kB-activating kinase|NF-kappa-B-activating kinase|serine/threonine-protein kinase TBK1
Full Nomenclature : TANK-binding kinase 1
GENEID : 29110
HGNC : 11584
MIM : 604834
Vega : OTTHUMG00000168796
Target GenBank: BC034950

 

Reference Sequence Alignment

  

HsCD00038512        ATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACT
XM_005268810.1      ATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACT
XM_005268809.1      ATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACT
NM_013254.3         ATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACT
                    ************************************************************

HsCD00038512        GCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTT
XM_005268810.1      GCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTT
XM_005268809.1      GCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTT
NM_013254.3         GCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTT
                    ************************************************************

HsCD00038512        AATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAA
XM_005268810.1      AATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAA
XM_005268809.1      AATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAA
NM_013254.3         AATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAA
                    ************************************************************

HsCD00038512        AAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGA
XM_005268810.1      AAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGA
XM_005268809.1      AAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGA
NM_013254.3         AAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGA
                    ************************************************************

HsCD00038512        CATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAA
XM_005268810.1      CATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAA
XM_005268809.1      CATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAA
NM_013254.3         CATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAA
                    ************************************************************

HsCD00038512        CCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTG
XM_005268810.1      CCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTG
XM_005268809.1      CCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTG
NM_013254.3         CCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTG
                    ************************************************************

HsCD00038512        GGTGGAATGAATCATCTACGAGAGAATGGTATAGTGCACCGTGATATCAAGCCAGGAAAT
XM_005268810.1      GGTGGAATGAATCATCTACGAGAGAATGGTATAGTGCACCGTGATATCAAGCCAGGAAAT
XM_005268809.1      GGTGGAATGAATCATCTACGAGAGAATGGTATAGTGCACCGTGATATCAAGCCAGGAAAT
NM_013254.3         GGTGGAATGAATCATCTACGAGAGAATGGTATAGTGCACCGTGATATCAAGCCAGGAAAT
                    ************************************************************

HsCD00038512        ATCATGCGTGTTATAGGGGAAGATGGACAGTCTGTGTACAAACTCACAGATTTTGGTGCA
XM_005268810.1      ATCATGCGTGTTATAGGGGAAGATGGACAGTCTGTGTACAAACTCACAGATTTTGGTGCA
XM_005268809.1      ATCATGCGTGTTATAGGGGAAGATGGACAGTCTGTGTACAAACTCACAGATTTTGGTGCA
NM_013254.3         ATCATGCGTGTTATAGGGGAAGATGGACAGTCTGTGTACAAACTCACAGATTTTGGTGCA
                    ************************************************************

HsCD00038512        GCTAGAGAATTAGAAGATGATGAGCAGTTTGTTTCTCTGTATGGCACAGAAGAATATTTG
XM_005268810.1      GCTAGAGAATTAGAAGATGATGAGCAGTTTGTTTCTCTGTATGGCACAGAAGAATATTTG
XM_005268809.1      GCTAGAGAATTAGAAGATGATGAGCAGTTTGTTTCTCTGTATGGCACAGAAGAATATTTG
NM_013254.3         GCTAGAGAATTAGAAGATGATGAGCAGTTTGTTTCTCTGTATGGCACAGAAGAATATTTG
                    ************************************************************

HsCD00038512        CACCCTGATATGTATGAGAGAGCAGTGCTAAGAAAAGATCATCAGAAGAAATATGGAGCA
XM_005268810.1      CACCCTGATATGTATGAGAGAGCAGTGCTAAGAAAAGATCATCAGAAGAAATATGGAGCA
XM_005268809.1      CACCCTGATATGTATGAGAGAGCAGTGCTAAGAAAAGATCATCAGAAGAAATATGGAGCA
NM_013254.3         CACCCTGATATGTATGAGAGAGCAGTGCTAAGAAAAGATCATCAGAAGAAATATGGAGCA
                    ************************************************************

HsCD00038512        ACAGTTGATCTTTGGAGCATTGGGGTAACATTTTACCATGCAGCTACTGGATCACTGCCA
XM_005268810.1      ACAGTTGATCTTTGGAGCATTGGGGTAACATTTTACCATGCAGCTACTGGATCACTGCCA
XM_005268809.1      ACAGTTGATCTTTGGAGCATTGGGGTAACATTTTACCATGCAGCTACTGGATCACTGCCA
NM_013254.3         ACAGTTGATCTTTGGAGCATTGGGGTAACATTTTACCATGCAGCTACTGGATCACTGCCA
                    ************************************************************

HsCD00038512        TTTAGACCCTTTGAAGGGCCTCGTAGGAATAAAGAAGTGATGTATAAAATAATTACAGGA
XM_005268810.1      TTTAGACCCTTTGAAGGGCCTCGTAGGAATAAAGAAGTGATGTATAAAATAATTACAGGA
XM_005268809.1      TTTAGACCCTTTGAAGGGCCTCGTAGGAATAAAGAAGTGATGTATAAAATAATTACAGGA
NM_013254.3         TTTAGACCCTTTGAAGGGCCTCGTAGGAATAAAGAAGTGATGTATAAAATAATTACAGGA
                    ************************************************************

HsCD00038512        AAGCCTTCTGGTGCAATATCTGGAGTACAGAAAGCAGAAAATGGACCAATTGACTGGAGT
XM_005268810.1      AAGCCTTCTGGTGCAATATCTGGAGTACAGAAAGCAGAAAATGGACCAATTGACTGGAGT
XM_005268809.1      AAGCCTTCTGGTGCAATATCTGGAGTACAGAAAGCAGAAAATGGACCAATTGACTGGAGT
NM_013254.3         AAGCCTTCTGGTGCAATATCTGGAGTACAGAAAGCAGAAAATGGACCAATTGACTGGAGT
                    ************************************************************

HsCD00038512        GGAGACATGCCTGTTTCTTGCAGTCTTTCTCGGGGTCTTCAGGTTCTACTTACCCCTGTT
XM_005268810.1      GGAGACATGCCTGTTTCTTGCAGTCTTTCTCGGGGTCTTCAGGTTCTACTTACCCCTGTT
XM_005268809.1      GGAGACATGCCTGTTTCTTGCAGTCTTTCTCGGGGTCTTCAGGTTCTACTTACCCCTGTT
NM_013254.3         GGAGACATGCCTGTTTCTTGCAGTCTTTCTCGGGGTCTTCAGGTTCTACTTACCCCTGTT
                    ************************************************************

HsCD00038512        CTTGCAAACATCCTTGAAGCAGATCAGGAAAAGTGTTGGGGTTTTGACCAGTTTTTTGCA
XM_005268810.1      CTTGCAAACATCCTTGAAGCAGATCAGGAAAAGTGTTGGGGTTTTGACCAGTTTTTTGCA
XM_005268809.1      CTTGCAAACATCCTTGAAGCAGATCAGGAAAAGTGTTGGGGTTTTGACCAGTTTTTTGCA
NM_013254.3         CTTGCAAACATCCTTGAAGCAGATCAGGAAAAGTGTTGGGGTTTTGACCAGTTTTTTGCA
                    ************************************************************

HsCD00038512        GAAACTAGTGATATACTTCACCGAATGGTAATTCATGTTTTTTCGCTACAACAAATGACA
XM_005268810.1      GAAACTAGTGATATACTTCACCGAATGGTAATTCATGTTTTTTCGCTACAACAAATGACA
XM_005268809.1      GAAACTAGTGATATACTTCACCGAATGGTAATTCATGTTTTTTCGCTACAACAAATGACA
NM_013254.3         GAAACTAGTGATATACTTCACCGAATGGTAATTCATGTTTTTTCGCTACAACAAATGACA
                    ************************************************************

HsCD00038512        GCTCATAAGATTTATATACATAGCTATAATACTGCTACTATATTTCATGAACTGGTATAT
XM_005268810.1      GCTCATAAGATTTATATTCATAGCTATAATACTGCTACTATATTTCATGAACTGGTATAT
XM_005268809.1      GCTCATAAGATTTATATTCATAGCTATAATACTGCTACTATATTTCATGAACTGGTATAT
NM_013254.3         GCTCATAAGATTTATATTCATAGCTATAATACTGCTACTATATTTCATGAACTGGTATAT
                    *****************:******************************************

HsCD00038512        AAACAAACCAAAATTATTTCTTCAAATCAAGAACTTATCTACGAAGGGCGACGCTTAGTC
XM_005268810.1      AAACAAACCAAAATTATTTCTTCAAATCAAGAACTTATCTACGAAGGGCGACGCTTAGTC
XM_005268809.1      AAACAAACCAAAATTATTTCTTCAAATCAAGAACTTATCTACGAAGGGCGACGCTTAGTC
NM_013254.3         AAACAAACCAAAATTATTTCTTCAAATCAAGAACTTATCTACGAAGGGCGACGCTTAGTC
                    ************************************************************

HsCD00038512        TTAGAACCTGGAAGGCTGGCACAACATTTCCCTAAAACTACTGAGGAAAACCCTATATTT
XM_005268810.1      TTAGAACCTGGAAGGCTGGCACAACATTTCCCTAAAACTACTGAGGAAAACCCTATATTT
XM_005268809.1      TTAGAACCTGGAAGGCTGGCACAACATTTCCCTAAAACTACTGAGGAAAACCCTATATTT
NM_013254.3         TTAGAACCTGGAAGGCTGGCACAACATTTCCCTAAAACTACTGAGGAAAACCCTATATTT
                    ************************************************************

HsCD00038512        GTAGTAAGCCGGGAACCTCTGGATACCATAGGATTAATATATGAAAAAATTTCCCTCCCT
XM_005268810.1      GTAGTAAGCCGGGAACCTCTGAATACCATAGGATTAATATATGAAAAAATTTCCCTCCCT
XM_005268809.1      GTAGTAAGCCGGGAACCTCTGAATACCATAGGATTAATATATGAAAAAATTTCCCTCCCT
NM_013254.3         GTAGTAAGCCGGGAACCTCTGAATACCATAGGATTAATATATGAAAAAATTTCCCTCCCT
                    *********************.**************************************

HsCD00038512        AAAGTACATCCACGTTATGATTTAGACGGGGATGCTAGCATGGCTAAGGCAATAACAGGG
XM_005268810.1      AAAGTACATCCACGTTATGATTTAGACGGGGATGCTAGCATGGCTAAGGCAATAACAGGG
XM_005268809.1      AAAGTACATCCACGTTATGATTTAGACGGGGATGCTAGCATGGCTAAGGCAATAACAGGG
NM_013254.3         AAAGTACATCCACGTTATGATTTAGACGGGGATGCTAGCATGGCTAAGGCAATAACAGGG
                    ************************************************************

HsCD00038512        GTTGTGTGTTATGCCTGCAGAATTGCCAGTACCTTACTGCTTTATCAGGAATTAATGCGA
XM_005268810.1      GTTGTGTGTTATGCCTGCAGAATTGCCAGTACCTTACTGCTTTATCAGGAATTAATGCGA
XM_005268809.1      GTTGTGTGTTATGCCTGCAGAATTGCCAGTACCTTACTGCTTTATCAGGAATTAATGCGA
NM_013254.3         GTTGTGTGTTATGCCTGCAGAATTGCCAGTACCTTACTGCTTTATCAGGAATTAATGCGA
                    ************************************************************

HsCD00038512        AAGGGGATACGATGGCTGATTGAATTAATTAAAGATGATTACAATGAAACTGTTCACAAA
XM_005268810.1      AAGGGGATACGATGGCTGATTGAATTAATTAAAGATGATTACAATGAAACTGTTCACAAA
XM_005268809.1      AAGGGGATACGATGGCTGATTGAATTAATTAAAGATGATTACAATGAAACTGTTCACAAA
NM_013254.3         AAGGGGATACGATGGCTGATTGAATTAATTAAAGATGATTACAATGAAACTGTTCACAAA
                    ************************************************************

HsCD00038512        AAGACAGAAGTTGTGATCACATTGGATTTCTGTATCAGAAACATTGAAAAAACTGTGAAA
XM_005268810.1      AAGACAGAAGTTGTGATCACATTGGATTTCTGTATCAGAAACATTGAAAAAACTGTGAAA
XM_005268809.1      AAGACAGAAGTTGTGATCACATTGGATTTCTGTATCAGAAACATTGAAAAAACTGTGAAA
NM_013254.3         AAGACAGAAGTTGTGATCACATTGGATTTCTGTATCAGAAACATTGAAAAAACTGTGAAA
                    ************************************************************

HsCD00038512        GTATATGAAAAGTTGATGAAGATCAACCTGGAAGCGGCAGAGTTAGGTGAAATTTCAGAC
XM_005268810.1      GTATATGAAAAGTTGATGAAGATCAACCTGGAAGCGGCAGAGTTAGGTGAAATTTCAGAC
XM_005268809.1      GTATATGAAAAGTTGATGAAGATCAACCTGGAAGCGGCAGAGTTAGGTGAAATTTCAGAC
NM_013254.3         GTATATGAAAAGTTGATGAAGATCAACCTGGAAGCGGCAGAGTTAGGTGAAATTTCAGAC
                    ************************************************************

HsCD00038512        ATACACACCAAATTGTTGAGACTTTCCAGTTCTCAGGGAACAATAGAAACCAGTCTTCAG
XM_005268810.1      ATACACACCAAATTGTTGAGACTTTCCAGTTCTCAGGGAACAATAGAAACCAGTCTTCAG
XM_005268809.1      ATACACACCAAATTGTTGAGACTTTCCAGTTCTCAGGGAACAATAGAAACCAGTCTTCAG
NM_013254.3         ATACACACCAAATTGTTGAGACTTTCCAGTTCTCAGGGAACAATAGAAACCAGTCTTCAG
                    ************************************************************

HsCD00038512        GATATCGACAGCAGATTATCTCCAGGTGGATCACTGGCAGACGCATGGGCACATCAAGAA
XM_005268810.1      GATATCGACAGCAGATTATCTCCAGGTGGATCACTGGCAGACGCATGGGCACATCAAGAA
XM_005268809.1      GATATCGACAGCAGATTATCTCCAGGTGGATCACTGGCAGACGCATGGGCACATCAAGAA
NM_013254.3         GATATCGACAGCAGATTATCTCCAGGTGGATCACTGGCAGACGCATGGGCACATCAAGAA
                    ************************************************************

HsCD00038512        GGCACTCATCCGAAAGACAGAAATGTAGAAAAACTACAAGTCCTGTTAAATTGCATGACA
XM_005268810.1      GGCACTCATCCGAAAGACAGAAATGTAGAAAAACTACAAGTCCTGTTAAATTGCATGACA
XM_005268809.1      GGCACTCATCCGAAAGACAGAAATGTAGAAAAACTACAAGTCCTGTTAAATTGCATGACA
NM_013254.3         GGCACTCATCCGAAAGACAGAAATGTAGAAAAACTACAAGTCCTGTTAAATTGCATGACA
                    ************************************************************

HsCD00038512        GAGATTTACTATCAGTTCAAAAAAGACCAAGCAGAACGTAGATTAGCTTATAATGAAGAA
XM_005268810.1      GAGATTTACTATCAGTTCAAAAAAGACAAAGCAGAACGTAGATTAGCTTATAATGAAGAA
XM_005268809.1      GAGATTTACTATCAGTTCAAAAAAGACAAAGCAGAACGTAGATTAGCTTATAATGAAGAA
NM_013254.3         GAGATTTACTATCAGTTCAAAAAAGACAAAGCAGAACGTAGATTAGCTTATAATGAAGAA
                    ***************************.********************************

HsCD00038512        CAAATCCACAAATTTGATAAGCAAAAACTGTATTACCATGCCACAAAAGCTATGACGCAC
XM_005268810.1      CAAATCCACAAATTTGATAAGCAAAAACTGTATTACCATGCCACAAAAGCTATGACGCAC
XM_005268809.1      CAAATCCACAAATTTGATAAGCAAAAACTGTATTACCATGCCACAAAAGCTATGACGCAC
NM_013254.3         CAAATCCACAAATTTGATAAGCAAAAACTGTATTACCATGCCACAAAAGCTATGACGCAC
                    ************************************************************

HsCD00038512        TTTACAGATGAATGTGTTAAAAAGTATGAGGCATTTTTGAATAAGTCAGAAGAATGGATA
XM_005268810.1      TTTACAGATGAATGTGTTAAAAAGTATGAGGCATTTTTGAATAAGTCAGAAGAATGGATA
XM_005268809.1      TTTACAGATGAATGTGTTAAAAAGTATGAGGCATTTTTGAATAAGTCAGAAGAATGGATA
NM_013254.3         TTTACAGATGAATGTGTTAAAAAGTATGAGGCATTTTTGAATAAGTCAGAAGAATGGATA
                    ************************************************************

HsCD00038512        AGAAAGATGCTTCATCTTAGGAAACAGTTATTATCGCTGACTAATCAGTGTTTTGATATT
XM_005268810.1      AGAAAGATGCTTCATCTTAGGAAACAGTTATTATCGCTGACTAATCAGTGTTTTGATATT
XM_005268809.1      AGAAAGATGCTTCATCTTAGGAAACAGTTATTATCGCTGACTAATCAGTGTTTTGATATT
NM_013254.3         AGAAAGATGCTTCATCTTAGGAAACAGTTATTATCGCTGACTAATCAGTGTTTTGATATT
                    ************************************************************

HsCD00038512        GAAGAAGAAGTATCAAAATATCAAGAATATACTAATGAGTTACAAGAAACTCTGCCTCAG
XM_005268810.1      GAAGAAGAAGTATCAAAATATCAAGAATATACTAATGAGTTACAAGAAACTCTGCCTCAG
XM_005268809.1      GAAGAAGAAGTATCAAAATATCAAGAATATACTAATGAGTTACAAGAAACTCTGCCTCAG
NM_013254.3         GAAGAAGAAGTATCAAAATATCAAGAATATACTAATGAGTTACAAGAAACTCTGCCTCAG
                    ************************************************************

HsCD00038512        AAAATGTTTACAGCTTCCAGTGGAATCAAACATACCATGACCCCAATTTATCCAAGTTCT
XM_005268810.1      AAAATGTTTACAGCTTCCAGTGGAATCAAACATACCATGACCCCAATTTATCCAAGTTCT
XM_005268809.1      AAAATGTTTACAGCTTCCAGTGGAATCAAACATACCATGACCCCAATTTATCCAAGTTCT
NM_013254.3         AAAATGTTTACAGCTTCCAGTGGAATCAAACATACCATGACCCCAATTTATCCAAGTTCT
                    ************************************************************

HsCD00038512        AACACATTAGTAGAAATGACTCTTGGTATGAAGAAATTAAAGGAAGAGATGGAAGGGGTG
XM_005268810.1      AACACATTAGTAGAAATGACTCTTGGTATGAAGAAATTAAAGGAAGAGATGGAAGGGGTG
XM_005268809.1      AACACATTAGTAGAAATGACTCTTGGTATGAAGAAATTAAAGGAAGAGATGGAAGGGGTG
NM_013254.3         AACACATTAGTAGAAATGACTCTTGGTATGAAGAAATTAAAGGAAGAGATGGAAGGGGTG
                    ************************************************************

HsCD00038512        GTTAAAGAACTTGCTGAAAATAACCACATTTTAGAAAGGTTTGGCTCTTTAACCATGGAT
XM_005268810.1      GTTAAAGAACTTGCTGAAAATAACCACATTTTAGAAAGGTTTGGCTCTTTAACCATGGAT
XM_005268809.1      GTTAAAGAACTTGCTGAAAATAACCACATTTTAGAAAGGTTTGGCTCTTTAACCATGGAT
NM_013254.3         GTTAAAGAACTTGCTGAAAATAACCACATTTTAGAAAGGTTTGGCTCTTTAACCATGGAT
                    ************************************************************

HsCD00038512        GGTGGCCTTCGCAACGTTGACTGTCTTTTG
XM_005268810.1      GGTGGCCTTCGCAACGTTGACTGTCTTTAG
XM_005268809.1      GGTGGCCTTCGCAACGTTGACTGTCTTTAG
NM_013254.3         GGTGGCCTTCGCAACGTTGACTGTCTTTAG
                    ****************************:*

Pathways

Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of IRF3/IRF7 mediated by TBK1/IKK epsilon
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : IRF3 mediated activation of type 1 IFN
Reactome : IRF3-mediated induction of type I IFN
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MyD88-independent cascade
Reactome : Negative regulators of RIG-I/MDA5 signaling
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation of innate immune responses to cytosolic DNA
Reactome : STAT6-mediated induction of chemokines
Reactome : STING mediated induction of host immune responses
Reactome : TRAF3-dependent IRF activation pathway
Reactome : TRAF6 mediated IRF7 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 205403
HIP Master Clone ID : 134856
Original Clone ID : FLH205403.01L

Organism


TAX_ID : 9606
Species Specific ID: 29110

Genome

Chromosome : 12
Map Location : 12q14.1
Ensembl : ENSG00000183735

Reagents

Labome : TBK1-antibody