DNASU Plasmid Repository • 480.965.5697 | Email

GSK3A (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GSK3A
Gene Name:  glycogen synthase kinase 3 alpha
Sequence             
Original Clone ID: FLH205410.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038517

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1452nts         Open reading frame : 1 to 1452
Reference Sequence Alignment

ATGAGCGGCGGCGGGCCTTCGGGAGGCGGCCCTGGGGGCTCGGGCAGGGCGCGGACTAGC
TCGTTCGCGGAGCCCGGCGGCGGAGGCGGAGGAGGCGGCGGCGGCCCCGGAGGCTCGGCC
TCCGGCCCAGGCGGCACCGGCGGCGGAAAGGCATCTGTCGGGGCCATGGGTGGGGGCGTC
GGGGCCTCGAGCTCCGGGGGTGGACCCGGCGGCAGCGGCGGAGGAGGCAGCGGAGGCCCC
GGCGCAGGCACTAGCTTCCCGCCGCCCGGGGTGAAGCTGGGCCGTGACAGCGGGAAGGTG
ACCACAGTCGTAGCCACTCTAGGCCAAGGCCCAGAGCGCTCCCAAGAAGTGGCTTACACG
GACATCAAAGTGATTGGCAATGGCTCATTTGGGGTCGTGTACCAGGCACGGCTGGCAGAG
ACCAGGGAACTAGTCGCCATCAAGAAGGTTCTCCAGGACAAGAGGTTCAAGAACCGAGAG
CTGCAGATCATGCGTAAGCTGGACCACTGCAATATTGTGAGGCTGAGATACTTTTTCTAC
TCCAGTGGCGAGAAGAAAGACGAGCTTTACCTAAATCTGGTGCTGGAATATGTGCCCGAG
ACAGTGTACCGGGTGGCCCGCCACTTCACCAAGGCCAAGTTGACCATCCCTATCCTCTAT
GTCAAGGTGTACATGTACCAGCTCTTCCGCAGCTTGGCCTACATCCACTCCCAGGGCGTG
TGTCACCGCGACATCAAGCCCCAGAACCTGCTGGTGGACCCTGACACTGCTGTCCTCAAG
CTCTGCGATTTTGGCAGTGCAAAGCAGTTGGTCCGAGGGGAGCCCAATGTCTCCTACATC
TGTTCTCGCTACTACCGGGCCCCAGAGCTCATCTTTGGAGCCACTGATTACACCTCATCC
ATCGATGTTTGGTCAGCTGGCTGTGTACTGGCAGAGCTCCTCTTGGGCCAGCCCATCTTC
CCTGGGGACAGTGGGGTGGACCAGCTGGTGGAGATCATCAAGGTGCTGGGAACACCAACC
CGGGAACAAATCCGAGAGATGAACCCCAACTACACGGAGTTCAAGTTCCCTCAGATTAAA
GCTCACCCCTGGACAAAGGTGTTCAAATCTCGAACGCCGCCAGAGGCCATCGCGCTCTGC
TCTAGCCTGCTGGAGTACACCCCATCCTCAAGGCTCTCCCCACTAGAGGCCTGTGCGCAC
AGCTTCTTTGATGAACTGCGATGTCTGGGAACCCAGCTGCCTAACAACCGCCCACTTCCC
CCTCTCTTCAACTTCAGTGCTGGTGAACTCTCCATCCAACCGTCTCTCAACGCCATTCTC
ATCCCTCCTCACTTGAGGTCCCCAGCGGGCACTACCACCCTCACCCCGTCCTCACAAGCT
TTAACTGAGACTCCGACCAGCTCAGACTGGCAGTCGACCGATGCCACACCTACCCTCACT
AACTCCTCCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1590
Start on reference sequence 139
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GSK3A
Symbol Nomenclature : GSK3A
Designation : GSK-3 alpha|glycogen synthase kinase-3 alpha|serine/threonine-protein kinase GSK3A
Full Nomenclature : glycogen synthase kinase 3 alpha
GENEID : 2931
HGNC : 4616
MIM : 606784
Vega : OTTHUMG00000150722
Target GenBank: BC027984

 

Reference Sequence Alignment

  

HsCD00038517      ATGAGCGGCGGCGGGCCTTCGGGAGGCGGCCCTGGGGGCTCGGGCAGGGCGCGGACTAGC
NM_019884.2       ATGAGCGGCGGCGGGCCTTCGGGAGGCGGCCCTGGGGGCTCGGGCAGGGCGCGGACTAGC
                  ************************************************************

HsCD00038517      TCGTTCGCGGAGCCCGGCGGCGGAGGCGGAGGAGGCGGCGGCGGCCCCGGAGGCTCGGCC
NM_019884.2       TCGTTCGCGGAGCCCGGCGGCGGAGGCGGAGGAGGCGGCGGCGGCCCCGGAGGCTCGGCC
                  ************************************************************

HsCD00038517      TCCGGCCCAGGCGGCACCGGCGGCGGAAAGGCATCTGTCGGGGCCATGGGTGGGGGCGTC
NM_019884.2       TCCGGCCCAGGCGGCACCGGCGGCGGAAAGGCATCTGTCGGGGCCATGGGTGGGGGCGTC
                  ************************************************************

HsCD00038517      GGGGCCTCGAGCTCCGGGGGTGGACCCGGCGGCAGCGGCGGAGGAGGCAGCGGAGGCCCC
NM_019884.2       GGGGCCTCGAGCTCCGGGGGTGGACCCGGCGGCAGCGGCGGAGGAGGCAGCGGAGGCCCC
                  ************************************************************

HsCD00038517      GGCGCAGGCACTAGCTTCCCGCCGCCCGGGGTGAAGCTGGGCCGTGACAGCGGGAAGGTG
NM_019884.2       GGCGCAGGCACTAGCTTCCCGCCGCCCGGGGTGAAGCTGGGCCGTGACAGCGGGAAGGTG
                  ************************************************************

HsCD00038517      ACCACAGTCGTAGCCACTCTAGGCCAAGGCCCAGAGCGCTCCCAAGAAGTGGCTTACACG
NM_019884.2       ACCACAGTCGTAGCCACTCTAGGCCAAGGCCCAGAGCGCTCCCAAGAAGTGGCTTACACG
                  ************************************************************

HsCD00038517      GACATCAAAGTGATTGGCAATGGCTCATTTGGGGTCGTGTACCAGGCACGGCTGGCAGAG
NM_019884.2       GACATCAAAGTGATTGGCAATGGCTCATTTGGGGTCGTGTACCAGGCACGGCTGGCAGAG
                  ************************************************************

HsCD00038517      ACCAGGGAACTAGTCGCCATCAAGAAGGTTCTCCAGGACAAGAGGTTCAAGAACCGAGAG
NM_019884.2       ACCAGGGAACTAGTCGCCATCAAGAAGGTTCTCCAGGACAAGAGGTTCAAGAACCGAGAG
                  ************************************************************

HsCD00038517      CTGCAGATCATGCGTAAGCTGGACCACTGCAATATTGTGAGGCTGAGATACTTTTTCTAC
NM_019884.2       CTGCAGATCATGCGTAAGCTGGACCACTGCAATATTGTGAGGCTGAGATACTTTTTCTAC
                  ************************************************************

HsCD00038517      TCCAGTGGCGAGAAGAAAGACGAGCTTTACCTAAATCTGGTGCTGGAATATGTGCCCGAG
NM_019884.2       TCCAGTGGCGAGAAGAAAGACGAGCTTTACCTAAATCTGGTGCTGGAATATGTGCCCGAG
                  ************************************************************

HsCD00038517      ACAGTGTACCGGGTGGCCCGCCACTTCACCAAGGCCAAGTTGACCATCCCTATCCTCTAT
NM_019884.2       ACAGTGTACCGGGTGGCCCGCCACTTCACCAAGGCCAAGTTGACCATCCCTATCCTCTAT
                  ************************************************************

HsCD00038517      GTCAAGGTGTACATGTACCAGCTCTTCCGCAGCTTGGCCTACATCCACTCCCAGGGCGTG
NM_019884.2       GTCAAGGTGTACATGTACCAGCTCTTCCGCAGCTTGGCCTACATCCACTCCCAGGGCGTG
                  ************************************************************

HsCD00038517      TGTCACCGCGACATCAAGCCCCAGAACCTGCTGGTGGACCCTGACACTGCTGTCCTCAAG
NM_019884.2       TGTCACCGCGACATCAAGCCCCAGAACCTGCTGGTGGACCCTGACACTGCTGTCCTCAAG
                  ************************************************************

HsCD00038517      CTCTGCGATTTTGGCAGTGCAAAGCAGTTGGTCCGAGGGGAGCCCAATGTCTCCTACATC
NM_019884.2       CTCTGCGATTTTGGCAGTGCAAAGCAGTTGGTCCGAGGGGAGCCCAATGTCTCCTACATC
                  ************************************************************

HsCD00038517      TGTTCTCGCTACTACCGGGCCCCAGAGCTCATCTTTGGAGCCACTGATTACACCTCATCC
NM_019884.2       TGTTCTCGCTACTACCGGGCCCCAGAGCTCATCTTTGGAGCCACTGATTACACCTCATCC
                  ************************************************************

HsCD00038517      ATCGATGTTTGGTCAGCTGGCTGTGTACTGGCAGAGCTCCTCTTGGGCCAGCCCATCTTC
NM_019884.2       ATCGATGTTTGGTCAGCTGGCTGTGTACTGGCAGAGCTCCTCTTGGGCCAGCCCATCTTC
                  ************************************************************

HsCD00038517      CCTGGGGACAGTGGGGTGGACCAGCTGGTGGAGATCATCAAGGTGCTGGGAACACCAACC
NM_019884.2       CCTGGGGACAGTGGGGTGGACCAGCTGGTGGAGATCATCAAGGTGCTGGGAACACCAACC
                  ************************************************************

HsCD00038517      CGGGAACAAATCCGAGAGATGAACCCCAACTACACGGAGTTCAAGTTCCCTCAGATTAAA
NM_019884.2       CGGGAACAAATCCGAGAGATGAACCCCAACTACACGGAGTTCAAGTTCCCTCAGATTAAA
                  ************************************************************

HsCD00038517      GCTCACCCCTGGACAAAGGTGTTCAAATCTCGAACGCCGCCAGAGGCCATCGCGCTCTGC
NM_019884.2       GCTCACCCCTGGACAAAGGTGTTCAAATCTCGAACGCCGCCAGAGGCCATCGCGCTCTGC
                  ************************************************************

HsCD00038517      TCTAGCCTGCTGGAGTACACCCCATCCTCAAGGCTCTCCCCACTAGAGGCCTGTGCGCAC
NM_019884.2       TCTAGCCTGCTGGAGTACACCCCATCCTCAAGGCTCTCCCCACTAGAGGCCTGTGCGCAC
                  ************************************************************

HsCD00038517      AGCTTCTTTGATGAACTGCGATGTCTGGGAACCCAGCTGCCTAACAACCGCCCACTTCCC
NM_019884.2       AGCTTCTTTGATGAACTGCGATGTCTGGGAACCCAGCTGCCTAACAACCGCCCACTTCCC
                  ************************************************************

HsCD00038517      CCTCTCTTCAACTTCAGTGCTGGTGAACTCTCCATCCAACCGTCTCTCAACGCCATTCTC
NM_019884.2       CCTCTCTTCAACTTCAGTGCTGGTGAACTCTCCATCCAACCGTCTCTCAACGCCATTCTC
                  ************************************************************

HsCD00038517      ATCCCTCCTCACTTGAGGTCCCCAGCGGGCACTACCACCCTCACCCCGTCCTCACAAGCT
NM_019884.2       ATCCCTCCTCACTTGAGGTCCCCAGCGGGCACTACCACCCTCACCCCGTCCTCACAAGCT
                  ************************************************************

HsCD00038517      TTAACTGAGACTCCGACCAGCTCAGACTGGCAGTCGACCGATGCCACACCTACCCTCACT
NM_019884.2       TTAACTGAGACTCCGACCAGCTCAGACTGGCAGTCGACCGATGCCACACCTACCCTCACT
                  ************************************************************

HsCD00038517      AACTCCTCCTTG
NM_019884.2       AACTCCTCCTGA
                  ********** .

Pathways

NCI : Canonical Wnt signaling pathway
NCI : Class I PI3K signaling events mediated by Akt
NCI : Degradation of beta catenin
NCI : FOXM1 transcription factor network
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : PDGF signaling pathway
Panther : Ras Pathway
Reactome : AKT phosphorylates targets in the cytosol
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : IRE1alpha activates chaperones
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Metabolism of proteins
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Unfolded Protein Response (UPR)
Reactome : XBP1(S) activates chaperone genes
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : Glycogen Metabolism
WikiPathway : IL-5 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Integrated Breast Cancer Pathway

Clone

Cloning Information : 205410
HIP Master Clone ID : 134852
Original Clone ID : FLH205410.01L

Organism


TAX_ID : 9606
Species Specific ID: 2931

Genome

Chromosome : 19
Map Location : 19q13.2
Ensembl : ENSG00000105723

Reagents

Labome : GSK3-antibody