DNASU Plasmid Repository • 480.965.5697 | Email

CDC45L (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDC45
Gene Name:  cell division cycle 45
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH025487.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00003856

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1701nts         Open reading frame : 1 to 1701
Reference Sequence Alignment

ATGTTCGTGTCCGATTTCCGCAAAGAGTTCTACGAGGTGGTCCAGAGCCAGAGGGTCCTT
CTCTTCGTGGCCTCGGACGTGGATGCTCTGTGTGCGTGCAAGATCCTTCAGGCCTTGTTC
CAGTGTGACCACGTGCAATATACGCTGGTTCCAGTTTCTGGGTGGCAAGAACTTGAAACT
GCATTTCTTGAGCATAAAGAACAGTTTCATTATTTTATTCTCATAAACTGTGGAGCTAAT
GTAGACCTATTGGATATTCTTCAACCTGATGAAGACACTATATTCTTTGTGTGTGACACC
CATAGGCCAGTCAATGTCGTCAATGTATACAACGATACCCAGATCAAATTACTCATTAAA
CAAGATGATGACCTTGAAGTTCCCGCCTATGAAGACATCTTCAGGGATGAAGAGGAGGAT
GAAGAGCATTCAGGAAATGACAGTGATGGGTCAGAGCCTTCTGAGAAGCGCACACGGTTA
GAAGAGGAGATAGTGGAGCAAACCATGCGGAGGAGGCAGCGGCGAGAGTGGGAGGCCCGG
AGAAGAGACATCCTCTTTGACTACGAGCAGTATGAATATCATGGGACATCGTCAGCCATG
GTGATGTTTGAGCTGGCTTGGATGCTGTCCAAGGACCTGAATGACATGCTGTGGTGGGCC
ATCGTTGGACTAACAGACCAGTGGGTGCAAGACAAGATCACTCAAATGAAATACGTGACT
GATGTTGGTGTCCTGCAGCGCCACGTTTCCCGCCACAACCACCGGAACGAGGATGAGGAG
AACACACTCTCCGTGGACTGCACACGGATCTCCTTTGAGTATGACCTCCGCCTGGTGCTC
TACCAGCACTGGTCCCTCCATGACAGCCTGTGCAACACCAGCTATACCGCAGCCAGGTTC
AAGCTGTGGTCTGTGCATGGACAGAAGCGGCTCCAGGAGTTCCTTGCAGACATGGGTCTT
CCCCTGAAGCAGGTGAAGCAGAAGTTCCAGGCCATGGACATCTCCTTGAAGGAGAATTTG
CGGGAAATGATTGAAGAGTCTGCAAATAAATTTGGGATGAAGGACATGCGCGTGCAGACT
TTCAGCATTCATTTTGGGTTCAAGCACAAGTTTCTGGCCAGCGACGTGGTCTTTGCCACC
ATGTCTTTGATGGAGAGCCCCGAGAAGGATGGCTCAGGGACAGATCACTTCATCCAGGCT
CTGGACAGCCTCTCCAGGAGTAACCTGGACAAGCTGTACCATGGCCTGGAACTCGCCAAG
AAGCAGCTGCGAGCCACCCAGCAGACCATTGCCAGCTGCCTTTGCACCAACCTCGTCATC
TCCCAGGGGCCTTTCCTGTACTGCTCTCTCATGGAGGGCACTCCAGATGTCATGCTGTTC
TCTAGGCCGGCATCCCTAAGCCTGCTCAGCAAACACCTGCTCAAGTCCTTTGTGTGTTCG
ACAAAGAACCGGCGCTGCAAACTGCTGCCCCTGGTGATGGCTGCCCCCCTGAGCATGGAG
CATGGCACAGTGACCGTGGTGGGCATCCCCCCAGAGACCGACAGCTCGGACAGGAAGAAC
TTTTTTGGGAGGGCGTTTGAGAAGGCAGCGGAAAGCACCAGCTCCCGGATGCTGCACAAC
CATTTTGACCTCTCAGTAATTGAGCTGAAAGCTGAGGATCGGAGCAAGTTTCTGGACGCA
CTTATTTCCCTCCTGTCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1771
Start on reference sequence 71
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDC45
Symbol Nomenclature : CDC45
SYNONYM : CDC45L; CDC45L2; PORC-PI-1
Designation : CDC45 cell division cycle 45 homolog|CDC45-related protein|cell division control protein 45 homolog|cell division cycle 45 homolog|cell division cycle 45-like 2|human CDC45
Full Nomenclature : cell division cycle 45
GENEID : 8318
Locus Tag : UNQ374/PRO710
GI : 60656162
GenBank Accession : AY889854
HGNC : 1739
MIM : 603465
Vega : OTTHUMG00000150386
Target GenBank: BC006232

 

Reference Sequence Alignment

  

HsCD00003856        ATGTTCGTGTCCGATTTCCGCAAAGAGTTCTACGAGGTGGTCCAGAGCCAGAGGGTCCTT
NM_003504.4         ATGTTCGTGTCCGATTTCCGCAAAGAGTTCTACGAGGTGGTCCAGAGCCAGAGGGTCCTT
NM_001178011.2      ATGTTCGTGTCCGATTTCCGCAAAGAGTTCTACGAGGTGGTCCAGAGCCAGAGGGTCCTT
NM_001178010.2      ATGTTCGTGTCCGATTTCCGCAAAGAGTTCTACGAGGTGGTCCAGAGCCAGAGGGTCCTT
                    ************************************************************

HsCD00003856        CTCTTCGTGGCCTCGGACGTGGATGCTCTGTGTGCGTGCAAGATCCTTCAGGCCTTGTTC
NM_003504.4         CTCTTCGTGGCCTCGGACGTGGATGCTCTGTGTGCGTGCAAGATCCTTCAGGCCTTGTTC
NM_001178011.2      CTCTTCGTGGCCTCGGACGTGGATGCTCTGTGTGCGTGCAAGATCCTTCAGGCCTTGTTC
NM_001178010.2      CTCTTCGTGGCCTCGGACGTGGATGCTCTGTGTGCGTGCAAGATCCTTCAGGCCTTGTTC
                    ************************************************************

HsCD00003856        CAGTGTGACCACGTGCAATATACGCTGGTTCCAGTTTCTGGGTGGCAAGAACTTGAAACT
NM_003504.4         CAGTGTGACCACGTGCAATATACGCTGGTTCCAGTTTCTGGGTGGCAAGAACTTGAAACT
NM_001178011.2      CAGTGTGACCACGTGCAATATACGCTGGTTCCAGTTTCTGGGTGGCAAGAACTTGAAACT
NM_001178010.2      CAGTGTGACCACGTGCAATATACGCTGGTTCCAGTTTCTGGGTGGCAAGAACTTGAAACT
                    ************************************************************

HsCD00003856        GCATTTCTTGAGCATAAAGAACAGTTTCATTATTTTATTCTCATAAACTGTGGAGCTAAT
NM_003504.4         GCATTTCTTGAGCATAAAGAACAGTTTCATTATTTTATTCTCATAAACTGTGGAGCTAAT
NM_001178011.2      GCATTTCTTGAGCATAAAGAACAG------------------------------------
NM_001178010.2      GCATTTCTTGAGCATAAAGAACAGTTTCATTATTTTATTCTCATAAACTGTGGAGCTAAT
                    ************************                                    

HsCD00003856        GTAGACCTATTGGATATTCTTCAACCTGATGAAGACACTATATTCTTTGTGTGTGACACC
NM_003504.4         GTAGACCTATTGGATATTCTTCAACCTGATGAAGACACTATATTCTTTGTGTGTGACACC
NM_001178011.2      ------------------------------------------------------------
NM_001178010.2      GTAGACCTATTGGATATTCTTCAACCTGATGAAGACACTATATTCTTTGTGTGTGACACC
                                                                                

HsCD00003856        CATAGGCCAGTCAATGTCGTCAATGTATACAACGATACCCAGATCAAATTACTCATTAAA
NM_003504.4         CATAGGCCAGTCAATGTCGTCAATGTATACAACGATACCCAGATCAAATTACTCATTAAA
NM_001178011.2      ------------------------------------------ATCAAATTACTCATTAAA
NM_001178010.2      CATAGGCCAGTCAATGTCGTCAATGTATACAACGATACCCAGATCAAATTACTCATTAAA
                                                              ******************

HsCD00003856        CAAGATGATGACCTTGAAGTTCCCGCCTATGAAGACATCTTCAGGGATGAAGAGGAGGAT
NM_003504.4         CAAGATGATGACCTTGAAGTTCCCGCCTATGAAGACATCTTCAGGGATGAAGAGGAGGAT
NM_001178011.2      CAAGATGATGACCTTGAAGTTCCCGCCTATGAAGACATCTTCAGGGATGAAGAGGAGGAT
NM_001178010.2      CAAGATGATGACCTTGAAGTTCCCGCCTATGAAGACATCTTCAGGGATGAAGAGGAGGAT
                    ************************************************************

HsCD00003856        GAAGAGCATTCAGGAAATGACAGTGATGGGTCAGAGCCTTCTGAGAAGCGCACACGGTTA
NM_003504.4         GAAGAGCATTCAGGAAATGACAGTGATGGGTCAGAGCCTTCTGAGAAGCGCACACGGTTA
NM_001178011.2      GAAGAGCATTCAGGAAATGACAGTGATGGGTCAGAGCCTTCTGAGAAGCGCACACGGTTA
NM_001178010.2      GAAGAGCATTCAGGAAATGACAGTGATGGGTCAGAGCCTTCTGAGAAGCGCACACGGTTA
                    ************************************************************

HsCD00003856        GAAGAGGAGATAGTGGAGCAAACCATGCGGAGGAGGCAGCGGCGAGAGTGGGAGGCCCG-
NM_003504.4         GAAGAGGAGATAGTGGAGCAAACCATGCGGAGGAGGCAGCGGCGAGAGTGGGAGGCCCG-
NM_001178011.2      GAAGAGGAGATAGTGGAGCAAACCATGCGGAGGAGGCAGCGGCGAGAGTGGGAGGCCCG-
NM_001178010.2      GAAGAGGAGATAGTGGAGCAAACCATGCGGAGGAGGCAGCGGCGAGAGTGGGAGGCCCGG
                    *********************************************************** 

HsCD00003856        ------------------------------------------------------------
NM_003504.4         ------------------------------------------------------------
NM_001178011.2      ------------------------------------------------------------
NM_001178010.2      AGTGGCTCTGGGAGTGAACCTGTGGCCGCTGCATTGGAGAAGAGCTCCAGGTTGTTCGCC
                                                                                

HsCD00003856        -----------------------------------GAGAAGAGACATCCTCTTTGACTAC
NM_003504.4         -----------------------------------GAGAAGAGACATCCTCTTTGACTAC
NM_001178011.2      -----------------------------------GAGAAGAGACATCCTCTTTGACTAC
NM_001178010.2      GGTCCCATGAGTGACAGGACAGCCCCAAGGTCTCCCAGAAGAGACATCCTCTTTGACTAC
                                                        ************************

HsCD00003856        GAGCAGTATGAATATCATGGGACATCGTCAGCCATGGTGATGTTTGAGCTGGCTTGGATG
NM_003504.4         GAGCAGTATGAATATCATGGGACATCGTCAGCCATGGTGATGTTTGAGCTGGCTTGGATG
NM_001178011.2      GAGCAGTATGAATATCATGGGACATCGTCAGCCATGGTGATGTTTGAGCTGGCTTGGATG
NM_001178010.2      GAGCAGTATGAATATCATGGGACATCGTCAGCCATGGTGATGTTTGAGCTGGCTTGGATG
                    ************************************************************

HsCD00003856        CTGTCCAAGGACCTGAATGACATGCTGTGGTGGGCCATCGTTGGACTAACAGACCAGTGG
NM_003504.4         CTGTCCAAGGACCTGAATGACATGCTGTGGTGGGCCATCGTTGGACTAACAGACCAGTGG
NM_001178011.2      CTGTCCAAGGACCTGAATGACATGCTGTGGTGGGCCATCGTTGGACTAACAGACCAGTGG
NM_001178010.2      CTGTCCAAGGACCTGAATGACATGCTGTGGTGGGCCATCGTTGGACTAACAGACCAGTGG
                    ************************************************************

HsCD00003856        GTGCAAGACAAGATCACTCAAATGAAATACGTGACTGATGTTGGTGTCCTGCAGCGCCAC
NM_003504.4         GTGCAAGACAAGATCACTCAAATGAAATACGTGACTGATGTTGGTGTCCTGCAGCGCCAC
NM_001178011.2      GTGCAAGACAAGATCACTCAAATGAAATACGTGACTGATGTTGGTGTCCTGCAGCGCCAC
NM_001178010.2      GTGCAAGACAAGATCACTCAAATGAAATACGTGACTGATGTTGGTGTCCTGCAGCGCCAC
                    ************************************************************

HsCD00003856        GTTTCCCGCCACAACCACCGGAACGAGGATGAGGAGAACACACTCTCCGTGGACTGCACA
NM_003504.4         GTTTCCCGCCACAACCACCGGAACGAGGATGAGGAGAACACACTCTCCGTGGACTGCACA
NM_001178011.2      GTTTCCCGCCACAACCACCGGAACGAGGATGAGGAGAACACACTCTCCGTGGACTGCACA
NM_001178010.2      GTTTCCCGCCACAACCACCGGAACGAGGATGAGGAGAACACACTCTCCGTGGACTGCACA
                    ************************************************************

HsCD00003856        CGGATCTCCTTTGAGTATGACCTCCGCCTGGTGCTCTACCAGCACTGGTCCCTCCATGAC
NM_003504.4         CGGATCTCCTTTGAGTATGACCTCCGCCTGGTGCTCTACCAGCACTGGTCCCTCCATGAC
NM_001178011.2      CGGATCTCCTTTGAGTATGACCTCCGCCTGGTGCTCTACCAGCACTGGTCCCTCCATGAC
NM_001178010.2      CGGATCTCCTTTGAGTATGACCTCCGCCTGGTGCTCTACCAGCACTGGTCCCTCCATGAC
                    ************************************************************

HsCD00003856        AGCCTGTGCAACACCAGCTATACCGCAGCCAGGTTCAAGCTGTGGTCTGTGCATGGACAG
NM_003504.4         AGCCTGTGCAACACCAGCTATACCGCAGCCAGGTTCAAGCTGTGGTCTGTGCATGGACAG
NM_001178011.2      AGCCTGTGCAACACCAGCTATACCGCAGCCAGGTTCAAGCTGTGGTCTGTGCATGGACAG
NM_001178010.2      AGCCTGTGCAACACCAGCTATACCGCAGCCAGGTTCAAGCTGTGGTCTGTGCATGGACAG
                    ************************************************************

HsCD00003856        AAGCGGCTCCAGGAGTTCCTTGCAGACATGGGTCTTCCCCTGAAGCAGGTGAAGCAGAAG
NM_003504.4         AAGCGGCTCCAGGAGTTCCTTGCAGACATGGGTCTTCCCCTGAAGCAGGTGAAGCAGAAG
NM_001178011.2      AAGCGGCTCCAGGAGTTCCTTGCAGACATGGGTCTTCCCCTGAAGCAGGTGAAGCAGAAG
NM_001178010.2      AAGCGGCTCCAGGAGTTCCTTGCAGACATGGGTCTTCCCCTGAAGCAGGTGAAGCAGAAG
                    ************************************************************

HsCD00003856        TTCCAGGCCATGGACATCTCCTTGAAGGAGAATTTGCGGGAAATGATTGAAGAGTCTGCA
NM_003504.4         TTCCAGGCCATGGACATCTCCTTGAAGGAGAATTTGCGGGAAATGATTGAAGAGTCTGCA
NM_001178011.2      TTCCAGGCCATGGACATCTCCTTGAAGGAGAATTTGCGGGAAATGATTGAAGAGTCTGCA
NM_001178010.2      TTCCAGGCCATGGACATCTCCTTGAAGGAGAATTTGCGGGAAATGATTGAAGAGTCTGCA
                    ************************************************************

HsCD00003856        AATAAATTTGGGATGAAGGACATGCGCGTGCAGACTTTCAGCATTCATTTTGGGTTCAAG
NM_003504.4         AATAAATTTGGGATGAAGGACATGCGCGTGCAGACTTTCAGCATTCATTTTGGGTTCAAG
NM_001178011.2      AATAAATTTGGGATGAAGGACATGCGCGTGCAGACTTTCAGCATTCATTTTGGGTTCAAG
NM_001178010.2      AATAAATTTGGGATGAAGGACATGCGCGTGCAGACTTTCAGCATTCATTTTGGGTTCAAG
                    ************************************************************

HsCD00003856        CACAAGTTTCTGGCCAGCGACGTGGTCTTTGCCACCATGTCTTTGATGGAGAGCCCCGAG
NM_003504.4         CACAAGTTTCTGGCCAGCGACGTGGTCTTTGCCACCATGTCTTTGATGGAGAGCCCCGAG
NM_001178011.2      CACAAGTTTCTGGCCAGCGACGTGGTCTTTGCCACCATGTCTTTGATGGAGAGCCCCGAG
NM_001178010.2      CACAAGTTTCTGGCCAGCGACGTGGTCTTTGCCACCATGTCTTTGATGGAGAGCCCCGAG
                    ************************************************************

HsCD00003856        AAGGATGGCTCAGGGACAGATCACTTCATCCAGGCTCTGGACAGCCTCTCCAGGAGTAAC
NM_003504.4         AAGGATGGCTCAGGGACAGATCACTTCATCCAGGCTCTGGACAGCCTCTCCAGGAGTAAC
NM_001178011.2      AAGGATGGCTCAGGGACAGATCACTTCATCCAGGCTCTGGACAGCCTCTCCAGGAGTAAC
NM_001178010.2      AAGGATGGCTCAGGGACAGATCACTTCATCCAGGCTCTGGACAGCCTCTCCAGGAGTAAC
                    ************************************************************

HsCD00003856        CTGGACAAGCTGTACCATGGCCTGGAACTCGCCAAGAAGCAGCTGCGAGCCACCCAGCAG
NM_003504.4         CTGGACAAGCTGTACCATGGCCTGGAACTCGCCAAGAAGCAGCTGCGAGCCACCCAGCAG
NM_001178011.2      CTGGACAAGCTGTACCATGGCCTGGAACTCGCCAAGAAGCAGCTGCGAGCCACCCAGCAG
NM_001178010.2      CTGGACAAGCTGTACCATGGCCTGGAACTCGCCAAGAAGCAGCTGCGAGCCACCCAGCAG
                    ************************************************************

HsCD00003856        ACCATTGCCAGCTGCCTTTGCACCAACCTCGTCATCTCCCAGGGGCCTTTCCTGTACTGC
NM_003504.4         ACCATTGCCAGCTGCCTTTGCACCAACCTCGTCATCTCCCAGGGGCCTTTCCTGTACTGC
NM_001178011.2      ACCATTGCCAGCTGCCTTTGCACCAACCTCGTCATCTCCCAGGGGCCTTTCCTGTACTGC
NM_001178010.2      ACCATTGCCAGCTGCCTTTGCACCAACCTCGTCATCTCCCAGGGGCCTTTCCTGTACTGC
                    ************************************************************

HsCD00003856        TCTCTCATGGAGGGCACTCCAGATGTCATGCTGTTCTCTAGGCCGGCATCCCTAAGCCTG
NM_003504.4         TCTCTCATGGAGGGCACTCCAGATGTCATGCTGTTCTCTAGGCCGGCATCCCTAAGCCTG
NM_001178011.2      TCTCTCATGGAGGGCACTCCAGATGTCATGCTGTTCTCTAGGCCGGCATCCCTAAGCCTG
NM_001178010.2      TCTCTCATGGAGGGCACTCCAGATGTCATGCTGTTCTCTAGGCCGGCATCCCTAAGCCTG
                    ************************************************************

HsCD00003856        CTCAGCAAACACCTGCTCAAGTCCTTTGTGTGTTCGACAAAGAACCGGCGCTGCAAACTG
NM_003504.4         CTCAGCAAACACCTGCTCAAGTCCTTTGTGTGTTCGACAAAGAACCGGCGCTGCAAACTG
NM_001178011.2      CTCAGCAAACACCTGCTCAAGTCCTTTGTGTGTTCGACAAAGAACCGGCGCTGCAAACTG
NM_001178010.2      CTCAGCAAACACCTGCTCAAGTCCTTTGTGTGTTCGACAAAGAACCGGCGCTGCAAACTG
                    ************************************************************

HsCD00003856        CTGCCCCTGGTGATGGCTGCCCCCCTGAGCATGGAGCATGGCACAGTGACCGTGGTGGGC
NM_003504.4         CTGCCCCTGGTGATGGCTGCCCCCCTGAGCATGGAGCATGGCACAGTGACCGTGGTGGGC
NM_001178011.2      CTGCCCCTGGTGATGGCTGCCCCCCTGAGCATGGAGCATGGCACAGTGACCGTGGTGGGC
NM_001178010.2      CTGCCCCTGGTGATGGCTGCCCCCCTGAGCATGGAGCATGGCACAGTGACCGTGGTGGGC
                    ************************************************************

HsCD00003856        ATCCCCCCAGAGACCGACAGCTCGGACAGGAAGAACTTTTTTGGGAGGGCGTTTGAGAAG
NM_003504.4         ATCCCCCCAGAGACCGACAGCTCGGACAGGAAGAACTTTTTTGGGAGGGCGTTTGAGAAG
NM_001178011.2      ATCCCCCCAGAGACCGACAGCTCGGACAGGAAGAACTTTTTTGGGAGGGCGTTTGAGAAG
NM_001178010.2      ATCCCCCCAGAGACCGACAGCTCGGACAGGAAGAACTTTTTTGGGAGGGCGTTTGAGAAG
                    ************************************************************

HsCD00003856        GCAGCGGAAAGCACCAGCTCCCGGATGCTGCACAACCATTTTGACCTCTCAGTAATTGAG
NM_003504.4         GCAGCGGAAAGCACCAGCTCCCGGATGCTGCACAACCATTTTGACCTCTCAGTAATTGAG
NM_001178011.2      GCAGCGGAAAGCACCAGCTCCCGGATGCTGCACAACCATTTTGACCTCTCAGTAATTGAG
NM_001178010.2      GCAGCGGAAAGCACCAGCTCCCGGATGCTGCACAACCATTTTGACCTCTCAGTAATTGAG
                    ************************************************************

HsCD00003856        CTGAAAGCTGAGGATCGGAGCAAGTTTCTGGACGCACTTATTTCCCTCCTGTCCTAG
NM_003504.4         CTGAAAGCTGAGGATCGGAGCAAGTTTCTGGACGCACTTATTTCCCTCCTGTCCTAG
NM_001178011.2      CTGAAAGCTGAGGATCGGAGCAAGTTTCTGGACGCACTTATTTCCCTCCTGTCCTAG
NM_001178010.2      CTGAAAGCTGAGGATCGGAGCAAGTTTCTGGACGCACTTATTTCCCTCCTGTCCTAG
                    *********************************************************

Pathways

Reactome : Activation of ATR in response to replication stress
Reactome : Activation of the pre-replicative complex
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : DNA Replication
Reactome : DNA Replication Pre-Initiation
Reactome : DNA strand elongation
Reactome : E2F mediated regulation of DNA replication
Reactome : G1/S Transition
Reactome : G1/S-Specific Transcription
Reactome : G2/M Checkpoints
Reactome : M/G1 Transition
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic M-M/G1 phases
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Unwinding of DNA
WikiPathway : Cell cycle
WikiPathway : DNA Replication
WikiPathway : G1 to S cell cycle control

Protein

UniProt : B4DDB4
UniProt : E9PDH7
UniProt : B4DDU3
UniProt : O75419
HPRD : 09145

Clone

Cloning Information : 25487
HIP Master Clone ID : 55863
Original Clone ID : FLH025487.01X

Organism


TAX_ID : 9606
Species Specific ID: 8318

Genome

Chromosome : 22
Map Location : 22q11.21
Ensembl : ENSG00000093009

Reagents

Labome : CDC45-antibody