DNASU Plasmid Repository • 480.965.5697 | Email

CA8 (Homo sapiens) in pVP56K (His and MBP-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CA8
Gene Name:  carbonic anhydrase VIII
Sequence             
Original Clone ID: 2015.1.86_GO.57446
Keyword: full-length cds
Species: Homo sapiens
Type: cDNA
Vector Name: pVP56K               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: PSI
Center for Eukaryotic Structural Genomics
HsCD00386054

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 879nts         Open reading frame : 51 to 929
Reference Sequence Alignment

GTGCCGGGCTGGAAGTTCTGTTCCAGGGGCCCGAAAACCTGTACTTCCAGGCGATCGCCG
CGGACCTGAGCTTCATCGAAGATACCGTCGCCTTCCCCGAGAAGGAAGAGGATGAGGAGG
AAGAAGAGGAGGGTGTGGAGTGGGGCTACGAGGAAGGTGTTGAGTGGGGTCTGGTGTTTC
CTGATGCTAATGGGGAATACCAGTCTCCTATTAACCTAAACTCAAGAGAGGCTAGGTATG
ACCCCTCGCTGTTGGATGTCCGCCTCTCCCCAAATTATGTGGTGTGCCGAGACTGTGAAG
TCACCAATGATGGACATACCATTCAGGTTATCCTGAAGTCAAAATCAGTTCTTTCGGGAG
GACCATTGCCTCAAGGGCATGAATTTGAACTGTACGAAGTGAGATTTCACTGGGGAAGAG
AAAACCAGCGTGGTTCTGAGCACACGGTTAATTTCAAAGCTTTTCCCATGGAGCTCCATC
TGATCCACTGGAACTCCACTCTGTTTGGCAGCATTGATGAGGCTGTGGGGAAGCCGCACG
GAATCGCCATCATTGCTCTGTTTGTTCAGATAGGAAAGGAACATGTTGGCTTGAAGGCTG
TGACTGAAATCCTCCAAGATATTCAGTATAAGGGGAAGTCCAAAACAATACCTTGCTTTA
ATCCTAACACTTTATTACCAGACCCTCTGCTGCGGGATTACTGGGTGTATGAAGGCTCTC
TCACCATCCCACCTTGCAGTGAAGGTGTCACCTGGATATTATTCCGATACCCTTTAACTA
TATCCCAGCTACAGATAGAAGAATTTCGAAGGCTGAGGACACATGTTAAGGGGGCAGAAC
TTGTGGAAGGCTGTGATGGGATTTTGGGAGACAACTTTCGGCCCACTCAGCCTCTTAGTG
ACAGAGTCATTAGAGCTGCATTTCAGTAGTAGGTTTAAACGAATTCGAGCTCGGTA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
ins@874,3
                                

5' Linker Sequence: None
3' Linker Sequence:
GTTTAAAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Protein_Soluble
Find experimental protocols in GO.57446
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pVP56K

pVP56K in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  MBP Forward
Reverse:  T7 Terminator
Description: Bacterial (E. coli) expression, adds N-terminal 8xHis, MBP, 3CP cleavage, Tev cleavage; kanamycin resistance; restriction enzyme cloning (SgfI, PmeI).
Comments: Cloning into this vector will remove the BarCat casstte
Size (bp): 7253
Parent Vector: None
Empty Vector: EvNO00084282
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
Publications: PMID: 16377204
Title: High efficiency single step production of expression plasmids from cDNA clones using the Flexi Vector cloning system

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 5502 6184
promoter T5 T5 promoter 123 169
protease cleavage site 3C 3C protease cleavage site 1388 1412
protease cleavage site TEV TEV protease cleavage site 1413 1433
repressor protein gene LacI LacI cds 3845 4924
selectable marker CmR Chlorampenicol resistance gene (CAT) 1903 2556
selectable marker Barnase Barnase gene 1464 1800
tag His 8xHis tag 237 260
tag MBP MBP tag 267 1363

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CA8
Symbol Nomenclature : CA8
SYNONYM : CA-VIII; CALS; CAMRQ3; CARP
Designation : CA-related protein|carbonate dehydratase|carbonic anhydrase-like sequence|carbonic anhydrase-related protein
Full Nomenclature : carbonic anhydrase VIII
GENEID : 767
GI : 22027500
GenBank Accession : NM_004056
HGNC : 1382
MIM : 114815
Target GenBank: NM_004056

 

Reference Sequence Alignment

  

HsCD00386054      GTGCCGGGCTGGAAGTTCTGTTCCAGGGGCCCGAAAACCTGTACTTCCAGGCGATCGCCG
NM_004056.4       --------------------------------------------------------ATGG
                                                                          .  *

HsCD00386054      CGGACCTGAGCTTCATCGAAGATACCGTCGCCTTCCCCGAGAAGGAAGAGGATGAGGAGG
NM_004056.4       CGGACCTGAGCTTCATCGAAGATACCGTCGCCTTCCCCGAGAAGGAAGAGGATGAGGAGG
                  ************************************************************

HsCD00386054      AAGAAGAGGAGGGTGTGGAGTGGGGCTACGAGGAAGGTGTTGAGTGGGGTCTGGTGTTTC
NM_004056.4       AAGAAGAGGAGGGTGTGGAGTGGGGCTACGAGGAAGGTGTTGAGTGGGGTCTGGTGTTTC
                  ************************************************************

HsCD00386054      CTGATGCTAATGGGGAATACCAGTCTCCTATTAACCTAAACTCAAGAGAGGCTAGGTATG
NM_004056.4       CTGATGCTAATGGGGAATACCAGTCTCCTATTAACCTAAACTCAAGAGAGGCTAGGTATG
                  ************************************************************

HsCD00386054      ACCCCTCGCTGTTGGATGTCCGCCTCTCCCCAAATTATGTGGTGTGCCGAGACTGTGAAG
NM_004056.4       ACCCCTCGCTGTTGGATGTCCGCCTCTCCCCAAATTATGTGGTGTGCCGAGACTGTGAAG
                  ************************************************************

HsCD00386054      TCACCAATGATGGACATACCATTCAGGTTATCCTGAAGTCAAAATCAGTTCTTTCGGGAG
NM_004056.4       TCACCAATGATGGACATACCATTCAGGTTATCCTGAAGTCAAAATCAGTTCTTTCGGGAG
                  ************************************************************

HsCD00386054      GACCATTGCCTCAAGGGCATGAATTTGAACTGTACGAAGTGAGATTTCACTGGGGAAGAG
NM_004056.4       GACCATTGCCTCAAGGGCATGAATTTGAACTGTACGAAGTGAGATTTCACTGGGGAAGAG
                  ************************************************************

HsCD00386054      AAAACCAGCGTGGTTCTGAGCACACGGTTAATTTCAAAGCTTTTCCCATGGAGCTCCATC
NM_004056.4       AAAACCAGCGTGGTTCTGAGCACACGGTTAATTTCAAAGCTTTTCCCATGGAGCTCCATC
                  ************************************************************

HsCD00386054      TGATCCACTGGAACTCCACTCTGTTTGGCAGCATTGATGAGGCTGTGGGGAAGCCGCACG
NM_004056.4       TGATCCACTGGAACTCCACTCTGTTTGGCAGCATTGATGAGGCTGTGGGGAAGCCGCACG
                  ************************************************************

HsCD00386054      GAATCGCCATCATTGCTCTGTTTGTTCAGATAGGAAAGGAACATGTTGGCTTGAAGGCTG
NM_004056.4       GAATCGCCATCATTGCTCTGTTTGTTCAGATAGGAAAGGAACATGTTGGCTTGAAGGCTG
                  ************************************************************

HsCD00386054      TGACTGAAATCCTCCAAGATATTCAGTATAAGGGGAAGTCCAAAACAATACCTTGCTTTA
NM_004056.4       TGACTGAAATCCTCCAAGATATTCAGTATAAGGGGAAGTCCAAAACAATACCTTGCTTTA
                  ************************************************************

HsCD00386054      ATCCTAACACTTTATTACCAGACCCTCTGCTGCGGGATTACTGGGTGTATGAAGGCTCTC
NM_004056.4       ATCCTAACACTTTATTACCAGACCCTCTGCTGCGGGATTACTGGGTGTATGAAGGCTCTC
                  ************************************************************

HsCD00386054      TCACCATCCCACCTTGCAGTGAAGGTGTCACCTGGATATTATTCCGATACCCTTTAACTA
NM_004056.4       TCACCATCCCACCTTGCAGTGAAGGTGTCACCTGGATATTATTCCGATACCCTTTAACTA
                  ************************************************************

HsCD00386054      TATCCCAGCTACAGATAGAAGAATTTCGAAGGCTGAGGACACATGTTAAGGGGGCAGAAC
NM_004056.4       TATCCCAGCTACAGATAGAAGAATTTCGAAGGCTGAGGACACATGTTAAGGGGGCAGAAC
                  ************************************************************

HsCD00386054      TTGTGGAAGGCTGTGATGGGATTTTGGGAGACAACTTTCGGCCCACTCAGCCTCTTAGTG
NM_004056.4       TTGTGGAAGGCTGTGATGGGATTTTGGGAGACAACTTTCGGCCCACTCAGCCTCTTAGTG
                  ************************************************************

HsCD00386054      ACAGAGTCATTAGAGCTGCATTTCAGTAGTAGGTTTAAACGAATTCGAGCTCGGTA
NM_004056.4       ACAGAGTCATTAGAGCTGCATTTCAGTAG---------------------------
                  *****************************                           

Protein

SMART domain : Carb_anhydrase : Eukaryotic-type carbonic anhydrase
Structural Annotation Wiki : TOPSAN
UniProt : P35219
HPRD : 00266

Clone

Cloning Information : 559050
HIP Master Clone ID : 469370
Original Clone ID : 2015.1.86_GO.57446

Experimental

TargetTrack - Experimental data : GO.57446

Organism


TAX_ID : 9606
Species Specific ID: 767

Genome

Chromosome : 8
Map Location : 8q12.1

Reagents

Labome : CA8-antibody