DNASU Plasmid Repository • 480.965.5697 | Email

PAPSS2 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PAPSS2
Gene Name:  3'-phosphoadenosine 5'-phosphosulfate synthase 2
Sequence             
Original Clone ID: FLH205956.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038687

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1845nts         Open reading frame : 1 to 1845
Reference Sequence Alignment

ATGTCGGGGATCAAGAAGCAAAAGACGGAGAACCAGCAGAAATCCACCAATGTAGTCTAT
CAGGCCCACCATGTGAGCAGGAATAAGAGAGGGCAAGTGGTTGGAACAAGGGGTGGGTTC
CGAGGATGTACCGTGTGGCTAACAGGTCTCTCTGGTGCTGGAAAAACAACGATAAGTTTT
GCCCTGGAGGAGTACCTTGTCTCCCATGCCATCCCTTGTTACTCCCTGGATGGGGACAAT
GTCCGTCATGGCCTTAACAGAAATCTCGGATTCTCTCCTGGGGACAGAGAGGAAAATATC
CGCCGGATTGCTGAGGTGGCTAAGCTGTTTGCTGATGCTGGTCTGGTCTGCATTACCAGC
TTTATTTCTCCATTCGCAAAGGATCGTGAGAATGCCCGCAAAATACATGAATCAGCAGGG
CTGCCATTCTTTGAAATATTTGTAGATGCACCTCTAAATATTTGTGAAAGCAGAGACGTA
AAAGGCCTCTATAAAAGGGCCAGAGCTGGGGAGATTAAAGGATTTACAGGTATTGATTCT
GATTATGAGAAACCTGAAACTCCTGAGCGTGTGCTTAAAACCAATTTGTCCACAGTGAGT
GACTGTGTCCACCAGGTAGTGGAACTTCTGCAAGAGCAGAACATTGTACCCTATACTATA
ATCAAAGATATCCACGAACTCTTTGTGCCGGAAAACAAACTTGACCACGTCCGAGCTGAG
GCTGAAACTCTCCCTTCATTATCAATTACTAAGCTGGATCTCCAGTGGGTCCAGGTTTTG
AGCGAAGGCTGGGCCACTCCCCTCAAAGGTTTCATGCGGGAGAAGGAGTACTTACAGGTT
ATGCACTTTGACACCCTGCTAGATGATGGCGTGATCAACATGAGCATCCCCATTGTACTG
CCCGTCTCTGCAGAGGATAAGACACGGCTGGAAGGGTGCAGCAAGTTTGTCCTGGCACAT
GGTGGACGGAGGGTAGCTATCTTACGAGACGCTGAATTCTATGAACACAGAAAAGAGGAA
CGCTGTTCCCGTGTTTGGGGGACAACATGTACAAAACACCCCCATATCAAAATGGTGATG
GAAAGTGGGGACTGGCTGGTTGGTGGAGACCTTCAGGTGCTGGAGAAAATAAGATGGAAT
GATGGGCTGGACCAATACCGTCTGACACCTCTGGAGCTCAAACAGAAATGTAAAGAAATG
AATGCTGATGCGGTGTTTGCATTCCAGTTGCGCAATCCTGTCCACAATGGCCATGCCCTG
TTGATGCAGGACACTCGCCGCAGGCTCCTAGAGAGGGGCTACAAGCACCCGGTCCTCCTA
CTACACCCTCTGGGCGGCTGGACCAAGGATGACGATGTGCCTCTAGACTGGCGGATGAAG
CAGCACGCGGCTGTGCTCGAGGAAGGGGTCCTGGATCCCAAGTCAACCATTGTTGCCATC
TTTCCGTCTCCCATGTTATATGCTGGCCCCACAGAGGTCCAGTGGCACTGCAGGTCCCGG
ATGATTGCGGGTGCCAATTTCTACATTGTGGGGAGGGACCCTGCAGGAATGCCCCATCCT
GAAACCAAGAAGGATCTGTATGAACCCACTCATGGGGGCAAGGTCTTGAGCATGGCCCCT
GGCCTCACCTCTGTGGAAATCATTCCATTCCGAGTGGCTGCCTACAACAAAGCCAAAAAA
GCCATGGACTTCTATGATCCAGCAAGGCACAATGAGTTTGACTTCATCTCAGGAACTCGA
ATGAGGAAGCTCGCCCGGGAAGGAGAGAATCCCCCAGATGGCTTCATGGCCCCCAAAGCA
TGGAAGGTCCTGACAGATTATTACAGGTCCCTGGAGAAGAACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1965
Start on reference sequence 121
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: EvNO00023114
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PAPSS2
Symbol Nomenclature : PAPSS2
SYNONYM : ATPSK2; BCYM4; SK2
Designation : 3-prime-phosphoadenosine 5-prime-phosphosulfate synthase 2|ATP sulfurylase/APS kinase 2|ATP sulfurylase/adenosine 5'-phosphosulfate kinase|PAPS synthase 2|PAPS synthetase 2|SK 2|bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 2|bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthethase 2
Full Nomenclature : 3'-phosphoadenosine 5'-phosphosulfate synthase 2
GENEID : 9060
Locus Tag : RP11-77F13.2
HGNC : 8604
MIM : 603005
Vega : OTTHUMG00000018683
Target GenBank: BC009894

 

Reference Sequence Alignment

  

HsCD00038687        ATGTCGGGGATCAAGAAGCAAAAGACGGAGAACCAGCAGAAATCCACCAATGTAGTCTAT
NM_001015880.1      ATGTCGGGGATCAAGAAGCAAAAGACGGAGAACCAGCAGAAATCCACCAATGTAGTCTAT
NM_004670.3         ATGTCGGGGATCAAGAAGCAAAAGACGGAGAACCAGCAGAAATCCACCAATGTAGTCTAT
                    ************************************************************

HsCD00038687        CAGGCCCACCATGTGAGCAGGAATAAGAGAGGGCAAGTGGTTGGAACAAGGGGTGGGTTC
NM_001015880.1      CAGGCCCACCATGTGAGCAGGAATAAGAGAGGGCAAGTGGTTGGAACAAGGGGTGGGTTC
NM_004670.3         CAGGCCCACCATGTGAGCAGGAATAAGAGAGGGCAAGTGGTTGGAACAAGGGGTGGGTTC
                    ************************************************************

HsCD00038687        CGAGGATGTACCGTGTGGCTAACAGGTCTCTCTGGTGCTGGAAAAACAACGATAAGTTTT
NM_001015880.1      CGAGGATGTACCGTGTGGCTAACAGGTCTCTCTGGTGCTGGAAAAACAACGATAAGTTTT
NM_004670.3         CGAGGATGTACCGTGTGGCTAACAGGTCTCTCTGGTGCTGGAAAAACAACGATAAGTTTT
                    ************************************************************

HsCD00038687        GCCCTGGAGGAGTACCTTGTCTCCCATGCCATCCCTTGTTACTCCCTGGATGGGGACAAT
NM_001015880.1      GCCCTGGAGGAGTACCTTGTCTCCCATGCCATCCCTTGTTACTCCCTGGATGGGGACAAT
NM_004670.3         GCCCTGGAGGAGTACCTTGTCTCCCATGCCATCCCTTGTTACTCCCTGGATGGGGACAAT
                    ************************************************************

HsCD00038687        GTCCGTCATGGCCTTAACAGAAATCTCGGATTCTCTCCTGGGGACAGAGAGGAAAATATC
NM_001015880.1      GTCCGTCATGGCCTTAACAGAAATCTCGGATTCTCTCCTGGGGACAGAGAGGAAAATATC
NM_004670.3         GTCCGTCATGGCCTTAACAGAAATCTCGGATTCTCTCCTGGGGACAGAGAGGAAAATATC
                    ************************************************************

HsCD00038687        CGCCGGATTGCTGAGGTGGCTAAGCTGTTTGCTGATGCTGGTCTGGTCTGCATTACCAGC
NM_001015880.1      CGCCGGATTGCTGAGGTGGCTAAGCTGTTTGCTGATGCTGGTCTGGTCTGCATTACCAGC
NM_004670.3         CGCCGGATTGCTGAGGTGGCTAAGCTGTTTGCTGATGCTGGTCTGGTCTGCATTACCAGC
                    ************************************************************

HsCD00038687        TTTATTTCTCCATTCGCAAAGGATCGTGAGAATGCCCGCAAAATACATGAATCAGCAGGG
NM_001015880.1      TTTATTTCTCCATTCGCAAAGGATCGTGAGAATGCCCGCAAAATACATGAATCAGCAGGG
NM_004670.3         TTTATTTCTCCATTCGCAAAGGATCGTGAGAATGCCCGCAAAATACATGAATCAGCAGGG
                    ************************************************************

HsCD00038687        CTGCCATTCTTTGAAATATTTGTAGATGCACCTCTAAATATTTGTGAAAGCAGAGACGTA
NM_001015880.1      CTGCCATTCTTTGAAATATTTGTAGATGCACCTCTAAATATTTGTGAAAGCAGAGACGTA
NM_004670.3         CTGCCATTCTTTGAAATATTTGTAGATGCACCTCTAAATATTTGTGAAAGCAGAGACGTA
                    ************************************************************

HsCD00038687        AAAGGCCTCTATAAAAGGGCCAGAGCTGGGGAGATTAAAGGATTTACAGGTATTGATTCT
NM_001015880.1      AAAGGCCTCTATAAAAGGGCCAGAGCTGGGGAGATTAAAGGATTTACAGGTATTGATTCT
NM_004670.3         AAAGGCCTCTATAAAAGGGCCAGAGCTGGGGAGATTAAAGGATTTACAGGTATTGATTCT
                    ************************************************************

HsCD00038687        GATTATGAGAAACCTGAAACTCCTGAGCGTGTGCTTAAAACCAATTTGTCCACAGTGAGT
NM_001015880.1      GATTATGAGAAACCTGAAACTCCTGAGCGTGTGCTTAAAACCAATTTGTCCACAGTGAGT
NM_004670.3         GATTATGAGAAACCTGAAACTCCTGAGCGTGTGCTTAAAACCAATTTGTCCACAGTGAGT
                    ************************************************************

HsCD00038687        GACTGTGTCCACCAGGTAGTGGAACTTCTGCAAGAGCAGAACATTGTACCCTATACTATA
NM_001015880.1      GACTGTGTCCACCAGGTAGTGGAACTTCTGCAAGAGCAGAACATTGTACCCTATACTATA
NM_004670.3         GACTGTGTCCACCAGGTAGTGGAACTTCTGCAAGAGCAGAACATTGTACCCTATACTATA
                    ************************************************************

HsCD00038687        ATCAAAGATATCCACGAACTCTTTGTGCCGGAAAACAAACTTGACCACGTCCGAGCTGAG
NM_001015880.1      ATCAAAGATATCCACGAACTCTTTGTGCCGGAAAACAAACTTGACCACGTCCGAGCTGAG
NM_004670.3         ATCAAAGATATCCACGAACTCTTTGTGCCGGAAAACAAACTTGACCACGTCCGAGCTGAG
                    ************************************************************

HsCD00038687        GCTGAAACTCTCCCTTCATTATCAATTACTAAGCTGGATCTCCAGTGGGTCCAGGTTTTG
NM_001015880.1      GCTGAAACTCTCCCTTCATTATCAATTACTAAGCTGGATCTCCAGTGGGTCCAGGTTTTG
NM_004670.3         GCTGAAACTCTCCCTTCATTATCAATTACTAAGCTGGATCTCCAGTGGGTCCAGGTTTTG
                    ************************************************************

HsCD00038687        AGCGAAGGCTGGGCCACTCCCCTCAAAGGTTTCATGCGGGAGAAGGAGTACTTACAGGTT
NM_001015880.1      AGCGAAGGCTGGGCCACTCCCCTCAAAGGTTTCATGCGGGAGAAGGAGTACTTACAGGTT
NM_004670.3         AGCGAAGGCTGGGCCACTCCCCTCAAAGGTTTCATGCGGGAGAAGGAGTACTTACAGGTT
                    ************************************************************

HsCD00038687        ATGCACTTTGACACCCTGCTAGATG-----------------------ATGGCGTGATCA
NM_001015880.1      ATGCACTTTGACACCCT--------GCTAGATGGCATGGCCCTTCCTGATGGCGTGATCA
NM_004670.3         ATGCACTTTGACACCCT--------GCTAGATG---------------ATGGCGTGATCA
                    *****************                               ************

HsCD00038687        ACATGAGCATCCCCATTGTACTGCCCGTCTCTGCAGAGGATAAGACACGGCTGGAAGGGT
NM_001015880.1      ACATGAGCATCCCCATTGTACTGCCCGTCTCTGCAGAGGATAAGACACGGCTGGAAGGGT
NM_004670.3         ACATGAGCATCCCCATTGTACTGCCCGTCTCTGCAGAGGATAAGACACGGCTGGAAGGGT
                    ************************************************************

HsCD00038687        GCAGCAAGTTTGTCCTGGCACATGGTGGACGGAGGGTAGCTATCTTACGAGACGCTGAAT
NM_001015880.1      GCAGCAAGTTTGTCCTGGCACATGGTGGACGGAGGGTAGCTATCTTACGAGACGCTGAAT
NM_004670.3         GCAGCAAGTTTGTCCTGGCACATGGTGGACGGAGGGTAGCTATCTTACGAGACGCTGAAT
                    ************************************************************

HsCD00038687        TCTATGAACACAGAAAAGAGGAACGCTGTTCCCGTGTTTGGGGGACAACATGTACAAAAC
NM_001015880.1      TCTATGAACACAGAAAAGAGGAACGCTGTTCCCGTGTTTGGGGGACAACATGTACAAAAC
NM_004670.3         TCTATGAACACAGAAAAGAGGAACGCTGTTCCCGTGTTTGGGGGACAACATGTACAAAAC
                    ************************************************************

HsCD00038687        ACCCCCATATCAAAATGGTGATGGAAAGTGGGGACTGGCTGGTTGGTGGAGACCTTCAGG
NM_001015880.1      ACCCCCATATCAAAATGGTGATGGAAAGTGGGGACTGGCTGGTTGGTGGAGACCTTCAGG
NM_004670.3         ACCCCCATATCAAAATGGTGATGGAAAGTGGGGACTGGCTGGTTGGTGGAGACCTTCAGG
                    ************************************************************

HsCD00038687        TGCTGGAGAAAATAAGATGGAATGATGGGCTGGACCAATACCGTCTGACACCTCTGGAGC
NM_001015880.1      TGCTGGAGAAAATAAGATGGAATGATGGGCTGGACCAATACCGTCTGACACCTCTGGAGC
NM_004670.3         TGCTGGAGAAAATAAGATGGAATGATGGGCTGGACCAATACCGTCTGACACCTCTGGAGC
                    ************************************************************

HsCD00038687        TCAAACAGAAATGTAAAGAAATGAATGCTGATGCGGTGTTTGCATTCCAGTTGCGCAATC
NM_001015880.1      TCAAACAGAAATGTAAAGAAATGAATGCTGATGCGGTGTTTGCATTCCAGTTGCGCAATC
NM_004670.3         TCAAACAGAAATGTAAAGAAATGAATGCTGATGCGGTGTTTGCATTCCAGTTGCGCAATC
                    ************************************************************

HsCD00038687        CTGTCCACAATGGCCATGCCCTGTTGATGCAGGACACTCGCCGCAGGCTCCTAGAGAGGG
NM_001015880.1      CTGTCCACAATGGCCATGCCCTGTTGATGCAGGACACTCGCCGCAGGCTCCTAGAGAGGG
NM_004670.3         CTGTCCACAATGGCCATGCCCTGTTGATGCAGGACACTCGCCGCAGGCTCCTAGAGAGGG
                    ************************************************************

HsCD00038687        GCTACAAGCACCCGGTCCTCCTACTACACCCTCTGGGCGGCTGGACCAAGGATGACGATG
NM_001015880.1      GCTACAAGCACCCGGTCCTCCTACTACACCCTCTGGGCGGCTGGACCAAGGATGACGATG
NM_004670.3         GCTACAAGCACCCGGTCCTCCTACTACACCCTCTGGGCGGCTGGACCAAGGATGACGATG
                    ************************************************************

HsCD00038687        TGCCTCTAGACTGGCGGATGAAGCAGCACGCGGCTGTGCTCGAGGAAGGGGTCCTGGATC
NM_001015880.1      TGCCTCTAGACTGGCGGATGAAGCAGCACGCGGCTGTGCTCGAGGAAGGGGTCCTGGATC
NM_004670.3         TGCCTCTAGACTGGCGGATGAAGCAGCACGCGGCTGTGCTCGAGGAAGGGGTCCTGGATC
                    ************************************************************

HsCD00038687        CCAAGTCAACCATTGTTGCCATCTTTCCGTCTCCCATGTTATATGCTGGCCCCACAGAGG
NM_001015880.1      CCAAGTCAACCATTGTTGCCATCTTTCCGTCTCCCATGTTATATGCTGGCCCCACAGAGG
NM_004670.3         CCAAGTCAACCATTGTTGCCATCTTTCCGTCTCCCATGTTATATGCTGGCCCCACAGAGG
                    ************************************************************

HsCD00038687        TCCAGTGGCACTGCAGGTCCCGGATGATTGCGGGTGCCAATTTCTACATTGTGGGGAGGG
NM_001015880.1      TCCAGTGGCACTGCAGGTCCCGGATGATTGCGGGTGCCAATTTCTACATTGTGGGGAGGG
NM_004670.3         TCCAGTGGCACTGCAGGTCCCGGATGATTGCGGGTGCCAATTTCTACATTGTGGGGAGGG
                    ************************************************************

HsCD00038687        ACCCTGCAGGAATGCCCCATCCTGAAACCAAGAAGGATCTGTATGAACCCACTCATGGGG
NM_001015880.1      ACCCTGCAGGAATGCCCCATCCTGAAACCAAGAAGGATCTGTATGAACCCACTCATGGGG
NM_004670.3         ACCCTGCAGGAATGCCCCATCCTGAAACCAAGAAGGATCTGTATGAACCCACTCATGGGG
                    ************************************************************

HsCD00038687        GCAAGGTCTTGAGCATGGCCCCTGGCCTCACCTCTGTGGAAATCATTCCATTCCGAGTGG
NM_001015880.1      GCAAGGTCTTGAGCATGGCCCCTGGCCTCACCTCTGTGGAAATCATTCCATTCCGAGTGG
NM_004670.3         GCAAGGTCTTGAGCATGGCCCCTGGCCTCACCTCTGTGGAAATCATTCCATTCCGAGTGG
                    ************************************************************

HsCD00038687        CTGCCTACAACAAAGCCAAAAAAGCCATGGACTTCTATGATCCAGCAAGGCACAATGAGT
NM_001015880.1      CTGCCTACAACAAAGCCAAAAAAGCCATGGACTTCTATGATCCAGCAAGGCACAATGAGT
NM_004670.3         CTGCCTACAACAAAGCCAAAAAAGCCATGGACTTCTATGATCCAGCAAGGCACAATGAGT
                    ************************************************************

HsCD00038687        TTGACTTCATCTCAGGAACTCGAATGAGGAAGCTCGCCCGGGAAGGAGAGAATCCCCCAG
NM_001015880.1      TTGACTTCATCTCAGGAACTCGAATGAGGAAGCTCGCCCGGGAAGGAGAGAATCCCCCAG
NM_004670.3         TTGACTTCATCTCAGGAACTCGAATGAGGAAGCTCGCCCGGGAAGGAGAGAATCCCCCAG
                    ************************************************************

HsCD00038687        ATGGCTTCATGGCCCCCAAAGCATGGAAGGTCCTGACAGATTATTACAGGTCCCTGGAGA
NM_001015880.1      ATGGCTTCATGGCCCCCAAAGCATGGAAGGTCCTGACAGATTATTACAGGTCCCTGGAGA
NM_004670.3         ATGGCTTCATGGCCCCCAAAGCATGGAAGGTCCTGACAGATTATTACAGGTCCCTGGAGA
                    ************************************************************

HsCD00038687        AGAACTTG
NM_001015880.1      AGAACTAA
NM_004670.3         AGAACTAA
                    ******:.

Pathways

Panther : Sulfate assimilation
Reactome : Biological oxidations
Reactome : Cytosolic sulfonation of small molecules
Reactome : Disease
Reactome : Glycogen storage diseases
Reactome : Glycosaminoglycan metabolism
Reactome : MPS I - Hurler syndrome
Reactome : MPS II - Hunter syndrome
Reactome : MPS IIIA - Sanfilippo syndrome A
Reactome : MPS IIIB - Sanfilippo syndrome B
Reactome : MPS IIIC - Sanfilippo syndrome C
Reactome : MPS IIID - Sanfilippo syndrome D
Reactome : MPS IV - Morquio syndrome A
Reactome : MPS IV - Morquio syndrome B
Reactome : MPS IX - Natowicz syndrome
Reactome : MPS VI - Maroteaux-Lamy syndrome
Reactome : MPS VII - Sly syndrome
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Mucopolysaccharidoses
Reactome : Myoclonic epilepsy of Lafora
Reactome : Phase II conjugation
Reactome : Transport and synthesis of PAPS
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Sulfation Biotransformation Reaction

Protein

UniProt : O95340
UniProt : Q5TB52
HPRD : 04303

Clone

Cloning Information : 205956
HIP Master Clone ID : 178207
Original Clone ID : FLH205956.01L

Organism


TAX_ID : 9606
Species Specific ID: 9060

Genome

Chromosome : 10
Map Location : 10q24
Ensembl : ENSG00000198682

Reagents

Labome : PAPSS2-antibody