DNASU Plasmid Repository • 480.965.5697 | Email

PRKCB1 (Homo sapiens) in pJP1520 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRKCB
Gene Name:  protein kinase C, beta
Sequence             
Original Clone ID: FLH213916.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1520               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00038741

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2022nts         Open reading frame : 1 to 2022
Reference Sequence Alignment

ATGGCTGACCCGGCTGCGGGGCCGCCGCCGAGCGAGGGCGAGGAGAGCACCGTGCGCTTC
GCCCGCAAAGGCGCCCTCCGGCAGAAGAACGTGCATGAGGTCAAGAACCACAAATTCACC
GCCCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGGGCTTC
GGGAAGCAGGGATTCCAGTGCCAAGTTTGCTGCTTTGTGGTGCACAAGCGGTGCCATGAA
TTTGTCACATTCTCCTGCCCTGGCGCTGACAAGGGTCCAGCCTCCGATGACCCCCGCAGC
AAACACAAGTTTAAGATCCACACGTACTCCAGCCCCACGTTTTGTGACCACTGTGGGTCA
CTGCTGTATGGACTCATCCACCAGGGGATGAAATGTGACACCTGCATGATGAATGTGCAC
AAGCGCTGCGTGATGAATGTTCCCAGCCTGTGTGGCACGGACCACACGGAGCGCCGCGGC
CGCATCTACATCCAGGCCCACATCGACAGGGACGTCCTCATTGTCCTCGTAAGAGATGCT
AAAAACCTTGTACCTATGGACCCCAATGGCCTGTCAGATCCCTACGTAAAACTGAAACTG
ATTCCCGATCCCAAAAGTGAGAGCAAACAGAAGACCAAAACCATCAAATGCTCCCTCAAC
CCTGAGTGGAATGAGACATTTAGATTTCAGCTGAAAGAATCGGACAAAGACAGAAGACTG
TCAGTAGAGATTTGGGATTGGGATTTGACCAGCAGGAATGACTTCATGGGATCTTTGTCC
TTTGGGATTTCTGAACTTCAGAAAGCCAGTGTTGATGGCTGGTTTAAGTTACTGAGCCAG
GAGGAAGGCGAGTACTTCAATGTGCCTGTGCCACCAGAAGGAAGTGAGGCCAATGAAGAA
CTGCGGCAGAAATTTGAGAGGGCCAAGATCAGTCAGGGAACCAAGGTCCCGGAAGAAAAG
ACGACCAACACTGTCTCCAAATTTGACAACAATGGCAACAGAGACCGGATGAAACTGACC
GATTTTAACTTCCTAATGGTGCTGGGGAAAGGCAGCTTTGGCAAGGTCATGCTTTCAGAA
CGAAAAGGCACAGATGAGCTCTATGCTGTGAAGATCCTGAAGAAGGACGTTGTGATCCAA
GATGATGACGTGGAGTGCACTATGGTGGAGAAGCGGGTGTTGGCCCTGCCTGGGAAGCCG
CCCTTCCTGACCCAGCTCCACTCCTGCTTCCAGACCATGGACCGCCTGTACTTTGTGATG
GAGTACGTGAATGGGGGCGACCTCATGTATCACATCCAGCAAGTCGGCCGGTTCAAGGAG
CCCCATGCTGTATTTTACGCTGCAGAAATTGCCATCGGTCTGTTCTTCTTACAGAGTAAG
GGCATCATTTACCGTGACCTAAAACTTGACAACGTGATGCTCGATTCTGAGGGACACATC
AAGATTGCCGATTTTGGCATGTGTAAGGAAAACATCTGGGATGGGGTGACAACCAAGACA
TTCTGTGGCACTCCAGACTACATCGCCCCCGAGATAATTGCTTATCAGCCCTATGGGAAG
TCCGTGGATTGGTGGGCATTTGGAGTCCTGCTGTATGAAATGTTGGCTGGGCAGGCACCC
TTTGAAGGGGAGGATGAAGATGAACTCTTCCAATCCATCATGGAACACAACGTAGCCTAT
CCCAAGTCTATGTCCAAGGAAGCTGTGGCCATCTGCAAAGGGCTGATGACCAAACACCCA
GGCAAACGTCTGGGTTGTGGACCTGAAGGCGAACGTGATATCAAAGAGCATGCATTTTTC
CGGTATATTGATTGGGAGAAACTTGAACGCAAAGAGATCCAGCCCCCTTATAAGCCAAAA
GCTTGTGGGCGAAATGCTGAAAACTTCGACCGATTTTTCACCCGCCATCCACCAGTCCTA
ACACCTCCCGACCAGGAAGTCATCAGGAATATTGACCAATCAGAATTCGAAGGATTTTCC
TTTGTTAACTCTGAATTTTTAAAACCCGAAGTCAAGAGCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 2179
Start on reference sequence 158
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  puromycin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1520

pJP1520 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (puromycin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7894
Parent Vector: None
Empty Vector: None
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori bacterial origin of replication 5659 6341
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer JPO113 forward sequencing primer: GCGGTTTTGGCAGTACATCAATGGGCG 3555 3581
primer site PBSQ primer binding sequence (glutamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3879 4005
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRKCB
Symbol Nomenclature : PRKCB
SYNONYM : PKC-beta; PKCB; PRKCB1; PRKCB2
Designation : PKC-B|protein kinase C beta type|protein kinase C, beta 1 polypeptide
Full Nomenclature : protein kinase C, beta
GENEID : 5579
HGNC : 9395
MIM : 176970
Vega : OTTHUMG00000131615
Target GenBank: BC036472

 

Reference Sequence Alignment

  

HsCD00038741      ATGGCTGACCCGGCTGCGGGGCCGCCGCCGAGCGAGGGCGAGGAGAGCACCGTGCGCTTC
NM_002738.6       ATGGCTGACCCGGCTGCGGGGCCGCCGCCGAGCGAGGGCGAGGAGAGCACCGTGCGCTTC
NM_212535.2       ATGGCTGACCCGGCTGCGGGGCCGCCGCCGAGCGAGGGCGAGGAGAGCACCGTGCGCTTC
                  ************************************************************

HsCD00038741      GCCCGCAAAGGCGCCCTCCGGCAGAAGAACGTGCATGAGGTCAAGAACCACAAATTCACC
NM_002738.6       GCCCGCAAAGGCGCCCTCCGGCAGAAGAACGTGCATGAGGTCAAGAACCACAAATTCACC
NM_212535.2       GCCCGCAAAGGCGCCCTCCGGCAGAAGAACGTGCATGAGGTCAAGAACCACAAATTCACC
                  ************************************************************

HsCD00038741      GCCCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGGGCTTC
NM_002738.6       GCCCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGGGCTTC
NM_212535.2       GCCCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGGGCTTC
                  ************************************************************

HsCD00038741      GGGAAGCAGGGATTCCAGTGCCAAGTTTGCTGCTTTGTGGTGCACAAGCGGTGCCATGAA
NM_002738.6       GGGAAGCAGGGATTCCAGTGCCAAGTTTGCTGCTTTGTGGTGCACAAGCGGTGCCATGAA
NM_212535.2       GGGAAGCAGGGATTCCAGTGCCAAGTTTGCTGCTTTGTGGTGCACAAGCGGTGCCATGAA
                  ************************************************************

HsCD00038741      TTTGTCACATTCTCCTGCCCTGGCGCTGACAAGGGTCCAGCCTCCGATGACCCCCGCAGC
NM_002738.6       TTTGTCACATTCTCCTGCCCTGGCGCTGACAAGGGTCCAGCCTCCGATGACCCCCGCAGC
NM_212535.2       TTTGTCACATTCTCCTGCCCTGGCGCTGACAAGGGTCCAGCCTCCGATGACCCCCGCAGC
                  ************************************************************

HsCD00038741      AAACACAAGTTTAAGATCCACACGTACTCCAGCCCCACGTTTTGTGACCACTGTGGGTCA
NM_002738.6       AAACACAAGTTTAAGATCCACACGTACTCCAGCCCCACGTTTTGTGACCACTGTGGGTCA
NM_212535.2       AAACACAAGTTTAAGATCCACACGTACTCCAGCCCCACGTTTTGTGACCACTGTGGGTCA
                  ************************************************************

HsCD00038741      CTGCTGTATGGACTCATCCACCAGGGGATGAAATGTGACACCTGCATGATGAATGTGCAC
NM_002738.6       CTGCTGTATGGACTCATCCACCAGGGGATGAAATGTGACACCTGCATGATGAATGTGCAC
NM_212535.2       CTGCTGTATGGACTCATCCACCAGGGGATGAAATGTGACACCTGCATGATGAATGTGCAC
                  ************************************************************

HsCD00038741      AAGCGCTGCGTGATGAATGTTCCCAGCCTGTGTGGCACGGACCACACGGAGCGCCGCGGC
NM_002738.6       AAGCGCTGCGTGATGAATGTTCCCAGCCTGTGTGGCACGGACCACACGGAGCGCCGCGGC
NM_212535.2       AAGCGCTGCGTGATGAATGTTCCCAGCCTGTGTGGCACGGACCACACGGAGCGCCGCGGC
                  ************************************************************

HsCD00038741      CGCATCTACATCCAGGCCCACATCGACAGGGACGTCCTCATTGTCCTCGTAAGAGATGCT
NM_002738.6       CGCATCTACATCCAGGCCCACATCGACAGGGACGTCCTCATTGTCCTCGTAAGAGATGCT
NM_212535.2       CGCATCTACATCCAGGCCCACATCGACAGGGACGTCCTCATTGTCCTCGTAAGAGATGCT
                  ************************************************************

HsCD00038741      AAAAACCTTGTACCTATGGACCCCAATGGCCTGTCAGATCCCTACGTAAAACTGAAACTG
NM_002738.6       AAAAACCTTGTACCTATGGACCCCAATGGCCTGTCAGATCCCTACGTAAAACTGAAACTG
NM_212535.2       AAAAACCTTGTACCTATGGACCCCAATGGCCTGTCAGATCCCTACGTAAAACTGAAACTG
                  ************************************************************

HsCD00038741      ATTCCCGATCCCAAAAGTGAGAGCAAACAGAAGACCAAAACCATCAAATGCTCCCTCAAC
NM_002738.6       ATTCCCGATCCCAAAAGTGAGAGCAAACAGAAGACCAAAACCATCAAATGCTCCCTCAAC
NM_212535.2       ATTCCCGATCCCAAAAGTGAGAGCAAACAGAAGACCAAAACCATCAAATGCTCCCTCAAC
                  ************************************************************

HsCD00038741      CCTGAGTGGAATGAGACATTTAGATTTCAGCTGAAAGAATCGGACAAAGACAGAAGACTG
NM_002738.6       CCTGAGTGGAATGAGACATTTAGATTTCAGCTGAAAGAATCGGACAAAGACAGAAGACTG
NM_212535.2       CCTGAGTGGAATGAGACATTTAGATTTCAGCTGAAAGAATCGGACAAAGACAGAAGACTG
                  ************************************************************

HsCD00038741      TCAGTAGAGATTTGGGATTGGGATTTGACCAGCAGGAATGACTTCATGGGATCTTTGTCC
NM_002738.6       TCAGTAGAGATTTGGGATTGGGATTTGACCAGCAGGAATGACTTCATGGGATCTTTGTCC
NM_212535.2       TCAGTAGAGATTTGGGATTGGGATTTGACCAGCAGGAATGACTTCATGGGATCTTTGTCC
                  ************************************************************

HsCD00038741      TTTGGGATTTCTGAACTTCAGAAAGCCAGTGTTGATGGCTGGTTTAAGTTACTGAGCCAG
NM_002738.6       TTTGGGATTTCTGAACTTCAGAAAGCCAGTGTTGATGGCTGGTTTAAGTTACTGAGCCAG
NM_212535.2       TTTGGGATTTCTGAACTTCAGAAAGCCAGTGTTGATGGCTGGTTTAAGTTACTGAGCCAG
                  ************************************************************

HsCD00038741      GAGGAAGGCGAGTACTTCAATGTGCCTGTGCCACCAGAAGGAAGTGAGGCCAATGAAGAA
NM_002738.6       GAGGAAGGCGAGTACTTCAATGTGCCTGTGCCACCAGAAGGAAGTGAGGCCAATGAAGAA
NM_212535.2       GAGGAAGGCGAGTACTTCAATGTGCCTGTGCCACCAGAAGGAAGTGAGGCCAATGAAGAA
                  ************************************************************

HsCD00038741      CTGCGGCAGAAATTTGAGAGGGCCAAGATCAGTCAGGGAACCAAGGTCCCGGAAGAAAAG
NM_002738.6       CTGCGGCAGAAATTTGAGAGGGCCAAGATCAGTCAGGGAACCAAGGTCCCGGAAGAAAAG
NM_212535.2       CTGCGGCAGAAATTTGAGAGGGCCAAGATCAGTCAGGGAACCAAGGTCCCGGAAGAAAAG
                  ************************************************************

HsCD00038741      ACGACCAACACTGTCTCCAAATTTGACAACAATGGCAACAGAGACCGGATGAAACTGACC
NM_002738.6       ACGACCAACACTGTCTCCAAATTTGACAACAATGGCAACAGAGACCGGATGAAACTGACC
NM_212535.2       ACGACCAACACTGTCTCCAAATTTGACAACAATGGCAACAGAGACCGGATGAAACTGACC
                  ************************************************************

HsCD00038741      GATTTTAACTTCCTAATGGTGCTGGGGAAAGGCAGCTTTGGCAAGGTCATGCTTTCAGAA
NM_002738.6       GATTTTAACTTCCTAATGGTGCTGGGGAAAGGCAGCTTTGGCAAGGTCATGCTTTCAGAA
NM_212535.2       GATTTTAACTTCCTAATGGTGCTGGGGAAAGGCAGCTTTGGCAAGGTCATGCTTTCAGAA
                  ************************************************************

HsCD00038741      CGAAAAGGCACAGATGAGCTCTATGCTGTGAAGATCCTGAAGAAGGACGTTGTGATCCAA
NM_002738.6       CGAAAAGGCACAGATGAGCTCTATGCTGTGAAGATCCTGAAGAAGGACGTTGTGATCCAA
NM_212535.2       CGAAAAGGCACAGATGAGCTCTATGCTGTGAAGATCCTGAAGAAGGACGTTGTGATCCAA
                  ************************************************************

HsCD00038741      GATGATGACGTGGAGTGCACTATGGTGGAGAAGCGGGTGTTGGCCCTGCCTGGGAAGCCG
NM_002738.6       GATGATGACGTGGAGTGCACTATGGTGGAGAAGCGGGTGTTGGCCCTGCCTGGGAAGCCG
NM_212535.2       GATGATGACGTGGAGTGCACTATGGTGGAGAAGCGGGTGTTGGCCCTGCCTGGGAAGCCG
                  ************************************************************

HsCD00038741      CCCTTCCTGACCCAGCTCCACTCCTGCTTCCAGACCATGGACCGCCTGTACTTTGTGATG
NM_002738.6       CCCTTCCTGACCCAGCTCCACTCCTGCTTCCAGACCATGGACCGCCTGTACTTTGTGATG
NM_212535.2       CCCTTCCTGACCCAGCTCCACTCCTGCTTCCAGACCATGGACCGCCTGTACTTTGTGATG
                  ************************************************************

HsCD00038741      GAGTACGTGAATGGGGGCGACCTCATGTATCACATCCAGCAAGTCGGCCGGTTCAAGGAG
NM_002738.6       GAGTACGTGAATGGGGGCGACCTCATGTATCACATCCAGCAAGTCGGCCGGTTCAAGGAG
NM_212535.2       GAGTACGTGAATGGGGGCGACCTCATGTATCACATCCAGCAAGTCGGCCGGTTCAAGGAG
                  ************************************************************

HsCD00038741      CCCCATGCTGTATTTTACGCTGCAGAAATTGCCATCGGTCTGTTCTTCTTACAGAGTAAG
NM_002738.6       CCCCATGCTGTATTTTACGCTGCAGAAATTGCCATCGGTCTGTTCTTCTTACAGAGTAAG
NM_212535.2       CCCCATGCTGTATTTTACGCTGCAGAAATTGCCATCGGTCTGTTCTTCTTACAGAGTAAG
                  ************************************************************

HsCD00038741      GGCATCATTTACCGTGACCTAAAACTTGACAACGTGATGCTCGATTCTGAGGGACACATC
NM_002738.6       GGCATCATTTACCGTGACCTAAAACTTGACAACGTGATGCTCGATTCTGAGGGACACATC
NM_212535.2       GGCATCATTTACCGTGACCTAAAACTTGACAACGTGATGCTCGATTCTGAGGGACACATC
                  ************************************************************

HsCD00038741      AAGATTGCCGATTTTGGCATGTGTAAGGAAAACATCTGGGATGGGGTGACAACCAAGACA
NM_002738.6       AAGATTGCCGATTTTGGCATGTGTAAGGAAAACATCTGGGATGGGGTGACAACCAAGACA
NM_212535.2       AAGATTGCCGATTTTGGCATGTGTAAGGAAAACATCTGGGATGGGGTGACAACCAAGACA
                  ************************************************************

HsCD00038741      TTCTGTGGCACTCCAGACTACATCGCCCCCGAGATAATTGCTTATCAGCCCTATGGGAAG
NM_002738.6       TTCTGTGGCACTCCAGACTACATCGCCCCCGAGATAATTGCTTATCAGCCCTATGGGAAG
NM_212535.2       TTCTGTGGCACTCCAGACTACATCGCCCCCGAGATAATTGCTTATCAGCCCTATGGGAAG
                  ************************************************************

HsCD00038741      TCCGTGGATTGGTGGGCATTTGGAGTCCTGCTGTATGAAATGTTGGCTGGGCAGGCACCC
NM_002738.6       TCCGTGGATTGGTGGGCATTTGGAGTCCTGCTGTATGAAATGTTGGCTGGGCAGGCACCC
NM_212535.2       TCCGTGGATTGGTGGGCATTTGGAGTCCTGCTGTATGAAATGTTGGCTGGGCAGGCACCC
                  ************************************************************

HsCD00038741      TTTGAAGGGGAGGATGAAGATGAACTCTTCCAATCCATCATGGAACACAACGTAGCCTAT
NM_002738.6       TTTGAAGGGGAGGATGAAGATGAACTCTTCCAATCCATCATGGAACACAACGTAGCCTAT
NM_212535.2       TTTGAAGGGGAGGATGAAGATGAACTCTTCCAATCCATCATGGAACACAACGTAGCCTAT
                  ************************************************************

HsCD00038741      CCCAAGTCTATGTCCAAGGAAGCTGTGGCCATCTGCAAAGGGCTGATGACCAAACACCCA
NM_002738.6       CCCAAGTCTATGTCCAAGGAAGCTGTGGCCATCTGCAAAGGGCTGATGACCAAACACCCA
NM_212535.2       CCCAAGTCTATGTCCAAGGAAGCTGTGGCCATCTGCAAAGGGCTGATGACCAAACACCCA
                  ************************************************************

HsCD00038741      GGCAAACGTCTGGGTTGTGGACCTGAAGGCGAACGTGATATCAAAGAGCATGCATTTTTC
NM_002738.6       GGCAAACGTCTGGGTTGTGGACCTGAAGGCGAACGTGATATCAAAGAGCATGCATTTTTC
NM_212535.2       GGCAAACGTCTGGGTTGTGGACCTGAAGGCGAACGTGATATCAAAGAGCATGCATTTTTC
                  ************************************************************

HsCD00038741      CGGTATATTGATTGGGAGAAACTTGAACGCAAAGAGATCCAGCCCCCTTATAAGCCAAAA
NM_002738.6       CGGTATATTGATTGGGAGAAACTTGAACGCAAAGAGATCCAGCCCCCTTATAAGCCAAAA
NM_212535.2       CGGTATATTGATTGGGAGAAACTTGAACGCAAAGAGATCCAGCCCCCTTATAAGCCAAAA
                  ************************************************************

HsCD00038741      GCTTGTGGGCG---AAATGCTGAAAACTTCGACCGATTTTTCACCCGCCATCCACCAGTC
NM_002738.6       GCTTGTGGGCG---AAATGCTGAAAACTTCGACCGATTTTTCACCCGCCATCCACCAGTC
NM_212535.2       GCTAGAGACAAGAGAGACACCTCCAACTTCGACAAAGAGTTCACCAGACAGCCTGTGGAA
                  ***:*:*. ..   *.* .*  ..*********..* : ******.*.** **:  .*:.

HsCD00038741      CTAACACCTCCCGACCAGGAAGTCATCAGGAATATTGACCAATCAGAATTCGAAGGATTT
NM_002738.6       CTAACACCTCCCGACCAGGAAGTCATCAGGAATATTGACCAATCAGAATTCGAAGGATTT
NM_212535.2       CTGACCCCCACTGATAAACTCTTCATCATGAACTTGGACCAAAATGAATTTGCTGGCTTC
                  **.**.** .* ** .*. :. ****** *** :* ******:.:***** *.:**.** 

HsCD00038741      TCCTTTGTTAACTCTGAATTTTTAAAACCCGAAGTCAAGAGCTTG
NM_002738.6       TCCTTTGTTAACTCTGAATTTTTAAAACCCGAAGTCAAGAGCTAA
NM_212535.2       TCTTATACTAACCCAGAGTTTGTCATTAATGTGTAG---------
                  ** *:*. **** *:**.*** *.*::.. *:. :          

Pathways

NCI : Downstream signaling in naïve CD8+ T cells
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : IL2-mediated signaling events
NCI : JNK signaling in the CD4+ TCR pathway
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Regulation of Ras family activation
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
Panther : 5HT2 type receptor mediated signaling pathway
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Panther : Histamine H1 receptor mediated signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Metabotropic glutamate receptor group I pathway
Panther : Muscarinic acetylcholine receptor 1 and 3 signaling pathway
Panther : Oxytocin receptor mediated signaling pathway
Panther : Thyrotropin-releasing hormone receptor signaling pathway
Panther : VEGF signaling pathway
Panther : Wnt signaling pathway
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Depolymerisation of the Nuclear Lamina
Reactome : Disinhibition of SNARE formation
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : G alpha (z) signalling events
Reactome : GPCR downstream signaling
Reactome : Glutamate Binding, Activation of AMPA Receptors and Synaptic Plasticity
Reactome : Hemostasis
Reactome : Immune System
Reactome : M Phase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prophase
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Nuclear Envelope Breakdown
Reactome : PCP/CE pathway
Reactome : Platelet activation, signaling and aggregation
Reactome : Response to elevated platelet cytosolic Ca2+
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signaling by Wnt
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Trafficking of AMPA receptors
Reactome : Trafficking of GluR2-containing AMPA receptors
Reactome : Transmission across Chemical Synapses
Reactome : WNT5A-dependent internalization of FZD4
Reactome : beta-catenin independent WNT signaling
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : G Protein Signaling Pathways
WikiPathway : Insulin Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : Physiological and Pathological Hypertrophy of the Heart
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency
WikiPathway : miRs in Muscle Cell Differentiation

Clone

Cloning Information : 213916
HIP Master Clone ID : 178101
Original Clone ID : FLH213916.01L

Organism


TAX_ID : 9606
Species Specific ID: 5579

Genome

Chromosome : 16
Map Location : 16p11.2
Ensembl : ENSG00000166501

Reagents

Labome : PKC-beta-antibody