DNASU Plasmid Repository • 480.965.5697 | Email

PIK3CA (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3CA
Gene Name:  phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
Sequence             
Original Clone ID: FLH214195.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00038850

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3207nts         Open reading frame : 1 to 3207
Reference Sequence Alignment

ATGCCTCCAAGACCATCATCAGGTGAACTGTGGGGCATCCACTTGATGCCCCCAAGAATC
CTAGTAGAATGTTTACTACCAAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAGGCT
ACATTAATAACCATAAAGCATGAACTATTTAAAGAAGCAAGAAAATACCCCCTCCATCAA
CTTCTTCAAGATGAATCTTCTTACATTTTCGTAAGTGTTACTCAAGAAGCAGAAAGGGAA
GAATTTTTTGATGAAACAAGACGACTTTGTGACCTTCGGCTTTTTCAACCCTTTTTAAAA
GTAATTGAACCAGTAGGCAACCGTGAAGAAAAGATCCTCAATCGAGAAATTGGTTTTGCT
ATCGGCATGCCAGTGTGTGAATTTGATATGGTTAAAGATCCAGAAGTACAGGACTTCCGA
AGAAATGTTCTGAACGTTTGTAAAGAAGCTGTGGATCTTAGGGACCTCAATTCACCTCAT
AGTAGAGCAATGTATGTCTATCCTCCAAATGTAGAATCTTCACCAGAATTGCCAAAGCAC
ATATATAATAAATTAGATAAAGGGCAAATAATAGTGGTGATCTGGGTAATAGTTTCTCCA
AATAATGACAAGCAGAAGTATACTCTGAAAATCAACCATGACTGTGTACCAGAACAAGTA
ATTGCTGAAGCAATCAGGAAAAAAACTCGAAGTATGTTGCTATCCTCTGAACAACTAAAA
CTCTGTGTTTTAGAATATCAGGGCAAGTATATTTTAAAAGTGTGTGGATGTGATGAATAC
TTCCTAGAAAAATATCCTCTGAGTCAGTATAAGTATATAAGAAGCTGTATAATGCTTGGG
AGGATGCCCAATTTGATGTTGATGGCTAAAGAAAGCCTTTATTCTCAACTGCCAATGGAC
TGTTTTACAATGCCATCTTATTCCAGACGCATTTCCACAGCTACACCATATATGAATGGA
GAAACATCTACAAAATCCCTTTGGGTTATAAATAGTGCACTCAGAATAAAAATTCTTTGT
GCAACCTACGTGAATGTAAATATTCGAGACATTGATAAGATCTATGTTCGAACAGGTATC
TACCATGGAGGAGAACCCTTATGTGACAATGTGAACACTCAAAGAGTACCTTGTTCCAAT
CCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCT
CGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGT
CCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAA
ATGGCTTTGAATCTTTGGCCAGTACCTCATGGATTAGAAGATTTGCTGAACCCTATTGGT
GTTACTGGATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTC
AGCAGTGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGTCTGTA
TCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGGACTGAGTAACAGACTAGCTAGAGAC
AATGAATTAAGGGAAAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTC
TCTGAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTCACAGACACTATTGTGTAACT
ATCCCCGAAATTCTACCCAAATTGCTTCTGTCTGTTAAATGGAATTCTAGAGATGAAGTA
GCCCAGATGTATTGCTTGGTAAAAGATTGGCCTCCAATCAAACCTGAACAGGCTATGGAA
CTTCTGGACTGTAATTACCCAGATCCTATGGTTCGAGGTTTTGCTGTTCGGTGCTTGGAA
AAATATTTAACAGATGACAAACTTTCTCAGTATTTAATTCAGCTAGTACAGGTCCTAAAA
TATGAACAATATTTGGATAACTTGCTTGTGAGATTTTTACTGAAGAAAGCATTGACTAAT
CAAAGGATTGGGCACTTTTTCTTTTGGCATTTAAAATCTGAGATGCACAATAAAACAGTT
AGCCAGAGGTTTGGCCTGCTTTTGGAGTCCTATTGTCGTGCATGTGGGATGTATTTGAAG
CACCTGAATAGGCAAGTCGAGGCAATGGAAAAGCTCATTAACTTAACTGACATTCTCAAA
CAGGAGAAGAAGGATGAAACACAAAAGGTACAGATGAAGTTTTTAGTTGAGCAAATGAGG
CGACCAGATTTCATGGATGCTCTACAGGGCTTTCTGTCTCCTCTAAACCCTGCTCATCAA
CTAGGAAACCTCAGGCTTGAAGAGTGTCGAATTATGTCCTCTGCAAAAAGGCCACTGTGG
TTGAATTGGGAGAACCCAGACATCATGTCAGAGTTACTGTTTCAGAACAATGAGATCATC
TTTAAAAATGGGGATGATTTACGGCAAGATATGCTAACACTTCAAATTATTCGTATTATG
GAAAATATCTGGCAAAATCAAGGTCTTGATCTTCGAATGTTACCTTATGGTTGTCTGTCA
ATCGGTGACTGTGTGGGACTTATTGAGGTGGTGCGAAATTCTCACACTATTATGCAAATT
CAGTGCAAAGGCGGCTTGAAAGGTGCACTGCAGTTCAACAGCCACACACTACATCAGTGG
CTCAAAGACAAGAACAAAGGAGAAATATATGATGCAGCCATTGACCTGTTTACACGTTCA
TGTGCTGGATACTGTGTAGCTACCTTCATTTTGGGAATTGGAGATCGTCACAATAGTAAC
ATCATGGTGAAAGACGATGGACAACTGTTTCATATAGATTTTGGACACTTTTTGGATCAC
AAGAAGAAAAAATTTGGTTATAAACGAGAACGTGTGCCATTTGTTTTGACACAGGATTTC
TTAATAGTGATTAGTAAAGGAGCCCAAGAATGCACAAAGACAAGAGAATTTGAGAGGTTT
CAGGAGATGTGTTACAAGGCTTATCTAGCTATTCGACAGCATGCCAATCTCTTCATAAAT
CTTTTCTCAATGATGCTTGGCTCTGGAATGCCAGAACTACAATCTTTTGATGACATTGCA
TACATTCGAAAGACCCTAGCCTTAGATAAAACTGAGCAAGAGGCTTTGGAGTATTTCATG
AAACAAATGAATGATGCACATCATGGTGGCTGGACAACAAAAATGGATTGGATCTTCCAC
ACAATTAAACAGCATGCATTGAACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 3207
Start on reference sequence 1
Mutations:
None
Discrepancy:
c222t; a427g,I143V;
 c879t; c1354t;
 g2784a
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3CA
Symbol Nomenclature : PIK3CA
SYNONYM : CLOVE; CWS5; MCAP; MCM; MCMTC; PI3K; p110-alpha
Designation : PI3-kinase p110 subunit alpha|PI3K-alpha|phosphatidylinositol 3-kinase, catalytic, 110-KD, alpha|phosphatidylinositol 3-kinase, catalytic, alpha polypeptide|phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit alpha isoform|phosphatidylinositol-4,5-bisphosphate 3-kinase 110 kDa catalytic subunit alpha|phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit, alpha isoform|phosphoinositide-3-kinase, catalytic, alpha polypeptide|ptdIns-3-kinase subunit p110-alpha|serine/threonine protein kinase PIK3CA
Full Nomenclature : phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha
GENEID : 5290
HGNC : 8975
MIM : 171834
Target GenBank: U79143

 

Reference Sequence Alignment

  

HsCD00038850      ATGCCTCCAAGACCATCATCAGGTGAACTGTGGGGCATCCACTTGATGCCCCCAAGAATC
NM_006218.2       ATGCCTCCACGACCATCATCAGGTGAACTGTGGGGCATCCACTTGATGCCCCCAAGAATC
                  *********.**************************************************

HsCD00038850      CTAGTAGAATGTTTACTACCAAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAGGCT
NM_006218.2       CTAGTAGAATGTTTACTACCAAATGGAATGATAGTGACTTTAGAATGCCTCCGTGAGGCT
                  ************************************************************

HsCD00038850      ACATTAATAACCATAAAGCATGAACTATTTAAAGAAGCAAGAAAATACCCCCTCCATCAA
NM_006218.2       ACATTAATAACCATAAAGCATGAACTATTTAAAGAAGCAAGAAAATACCCCCTCCATCAA
                  ************************************************************

HsCD00038850      CTTCTTCAAGATGAATCTTCTTACATTTTCGTAAGTGTTACTCAAGAAGCAGAAAGGGAA
NM_006218.2       CTTCTTCAAGATGAATCTTCTTACATTTTCGTAAGTGTTACTCAAGAAGCAGAAAGGGAA
                  ************************************************************

HsCD00038850      GAATTTTTTGATGAAACAAGACGACTTTGTGACCTTCGGCTTTTTCAACCCTTTTTAAAA
NM_006218.2       GAATTTTTTGATGAAACAAGACGACTTTGTGACCTTCGGCTTTTTCAACCCTTTTTAAAA
                  ************************************************************

HsCD00038850      GTAATTGAACCAGTAGGCAACCGTGAAGAAAAGATCCTCAATCGAGAAATTGGTTTTGCT
NM_006218.2       GTAATTGAACCAGTAGGCAACCGTGAAGAAAAGATCCTCAATCGAGAAATTGGTTTTGCT
                  ************************************************************

HsCD00038850      ATCGGCATGCCAGTGTGTGAATTTGATATGGTTAAAGATCCAGAAGTACAGGACTTCCGA
NM_006218.2       ATCGGCATGCCAGTGTGTGAATTTGATATGGTTAAAGATCCAGAAGTACAGGACTTCCGA
                  ************************************************************

HsCD00038850      AGAAATGTTCTGAACGTTTGTAAAGAAGCTGTGGATCTTAGGGACCTCAATTCACCTCAT
NM_006218.2       AGAAATATTCTGAACGTTTGTAAAGAAGCTGTGGATCTTAGGGACCTCAATTCACCTCAT
                  ******.*****************************************************

HsCD00038850      AGTAGAGCAATGTATGTCTATCCTCCAAATGTAGAATCTTCACCAGAATTGCCAAAGCAC
NM_006218.2       AGTAGAGCAATGTATGTCTATCCTCCAAATGTAGAATCTTCACCAGAATTGCCAAAGCAC
                  ************************************************************

HsCD00038850      ATATATAATAAATTAGATAAAGGGCAAATAATAGTGGTGATCTGGGTAATAGTTTCTCCA
NM_006218.2       ATATATAATAAATTAGATAAAGGGCAAATAATAGTGGTGATCTGGGTAATAGTTTCTCCA
                  ************************************************************

HsCD00038850      AATAATGACAAGCAGAAGTATACTCTGAAAATCAACCATGACTGTGTACCAGAACAAGTA
NM_006218.2       AATAATGACAAGCAGAAGTATACTCTGAAAATCAACCATGACTGTGTACCAGAACAAGTA
                  ************************************************************

HsCD00038850      ATTGCTGAAGCAATCAGGAAAAAAACTCGAAGTATGTTGCTATCCTCTGAACAACTAAAA
NM_006218.2       ATTGCTGAAGCAATCAGGAAAAAAACTCGAAGTATGTTGCTATCCTCTGAACAACTAAAA
                  ************************************************************

HsCD00038850      CTCTGTGTTTTAGAATATCAGGGCAAGTATATTTTAAAAGTGTGTGGATGTGATGAATAC
NM_006218.2       CTCTGTGTTTTAGAATATCAGGGCAAGTATATTTTAAAAGTGTGTGGATGTGATGAATAC
                  ************************************************************

HsCD00038850      TTCCTAGAAAAATATCCTCTGAGTCAGTATAAGTATATAAGAAGCTGTATAATGCTTGGG
NM_006218.2       TTCCTAGAAAAATATCCTCTGAGTCAGTATAAGTATATAAGAAGCTGTATAATGCTTGGG
                  ************************************************************

HsCD00038850      AGGATGCCCAATTTGATGTTGATGGCTAAAGAAAGCCTTTATTCTCAACTGCCAATGGAC
NM_006218.2       AGGATGCCCAATTTGATGTTGATGGCTAAAGAAAGCCTTTATTCTCAACTGCCAATGGAC
                  ************************************************************

HsCD00038850      TGTTTTACAATGCCATCTTATTCCAGACGCATTTCCACAGCTACACCATATATGAATGGA
NM_006218.2       TGTTTTACAATGCCATCTTATTCCAGACGCATTTCCACAGCTACACCATATATGAATGGA
                  ************************************************************

HsCD00038850      GAAACATCTACAAAATCCCTTTGGGTTATAAATAGTGCACTCAGAATAAAAATTCTTTGT
NM_006218.2       GAAACATCTACAAAATCCCTTTGGGTTATAAATAGTGCACTCAGAATAAAAATTCTTTGT
                  ************************************************************

HsCD00038850      GCAACCTACGTGAATGTAAATATTCGAGACATTGATAAGATCTATGTTCGAACAGGTATC
NM_006218.2       GCAACCTACGTGAATGTAAATATTCGAGACATTGATAAGATCTATGTTCGAACAGGTATC
                  ************************************************************

HsCD00038850      TACCATGGAGGAGAACCCTTATGTGACAATGTGAACACTCAAAGAGTACCTTGTTCCAAT
NM_006218.2       TACCATGGAGGAGAACCCTTATGTGACAATGTGAACACTCAAAGAGTACCTTGTTCCAAT
                  ************************************************************

HsCD00038850      CCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCT
NM_006218.2       CCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCT
                  ************************************************************

HsCD00038850      CGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGT
NM_006218.2       CGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGT
                  ************************************************************

HsCD00038850      CCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAA
NM_006218.2       CCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAA
                  ************************************************************

HsCD00038850      ATGGCTTTGAATCTTTGGCCAGTACCTCATGGATTAGAAGATTTGCTGAACCCTATTGGT
NM_006218.2       ATGGCTTTGAATCTTTGGCCAGTACCTCATGGATTAGAAGATTTGCTGAACCCTATTGGT
                  ************************************************************

HsCD00038850      GTTACTGGATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTC
NM_006218.2       GTTACTGGATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTC
                  ************************************************************

HsCD00038850      AGCAGTGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGTCTGTA
NM_006218.2       AGCAGTGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGTCTGTA
                  ************************************************************

HsCD00038850      TCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGGACTGAGTAACAGACTAGCTAGAGAC
NM_006218.2       TCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGGACTGAGTAACAGACTAGCTAGAGAC
                  ************************************************************

HsCD00038850      AATGAATTAAGGGAAAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTC
NM_006218.2       AATGAATTAAGGGAAAATGACAAAGAACAGCTCAAAGCAATTTCTACACGAGATCCTCTC
                  ************************************************************

HsCD00038850      TCTGAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTCACAGACACTATTGTGTAACT
NM_006218.2       TCTGAAATCACTGAGCAGGAGAAAGATTTTCTATGGAGTCACAGACACTATTGTGTAACT
                  ************************************************************

HsCD00038850      ATCCCCGAAATTCTACCCAAATTGCTTCTGTCTGTTAAATGGAATTCTAGAGATGAAGTA
NM_006218.2       ATCCCCGAAATTCTACCCAAATTGCTTCTGTCTGTTAAATGGAATTCTAGAGATGAAGTA
                  ************************************************************

HsCD00038850      GCCCAGATGTATTGCTTGGTAAAAGATTGGCCTCCAATCAAACCTGAACAGGCTATGGAA
NM_006218.2       GCCCAGATGTATTGCTTGGTAAAAGATTGGCCTCCAATCAAACCTGAACAGGCTATGGAA
                  ************************************************************

HsCD00038850      CTTCTGGACTGTAATTACCCAGATCCTATGGTTCGAGGTTTTGCTGTTCGGTGCTTGGAA
NM_006218.2       CTTCTGGACTGTAATTACCCAGATCCTATGGTTCGAGGTTTTGCTGTTCGGTGCTTGGAA
                  ************************************************************

HsCD00038850      AAATATTTAACAGATGACAAACTTTCTCAGTATTTAATTCAGCTAGTACAGGTCCTAAAA
NM_006218.2       AAATATTTAACAGATGACAAACTTTCTCAGTATTTAATTCAGCTAGTACAGGTCCTAAAA
                  ************************************************************

HsCD00038850      TATGAACAATATTTGGATAACTTGCTTGTGAGATTTTTACTGAAGAAAGCATTGACTAAT
NM_006218.2       TATGAACAATATTTGGATAACTTGCTTGTGAGATTTTTACTGAAGAAAGCATTGACTAAT
                  ************************************************************

HsCD00038850      CAAAGGATTGGGCACTTTTTCTTTTGGCATTTAAAATCTGAGATGCACAATAAAACAGTT
NM_006218.2       CAAAGGATTGGGCACTTTTTCTTTTGGCATTTAAAATCTGAGATGCACAATAAAACAGTT
                  ************************************************************

HsCD00038850      AGCCAGAGGTTTGGCCTGCTTTTGGAGTCCTATTGTCGTGCATGTGGGATGTATTTGAAG
NM_006218.2       AGCCAGAGGTTTGGCCTGCTTTTGGAGTCCTATTGTCGTGCATGTGGGATGTATTTGAAG
                  ************************************************************

HsCD00038850      CACCTGAATAGGCAAGTCGAGGCAATGGAAAAGCTCATTAACTTAACTGACATTCTCAAA
NM_006218.2       CACCTGAATAGGCAAGTCGAGGCAATGGAAAAGCTCATTAACTTAACTGACATTCTCAAA
                  ************************************************************

HsCD00038850      CAGGAGAAGAAGGATGAAACACAAAAGGTACAGATGAAGTTTTTAGTTGAGCAAATGAGG
NM_006218.2       CAGGAGAAGAAGGATGAAACACAAAAGGTACAGATGAAGTTTTTAGTTGAGCAAATGAGG
                  ************************************************************

HsCD00038850      CGACCAGATTTCATGGATGCTCTACAGGGCTTTCTGTCTCCTCTAAACCCTGCTCATCAA
NM_006218.2       CGACCAGATTTCATGGATGCTCTACAGGGCTTTCTGTCTCCTCTAAACCCTGCTCATCAA
                  ************************************************************

HsCD00038850      CTAGGAAACCTCAGGCTTGAAGAGTGTCGAATTATGTCCTCTGCAAAAAGGCCACTGTGG
NM_006218.2       CTAGGAAACCTCAGGCTTGAAGAGTGTCGAATTATGTCCTCTGCAAAAAGGCCACTGTGG
                  ************************************************************

HsCD00038850      TTGAATTGGGAGAACCCAGACATCATGTCAGAGTTACTGTTTCAGAACAATGAGATCATC
NM_006218.2       TTGAATTGGGAGAACCCAGACATCATGTCAGAGTTACTGTTTCAGAACAATGAGATCATC
                  ************************************************************

HsCD00038850      TTTAAAAATGGGGATGATTTACGGCAAGATATGCTAACACTTCAAATTATTCGTATTATG
NM_006218.2       TTTAAAAATGGGGATGATTTACGGCAAGATATGCTAACACTTCAAATTATTCGTATTATG
                  ************************************************************

HsCD00038850      GAAAATATCTGGCAAAATCAAGGTCTTGATCTTCGAATGTTACCTTATGGTTGTCTGTCA
NM_006218.2       GAAAATATCTGGCAAAATCAAGGTCTTGATCTTCGAATGTTACCTTATGGTTGTCTGTCA
                  ************************************************************

HsCD00038850      ATCGGTGACTGTGTGGGACTTATTGAGGTGGTGCGAAATTCTCACACTATTATGCAAATT
NM_006218.2       ATCGGTGACTGTGTGGGACTTATTGAGGTGGTGCGAAATTCTCACACTATTATGCAAATT
                  ************************************************************

HsCD00038850      CAGTGCAAAGGCGGCTTGAAAGGTGCACTGCAGTTCAACAGCCACACACTACATCAGTGG
NM_006218.2       CAGTGCAAAGGCGGCTTGAAAGGTGCACTGCAGTTCAACAGCCACACACTACATCAGTGG
                  ************************************************************

HsCD00038850      CTCAAAGACAAGAACAAAGGAGAAATATATGATGCAGCCATTGACCTGTTTACACGTTCA
NM_006218.2       CTCAAAGACAAGAACAAAGGAGAAATATATGATGCAGCCATTGACCTGTTTACACGTTCA
                  ************************************************************

HsCD00038850      TGTGCTGGATACTGTGTAGCTACCTTCATTTTGGGAATTGGAGATCGTCACAATAGTAAC
NM_006218.2       TGTGCTGGATACTGTGTAGCTACCTTCATTTTGGGAATTGGAGATCGTCACAATAGTAAC
                  ************************************************************

HsCD00038850      ATCATGGTGAAAGACGATGGACAACTGTTTCATATAGATTTTGGACACTTTTTGGATCAC
NM_006218.2       ATCATGGTGAAAGACGATGGACAACTGTTTCATATAGATTTTGGACACTTTTTGGATCAC
                  ************************************************************

HsCD00038850      AAGAAGAAAAAATTTGGTTATAAACGAGAACGTGTGCCATTTGTTTTGACACAGGATTTC
NM_006218.2       AAGAAGAAAAAATTTGGTTATAAACGAGAACGTGTGCCATTTGTTTTGACACAGGATTTC
                  ************************************************************

HsCD00038850      TTAATAGTGATTAGTAAAGGAGCCCAAGAATGCACAAAGACAAGAGAATTTGAGAGGTTT
NM_006218.2       TTAATAGTGATTAGTAAAGGAGCCCAAGAATGCACAAAGACAAGAGAATTTGAGAGGTTT
                  ************************************************************

HsCD00038850      CAGGAGATGTGTTACAAGGCTTATCTAGCTATTCGACAGCATGCCAATCTCTTCATAAAT
NM_006218.2       CAGGAGATGTGTTACAAGGCTTATCTAGCTATTCGACAGCATGCCAATCTCTTCATAAAT
                  ************************************************************

HsCD00038850      CTTTTCTCAATGATGCTTGGCTCTGGAATGCCAGAACTACAATCTTTTGATGACATTGCA
NM_006218.2       CTTTTCTCAATGATGCTTGGCTCTGGAATGCCAGAACTACAATCTTTTGATGACATTGCA
                  ************************************************************

HsCD00038850      TACATTCGAAAGACCCTAGCCTTAGATAAAACTGAGCAAGAGGCTTTGGAGTATTTCATG
NM_006218.2       TACATTCGAAAGACCCTAGCCTTAGATAAAACTGAGCAAGAGGCTTTGGAGTATTTCATG
                  ************************************************************

HsCD00038850      AAACAAATGAATGATGCACATCATGGTGGCTGGACAACAAAAATGGATTGGATCTTCCAC
NM_006218.2       AAACAAATGAATGATGCACATCATGGTGGCTGGACAACAAAAATGGATTGGATCTTCCAC
                  ************************************************************

HsCD00038850      ACAATTAAACAGCATGCATTGAACTTG
NM_006218.2       ACAATTAAACAGCATGCATTGAACTGA
                  ************************* .

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Atypical NF-kappaB pathway
NCI : BCR signaling pathway
NCI : CDC42 signaling events
NCI : CXCR3-mediated signaling events
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : E-cadherin signaling in keratinocytes
NCI : E-cadherin signaling in the nascent adherens junction
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EPHA2 forward signaling
NCI : EPHB forward signaling
NCI : Ephrin B reverse signaling
NCI : ErbB1 downstream signaling
NCI : ErbB2/ErbB3 signaling events
NCI : ErbB4 signaling events
NCI : FAS (CD95) signaling pathway
NCI : FGF signaling pathway
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : IFN-gamma pathway
NCI : IGF1 pathway
NCI : IL1-mediated signaling events
NCI : IL2 signaling events mediated by PI3K
NCI : IL2 signaling events mediated by STAT5
NCI : IL2-mediated signaling events
NCI : IL23-mediated signaling events
NCI : IL3-mediated signaling events
NCI : IL4-mediated signaling events
NCI : IL5-mediated signaling events
NCI : IL6-mediated signaling events
NCI : Insulin Pathway
NCI : Integrins in angiogenesis
NCI : Internalization of ErbB1
NCI : N-cadherin signaling events
NCI : Nectin adhesion pathway
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Netrin-mediated signaling events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : Nongenotropic Androgen signaling
NCI : Osteopontin-mediated events
NCI : PAR1-mediated thrombin signaling events
NCI : PDGFR-alpha signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : Plasma membrane estrogen receptor signaling
NCI : Reelin signaling pathway
NCI : SHP2 signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by TCPTP
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events mediated by the Hedgehog family
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : TRAIL signaling pathway
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : VEGFR1 specific signals
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : a6b1 and a6b4 Integrin signaling
NCI : p75(NTR)-mediated signaling
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : Axon guidance mediated by netrin
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : T cell activation
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Adaptive Immune System
Reactome : CD28 co-stimulation
Reactome : CD28 dependent PI3K/Akt signaling
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream TCR signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : G alpha (12/13) signalling events
Reactome : G alpha (q) signalling events
Reactome : GAB1 signalosome
Reactome : GPCR downstream signaling
Reactome : GPVI-mediated activation cascade
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nephrin interactions
Reactome : PI Metabolism
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phospholipid metabolism
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Role of phospholipids in phagocytosis
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by FGFR1 fusion mutants
Reactome : Signaling by FGFR1 mutants
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Synthesis of PIPs at the plasma membrane
Reactome : TCR signaling
Reactome : Tie2 Signaling
WikiPathway : AMPK signaling
WikiPathway : Angiogenesis
WikiPathway : Estrogen signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : G13 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Keap1-Nrf2 Pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : Serotonin HTR1 Group and FOS Pathway
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TSH signaling pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 214195
HIP Master Clone ID : 87317
Original Clone ID : FLH214195.01L

Organism


TAX_ID : 9606
Species Specific ID: 5290

Genome

Chromosome : 3
Map Location : 3q26.3

Reagents

Labome : p110-antibody