DNASU Plasmid Repository • 480.965.5697 | Email

MYLK (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MYLK
Gene Name:  myosin light chain kinase
Sequence             
Original Clone ID: FLH214454.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors:
HsCD00039037

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2976nts         Open reading frame : 1 to 2976
Reference Sequence Alignment

ATGGATTTCCGTGCCAACCTGCAGCGGCAAGTGAAGCCAAAGACTGTGTCTGAGGAAGAG
AGGAAGGTGCACAGCCCCCAGCAGGTCGATTTTCGCTCTGTCCTGGCCAAGAAGGGGACT
TCCAAGACCCCCGTGCCTGAGAAGGTGCCACCGCCAAAACCTGCCACCCCGGATTTTCGC
TCAGTGCTGGGTGGCAAGAAGAAATTACCAGCAGAGAATGGCAGCAGCAGTGCCGAGACC
CTGAATGCCAAGGCAGTGGAAAGTTCCAAGCCCCTGAGCAATGCACAGCCTTCAGGGCCC
TTGAAACCCGTGGGCAACGCCAAGCCTGCTGAGACCCTGAAGCCAATGGGCAACGCCAAG
CCTGCCGAGACCCTGAAGCCCATGGGCAATGCCAAGCCTGATGAGAACCTGAAATCCGCT
AGCAAAGAACTCAAGAAAGACGTTAAGAATGATGTGAACTGCAAGAGAGGCCATGCAGGG
ACCACAGATAATGAAAAGAGATCAGAGAGCCAGGGGACAGCCCCAGCCTTCAAGCAGAAG
CTGCAAGATGTTCATGTGGCAGAGGGCAAGAAGCTGCTGCTCCAGTGCCAGGTGTCTTCT
GACCCCCCAGCCACCATCATCTGGACGCTGAATGGAAAGACCCTCAAGACCACCAAGTTC
ATCATCCTCTCCCAGGAAGGCTCACTCTGCTCCGTCTCCATCGAGAAGGCACTGCCTGAG
GACAGAGGCTTATACAAGTGTGTAGCCAAGAATGACGCTGGCCAGGCGGAGTGCTCCTGC
CAAGTCACCGTGGATGATGCTCCAGCCAGTGAGAACACCAAGGCCCCAGAGATGAAATCC
CGGAGGCCCAAGAGCTCTCTTCCTCCCGTGCTAGGAACTGAGAGTGATGCGACTGTGAAA
AAGAAACCTGCCCCCAAGACACCTCCGAAGGCAGCAATGCCCCCTCAGATCATCCAGTTC
CCTGAGGACCAGAAGGTACGCGCAGGAGAGTCAGTGGAGCTGTTTGGCAAAGTGACAGGC
ACTCAGCCCATCACCTGTACCTGGATGAAGTTCCGAAAGCAGATCCAGGAAAGCGAGCAC
ATGAAGGTGGAGAACAGCGAGAATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAG
CACTGCGGCTGCTACACACTGCTGGTGGAGAACAAGCTGGGCAGCAGGCGGGCCCAGGTC
AACCTCACTGTCGTGGATAAGCCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATT
CGGAGCTCCTCACTGACCCTGTCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTA
CAGTCCTACAGCATCGAGATCTGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACA
TGCCGCAGCACCTCTTTCAACGTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGT
GTACGTGCAATCAACGTGTATGGAACCAGTGAGCCAAGCCAGGAGTCTGAACTCACAACG
GTAGGAGAGAAACCTGAAGAGCCGAAGGATGAAGTGGAGGTGTCAGACGATGATGAGAAG
GAGCCCGAGGTTGATTACCGGACAGTGACAATCAATACTGAACAAAAAGTATCTGACTTC
TACGACATTGAGGAGAGATTAGGATCTGGGAAATTTGGACAGGTCTTTCGACTTGTAGAA
AAGAAAACTCGAAAAGTCTGGGCAGGGAAGTTCTTCAAGGCATATTCAGCAAAAGAGAAA
GAGAATATCCGGCAGGAGATTAGCATCATGAACTGCCTCCACCACCCTAAGCTGGTCCAG
TGTGTGGATGCCTTTGAAGAAAAGGCCAACATCGTCATGGTCCTGGAGATCGTGTCAGGA
GGGGAGCTGTTTGAGCGCATCATTGACGAGGACTTTGAGCTGACGGAGCGTGAGTGCATC
AAGTACATGCGGCAGATCTCGGAGGGAGTGGAGTACATCCACAAGCAGGGCATCGTGCAC
CTGGACCTCAAGCCGGAGAACATCATGTGTGTCAACAAGACGGGCACCAGGATCAAGCTC
ATCGACTTTGGTCTGGCCAGGAGGCTGGAGAATGCGGGGTCTCTGAAGGTCCTCTTTGGC
ACCCCAGAATTTGTGGCTCCTGAAGTGATCAACTATGAGCCCATCGGCTACGCCACAGAC
ATGTGGAGCATCGGGGTCATCTGCTACATCCTAGTCAGTGGCCTTTCCCCCTTCATGGGA
GACAACGATAACGAAACCTTGGCCAACGTTACCTCAGCCACCTGGGACTTCGACGACGAG
GCATTCGATGAGATCTCCGACGATGCCAAGGATTTCATCAGCAATCTGCTGAAGAAAGAT
ATGAAAAACCGCCTGGACTGCACGCAGTGCCTTCAGCATCCATGGCTAATGAAAGATACC
AAGAACATGGAGGCCAAGAAACTCTCCAAGGACCGGATGAAGAAGTACATGGCAAGAAGG
AAATGGCAGAAAACGGGCAATGCTGTGAGAGCCATTGGAAGACTGTCCTCTATGGCAATG
ATCTCAGGGCTCAGTGGCAGGAAATCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCA
GAAAAACTAGAATCTGAAGAAGATGTGTCCCAAGCTTTCCTTGAGGCTGTTGCTGAGGAA
AAGCCTCATGTAAAACCCTATTTCTCTAAGACCATTCGCGATTTAGAAGTTGTGGAGGGA
AGTGCTGCTAGATTTGACTGCAAGATTGAAGGATACCCAGACCCCGAGGTTGTCTGGTTC
AAAGATGACCAGTCAATCAGGGAGTCCCGCCACTTCCAGATAGACTACGATGAGGACGGG
AACTGCTCTTTAATTATTAGTGATGTTTGCGGGGATGACGATGCCAAGTACACCTGCAAG
GCTGTCAACAGTCTTGGAGAAGCCACCTGCACAGCAGAGCTCATTGTGGAAACGATGGAG
GAAGGTGAAGGGGAAGGGGAAGAGGAAGAAGAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 3357
Start on reference sequence 382
Mutations:
None
Discrepancy:
g261a,E87E;del@425,3;
c636t,N212N;a1193g,Q398R;
t1551c,D517D;ins@2598,3;
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MYLK
Symbol Nomenclature : MYLK
SYNONYM : AAT7; KRP; MLCK; MLCK1; MLCK108; MLCK210; MSTP083; MYLK1; smMLCK
Designation : kinase-related protein|myosin light chain kinase, smooth muscle|myosin, light polypeptide kinase|smooth muscle myosin light chain kinase|telokin
Full Nomenclature : myosin light chain kinase
GENEID : 4638
HGNC : 7590
MIM : 600922
Vega : OTTHUMG00000141304
Target GenBank: NM_005965

 

Reference Sequence Alignment

  

HsCD00039037        ------------------------------------------------------------
NM_053028.3         ------------------------------ATGGGGGATGTGAAGCTGGTTGCCTCGTCA
XM_005247494.1      ATGGCACCTGGCCAGCTGCCCAAGCAGACCATGGGGGATGTGAAGCTGGTTGCCTCGTCA
NM_053025.3         ------------------------------ATGGGGGATGTGAAGCTGGTTGCCTCGTCA
XM_005247492.1      ATGGCACCTGGCCAGCTGCCCAAGCAGACCATGGGGGATGTGAAGCTGGTTGCCTCGTCA
NM_053027.3         ------------------------------ATGGGGGATGTGAAGCTGGTTGCCTCGTCA
NM_053026.3         ------------------------------ATGGGGGATGTGAAGCTGGTTGCCTCGTCA
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CACATTTCCAAAACCTCCCTCAGTGTGGATCCCTCAAGAGTTGACTCCATGCCCCTGACA
XM_005247494.1      CACATTTCCAAAACCTCCCTCAGTGTGGATCCCTCAAGAGTTGACTCCATGCCCCTGACA
NM_053025.3         CACATTTCCAAAACCTCCCTCAGTGTGGATCCCTCAAGAGTTGACTCCATGCCCCTGACA
XM_005247492.1      CACATTTCCAAAACCTCCCTCAGTGTGGATCCCTCAAGAGTTGACTCCATGCCCCTGACA
NM_053027.3         CACATTTCCAAAACCTCCCTCAGTGTGGATCCCTCAAGAGTTGACTCCATGCCCCTGACA
NM_053026.3         CACATTTCCAAAACCTCCCTCAGTGTGGATCCCTCAAGAGTTGACTCCATGCCCCTGACA
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GAGGCCCCTGCTTTCATTTTGCCCCCTCGGAACCTCTGCATCAAAGAAGGAGCCACCGCC
XM_005247494.1      GAGGCCCCTGCTTTCATTTTGCCCCCTCGGAACCTCTGCATCAAAGAAGGAGCCACCGCC
NM_053025.3         GAGGCCCCTGCTTTCATTTTGCCCCCTCGGAACCTCTGCATCAAAGAAGGAGCCACCGCC
XM_005247492.1      GAGGCCCCTGCTTTCATTTTGCCCCCTCGGAACCTCTGCATCAAAGAAGGAGCCACCGCC
NM_053027.3         GAGGCCCCTGCTTTCATTTTGCCCCCTCGGAACCTCTGCATCAAAGAAGGAGCCACCGCC
NM_053026.3         GAGGCCCCTGCTTTCATTTTGCCCCCTCGGAACCTCTGCATCAAAGAAGGAGCCACCGCC
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         AAGTTCGAAGGGCGGGTCCGGGGTTACCCAGAGCCCCAGGTGACATGGCACAGAAACGGG
XM_005247494.1      AAGTTCGAAGGGCGGGTCCGGGGTTACCCAGAGCCCCAGGTGACATGGCACAGAAACGGG
NM_053025.3         AAGTTCGAAGGGCGGGTCCGGGGTTACCCAGAGCCCCAGGTGACATGGCACAGAAACGGG
XM_005247492.1      AAGTTCGAAGGGCGGGTCCGGGGTTACCCAGAGCCCCAGGTGACATGGCACAGAAACGGG
NM_053027.3         AAGTTCGAAGGGCGGGTCCGGGGTTACCCAGAGCCCCAGGTGACATGGCACAGAAACGGG
NM_053026.3         AAGTTCGAAGGGCGGGTCCGGGGTTACCCAGAGCCCCAGGTGACATGGCACAGAAACGGG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CAACCCATCACCAGCGGGGGCCGCTTCCTGCTGGATTGCGGCATCCGGGGGACTTTCAGC
XM_005247494.1      CAACCCATCACCAGCGGGGGCCGCTTCCTGCTGGATTGCGGCATCCGGGGGACTTTCAGC
NM_053025.3         CAACCCATCACCAGCGGGGGCCGCTTCCTGCTGGATTGCGGCATCCGGGGGACTTTCAGC
XM_005247492.1      CAACCCATCACCAGCGGGGGCCGCTTCCTGCTGGATTGCGGCATCCGGGGGACTTTCAGC
NM_053027.3         CAACCCATCACCAGCGGGGGCCGCTTCCTGCTGGATTGCGGCATCCGGGGGACTTTCAGC
NM_053026.3         CAACCCATCACCAGCGGGGGCCGCTTCCTGCTGGATTGCGGCATCCGGGGGACTTTCAGC
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CTTGTGATTCATGCTGTCCATGAGGAGGACAGGGGAAAGTATACCTGTGAAGCCACCAAT
XM_005247494.1      CTTGTGATTCATGCTGTCCATGAGGAGGACAGGGGAAAGTATACCTGTGAAGCCACCAAT
NM_053025.3         CTTGTGATTCATGCTGTCCATGAGGAGGACAGGGGAAAGTATACCTGTGAAGCCACCAAT
XM_005247492.1      CTTGTGATTCATGCTGTCCATGAGGAGGACAGGGGAAAGTATACCTGTGAAGCCACCAAT
NM_053027.3         CTTGTGATTCATGCTGTCCATGAGGAGGACAGGGGAAAGTATACCTGTGAAGCCACCAAT
NM_053026.3         CTTGTGATTCATGCTGTCCATGAGGAGGACAGGGGAAAGTATACCTGTGAAGCCACCAAT
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GGCAGTGGTGCTCGCCAGGTGACAGTGGAGTTGACAGTAGAAGGAAGTTTTGCGAAGCAG
XM_005247494.1      GGCAGTGGTGCTCGCCAGGTGACAGTGGAGTTGACAGTAGAAGGAAGTTTTGCGAAGCAG
NM_053025.3         GGCAGTGGTGCTCGCCAGGTGACAGTGGAGTTGACAGTAGAAGGAAGTTTTGCGAAGCAG
XM_005247492.1      GGCAGTGGTGCTCGCCAGGTGACAGTGGAGTTGACAGTAGAAGGAAGTTTTGCGAAGCAG
NM_053027.3         GGCAGTGGTGCTCGCCAGGTGACAGTGGAGTTGACAGTAGAAGGAAGTTTTGCGAAGCAG
NM_053026.3         GGCAGTGGTGCTCGCCAGGTGACAGTGGAGTTGACAGTAGAAGGAAGTTTTGCGAAGCAG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CTTGGTCAGCCTGTTGTTTCCAAAACCTTAGGGGATAGATTTTCAGCTCCAGCAGTGGAG
XM_005247494.1      CTTGGTCAGCCTGTTGTTTCCAAAACCTTAGGGGATAGATTTTCAGCTCCAGCAGTGGAG
NM_053025.3         CTTGGTCAGCCTGTTGTTTCCAAAACCTTAGGGGATAGATTTTCAGCTCCAGCAGTGGAG
XM_005247492.1      CTTGGTCAGCCTGTTGTTTCCAAAACCTTAGGGGATAGATTTTCAGCTCCAGCAGTGGAG
NM_053027.3         CTTGGTCAGCCTGTTGTTTCCAAAACCTTAGGGGATAGATTTTCAGCTCCAGCAGTGGAG
NM_053026.3         CTTGGTCAGCCTGTTGTTTCCAAAACCTTAGGGGATAGATTTTCAGCTCCAGCAGTGGAG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         ACCCGTCCTAGCATCTGGGGGGAGTGCCCACCAAAGTTTGCTACCAAGCTGGGCCGAGTT
XM_005247494.1      ACCCGTCCTAGCATCTGGGGGGAGTGCCCACCAAAGTTTGCTACCAAGCTGGGCCGAGTT
NM_053025.3         ACCCGTCCTAGCATCTGGGGGGAGTGCCCACCAAAGTTTGCTACCAAGCTGGGCCGAGTT
XM_005247492.1      ACCCGTCCTAGCATCTGGGGGGAGTGCCCACCAAAGTTTGCTACCAAGCTGGGCCGAGTT
NM_053027.3         ACCCGTCCTAGCATCTGGGGGGAGTGCCCACCAAAGTTTGCTACCAAGCTGGGCCGAGTT
NM_053026.3         ACCCGTCCTAGCATCTGGGGGGAGTGCCCACCAAAGTTTGCTACCAAGCTGGGCCGAGTT
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GTGGTCAAAGAAGGACAGATGGGACGATTCTCCTGCAAGATCACTGGCCGGCCCCAACCG
XM_005247494.1      GTGGTCAAAGAAGGACAGATGGGACGATTCTCCTGCAAGATCACTGGCCGGCCCCAACCG
NM_053025.3         GTGGTCAAAGAAGGACAGATGGGACGATTCTCCTGCAAGATCACTGGCCGGCCCCAACCG
XM_005247492.1      GTGGTCAAAGAAGGACAGATGGGACGATTCTCCTGCAAGATCACTGGCCGGCCCCAACCG
NM_053027.3         GTGGTCAAAGAAGGACAGATGGGACGATTCTCCTGCAAGATCACTGGCCGGCCCCAACCG
NM_053026.3         GTGGTCAAAGAAGGACAGATGGGACGATTCTCCTGCAAGATCACTGGCCGGCCCCAACCG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CAGGTCACCTGGCTCAAGGGAAATGTTCCACTGCAGCCGAGTGCCCGTGTGTCTGTGTCT
XM_005247494.1      CAGGTCACCTGGCTCAAGGGAAATGTTCCACTGCAGCCGAGTGCCCGTGTGTCTGTGTCT
NM_053025.3         CAGGTCACCTGGCTCAAGGGAAATGTTCCACTGCAGCCGAGTGCCCGTGTGTCTGTGTCT
XM_005247492.1      CAGGTCACCTGGCTCAAGGGAAATGTTCCACTGCAGCCGAGTGCCCGTGTGTCTGTGTCT
NM_053027.3         CAGGTCACCTGGCTCAAGGGAAATGTTCCACTGCAGCCGAGTGCCCGTGTGTCTGTGTCT
NM_053026.3         CAGGTCACCTGGCTCAAGGGAAATGTTCCACTGCAGCCGAGTGCCCGTGTGTCTGTGTCT
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GAGAAGAACGGCATGCAGGTTCTGGAAATCCATGGAGTCAACCAAGATGACGTGGGAGTG
XM_005247494.1      GAGAAGAACGGCATGCAGGTTCTGGAAATCCATGGAGTCAACCAAGATGACGTGGGAGTG
NM_053025.3         GAGAAGAACGGCATGCAGGTTCTGGAAATCCATGGAGTCAACCAAGATGACGTGGGAGTG
XM_005247492.1      GAGAAGAACGGCATGCAGGTTCTGGAAATCCATGGAGTCAACCAAGATGACGTGGGAGTG
NM_053027.3         GAGAAGAACGGCATGCAGGTTCTGGAAATCCATGGAGTCAACCAAGATGACGTGGGAGTG
NM_053026.3         GAGAAGAACGGCATGCAGGTTCTGGAAATCCATGGAGTCAACCAAGATGACGTGGGAGTG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         TACACGTGCCTGGTGGTGAACGGGTCGGGGAAGGCCTCGATGTCAGCTGAACTTTCCATC
XM_005247494.1      TACACGTGCCTGGTGGTGAACGGGTCGGGGAAGGCCTCGATGTCAGCTGAACTTTCCATC
NM_053025.3         TACACGTGCCTGGTGGTGAACGGGTCGGGGAAGGCCTCGATGTCAGCTGAACTTTCCATC
XM_005247492.1      TACACGTGCCTGGTGGTGAACGGGTCGGGGAAGGCCTCGATGTCAGCTGAACTTTCCATC
NM_053027.3         TACACGTGCCTGGTGGTGAACGGGTCGGGGAAGGCCTCGATGTCAGCTGAACTTTCCATC
NM_053026.3         TACACGTGCCTGGTGGTGAACGGGTCGGGGAAGGCCTCGATGTCAGCTGAACTTTCCATC
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CAAGGTTTGGACAGTGCCAATAGGTCATTTGTGAGAGAAACAAAAGCCACCAATTCAGAT
XM_005247494.1      CAAGGTTTGGACAGTGCCAATAGGTCATTTGTGAGAGAAACAAAAGCCACCAATTCAGAT
NM_053025.3         CAAGGTTTGGACAGTGCCAATAGGTCATTTGTGAGAGAAACAAAAGCCACCAATTCAGAT
XM_005247492.1      CAAGGTTTGGACAGTGCCAATAGGTCATTTGTGAGAGAAACAAAAGCCACCAATTCAGAT
NM_053027.3         CAAGGTTTGGACAGTGCCAATAGGTCATTTGTGAGAGAAACAAAAGCCACCAATTCAGAT
NM_053026.3         CAAGGTTTGGACAGTGCCAATAGGTCATTTGTGAGAGAAACAAAAGCCACCAATTCAGAT
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GTCAGGAAAGAGGTGACCAATGTAATCTCAAAGGAGTCGAAGCTGGACAGTCTGGAGGCT
XM_005247494.1      GTCAGGAAAGAGGTGACCAATGTAATCTCAAAGGAGTCGAAGCTGGACAGTCTGGAGGCT
NM_053025.3         GTCAGGAAAGAGGTGACCAATGTAATCTCAAAGGAGTCGAAGCTGGACAGTCTGGAGGCT
XM_005247492.1      GTCAGGAAAGAGGTGACCAATGTAATCTCAAAGGAGTCGAAGCTGGACAGTCTGGAGGCT
NM_053027.3         GTCAGGAAAGAGGTGACCAATGTAATCTCAAAGGAGTCGAAGCTGGACAGTCTGGAGGCT
NM_053026.3         GTCAGGAAAGAGGTGACCAATGTAATCTCAAAGGAGTCGAAGCTGGACAGTCTGGAGGCT
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GCAGCCAAAAGCAAGAACTGCTCCAGCCCCCAGAGAGGTGGCTCCCCACCCTGGGCTGCA
XM_005247494.1      GCAGCCAAAAGCAAGAACTGCTCCAGCCCCCAGAGAGGTGGCTCCCCACCCTGGGCTGCA
NM_053025.3         GCAGCCAAAAGCAAGAACTGCTCCAGCCCCCAGAGAGGTGGCTCCCCACCCTGGGCTGCA
XM_005247492.1      GCAGCCAAAAGCAAGAACTGCTCCAGCCCCCAGAGAGGTGGCTCCCCACCCTGGGCTGCA
NM_053027.3         GCAGCCAAAAGCAAGAACTGCTCCAGCCCCCAGAGAGGTGGCTCCCCACCCTGGGCTGCA
NM_053026.3         GCAGCCAAAAGCAAGAACTGCTCCAGCCCCCAGAGAGGTGGCTCCCCACCCTGGGCTGCA
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         AACAGCCAGCCTCAGCCCCCAAGGGAGTCCAAGCTGGAGTCATGCAAGGACTCGCCCAGA
XM_005247494.1      AACAGCCAGCCTCAGCCCCCAAGGGAGTCCAAGCTGGAGTCATGCAAGGACTCGCCCAGA
NM_053025.3         AACAGCCAGCCTCAGCCCCCAAGGGAGTCCAAGCTGGAGTCATGCAAGGACTCGCCCAGA
XM_005247492.1      AACAGCCAGCCTCAGCCCCCAAGGGAGTCCAAGCTGGAGTCATGCAAGGACTCGCCCAGA
NM_053027.3         AACAGCCAGCCTCAGCCCCCAAGGGAGTCCAAGCTGGAGTCATGCAAGGACTCGCCCAGA
NM_053026.3         AACAGCCAGCCTCAGCCCCCAAGGGAGTCCAAGCTGGAGTCATGCAAGGACTCGCCCAGA
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         ACGGCCCCGCAGACCCCGGTCCTTCAGAAGACTTCCAGCTCCATCACCCTGCAGGCCGCA
XM_005247494.1      ACGGCCCCGCAGACCCCGGTCCTTCAGAAGACTTCCAGCTCCATCACCCTGCAGGCCGCA
NM_053025.3         ACGGCCCCGCAGACCCCGGTCCTTCAGAAGACTTCCAGCTCCATCACCCTGCAGGCCGCA
XM_005247492.1      ACGGCCCCGCAGACCCCGGTCCTTCAGAAGACTTCCAGCTCCATCACCCTGCAGGCCGCA
NM_053027.3         ACGGCCCCGCAGACCCCGGTCCTTCAGAAGACTTCCAGCTCCATCACCCTGCAGGCCGCA
NM_053026.3         ACGGCCCCGCAGACCCCGGTCCTTCAGAAGACTTCCAGCTCCATCACCCTGCAGGCCGCA
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         AGAGTTCAGCCGGAACCAAGAGCACCAGGCCTGGGGGTCCTATCACCTTCTGGAGAAGAG
XM_005247494.1      AGAGTTCAGCCGGAACCAAGAGCACCAGGCCTGGGGGTCCTATCACCTTCTGGAGAAGAG
NM_053025.3         AGAGTTCAGCCGGAACCAAGAGCACCAGGCCTGGGGGTCCTATCACCTTCTGGAGAAGAG
XM_005247492.1      AGAGTTCAGCCGGAACCAAGAGCACCAGGCCTGGGGGTCCTATCACCTTCTGGAGAAGAG
NM_053027.3         AGAGTTCAGCCGGAACCAAGAGCACCAGGCCTGGGGGTCCTATCACCTTCTGGAGAAGAG
NM_053026.3         AGAGTTCAGCCGGAACCAAGAGCACCAGGCCTGGGGGTCCTATCACCTTCTGGAGAAGAG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         AGGAAGAGGCCAGCTCCTCCCCGTCCAGCCACCTTCCCCACCAGGCAGCCTGGCCTGGGG
XM_005247494.1      AGGAAGAGGCCAGCTCCTCCCCGTCCAGCCACCTTCCCCACCAGGCAGCCTGGCCTGGGG
NM_053025.3         AGGAAGAGGCCAGCTCCTCCCCGTCCAGCCACCTTCCCCACCAGGCAGCCTGGCCTGGGG
XM_005247492.1      AGGAAGAGGCCAGCTCCTCCCCGTCCAGCCACCTTCCCCACCAGGCAGCCTGGCCTGGGG
NM_053027.3         AGGAAGAGGCCAGCTCCTCCCCGTCCAGCCACCTTCCCCACCAGGCAGCCTGGCCTGGGG
NM_053026.3         AGGAAGAGGCCAGCTCCTCCCCGTCCAGCCACCTTCCCCACCAGGCAGCCTGGCCTGGGG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         AGCCAAGATGTTGTGAGCAAGGCTGCTAACAGGAGAATCCCCATGGAGGGCCAGAGGGAT
XM_005247494.1      AGCCAAGATGTTGTGAGCAAGGCTGCTAACAGGAGAATCCCCATGGAGGGCCAGAGGGAT
NM_053025.3         AGCCAAGATGTTGTGAGCAAGGCTGCTAACAGGAGAATCCCCATGGAGGGCCAGAGGGAT
XM_005247492.1      AGCCAAGATGTTGTGAGCAAGGCTGCTAACAGGAGAATCCCCATGGAGGGCCAGAGGGAT
NM_053027.3         AGCCAAGATGTTGTGAGCAAGGCTGCTAACAGGAGAATCCCCATGGAGGGCCAGAGGGAT
NM_053026.3         AGCCAAGATGTTGTGAGCAAGGCTGCTAACAGGAGAATCCCCATGGAGGGCCAGAGGGAT
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         TCAGCATTCCCCAAATTTGAGAGCAAGCCCCAAAGCCAGGAGGTCAAGGAAAATCAAACT
XM_005247494.1      TCAGCATTCCCCAAATTTGAGAGCAAGCCCCAAAGCCAGGAGGTCAAGGAAAATCAAACT
NM_053025.3         TCAGCATTCCCCAAATTTGAGAGCAAGCCCCAAAGCCAGGAGGTCAAGGAAAATCAAACT
XM_005247492.1      TCAGCATTCCCCAAATTTGAGAGCAAGCCCCAAAGCCAGGAGGTCAAGGAAAATCAAACT
NM_053027.3         TCAGCATTCCCCAAATTTGAGAGCAAGCCCCAAAGCCAGGAGGTCAAGGAAAATCAAACT
NM_053026.3         TCAGCATTCCCCAAATTTGAGAGCAAGCCCCAAAGCCAGGAGGTCAAGGAAAATCAAACT
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GTCAAGTTCAGATGTGAAG-----------------------------------------
XM_005247494.1      GTCAAGTTCAGATGT---------------------------------------------
NM_053025.3         GTCAAGTTCAGATGTGAAGTTTCCGGGATTCCAAAGCCTGAAGTGGCCTGGTTCCTGGAA
XM_005247492.1      GTCAAGTTCAGATGTGAAGTTTCCGGGATTCCAAAGCCTGAAGTGGCCTGGTTCCTGGAA
NM_053027.3         GTCAAGTTCAGATGTGAAGTTTCCGGGATTCCAAAGCCTGAAGTGGCCTGGTTCCTGGAA
NM_053026.3         GTCAAGTTCAGATGT---------------------------------------------
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         ------------------------------------------------------------
XM_005247494.1      ------------------------------------------------------------
NM_053025.3         GGCACCCCCGTGAGGAGACAGGAAGGCAGCATTGAGGTTTATGAAGATGCTGGCTCCCAT
XM_005247492.1      GGCACCCCCGTGAGGAGACAGGAAGGCAGCATTGAGGTTTATGAAGATGCTGGCTCCCAT
NM_053027.3         GGCACCCCCGTGAGGAGACAGGAAGGCAGCATTGAGGTTTATGAAGATGCTGGCTCCCAT
NM_053026.3         ------------------------------------------------------------
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         ------------------------------------------------------------
XM_005247494.1      ------------------------------------------------------------
NM_053025.3         TACCTCTGCCTGCTGAAAGCCCGGACCAGGGACAGTGGGACATACAGCTGCACTGCTTCC
XM_005247492.1      TACCTCTGCCTGCTGAAAGCCCGGACCAGGGACAGTGGGACATACAGCTGCACTGCTTCC
NM_053027.3         TACCTCTGCCTGCTGAAAGCCCGGACCAGGGACAGTGGGACATACAGCTGCACTGCTTCC
NM_053026.3         ------------------------------------------------------------
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         ----------------------------------------------GGCTTGCCGTGATG
XM_005247494.1      ------------------------------------------GAAGGGCTTGCCGTGATG
NM_053025.3         AACGCCCAAGGCCAGCTGTCCTGTAGCTGGACCCTCCAAGTGGAAAGGCTTGCCGTGATG
XM_005247492.1      AACGCCCAAGGCCAGCTGTCCTGTAGCTGGACCCTCCAAGTGGAAAGGCTTGCCGTGATG
NM_053027.3         AACGCCCAAGGCCAGCTGTCCTGTAGCTGGACCCTCCAAGTGGAAAGGCTTGCCGTGATG
NM_053026.3         ------------------------------------------GAAGGGCTTGCCGTGATG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GAGGTGGCCCCCTCCTTCTCCAGTGTCCTGAAGGACTGCGCTGTTATTGAGGGCCAGGAT
XM_005247494.1      GAGGTGGCCCCCTCCTTCTCCAGTGTCCTGAAGGACTGCGCTGTTATTGAGGGCCAGGAT
NM_053025.3         GAGGTGGCCCCCTCCTTCTCCAGTGTCCTGAAGGACTGCGCTGTTATTGAGGGCCAGGAT
XM_005247492.1      GAGGTGGCCCCCTCCTTCTCCAGTGTCCTGAAGGACTGCGCTGTTATTGAGGGCCAGGAT
NM_053027.3         GAGGTGGCCCCCTCCTTCTCCAGTGTCCTGAAGGACTGCGCTGTTATTGAGGGCCAGGAT
NM_053026.3         GAGGTGGCCCCCTCCTTCTCCAGTGTCCTGAAGGACTGCGCTGTTATTGAGGGCCAGGAT
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         TTTGTGCTGCAGTGCTCCGTACGGGGGACCCCAGTGCCCCGGATCACTTGGCTGCTGAAT
XM_005247494.1      TTTGTGCTGCAGTGCTCCGTACGGGGGACCCCAGTGCCCCGGATCACTTGGCTGCTGAAT
NM_053025.3         TTTGTGCTGCAGTGCTCCGTACGGGGGACCCCAGTGCCCCGGATCACTTGGCTGCTGAAT
XM_005247492.1      TTTGTGCTGCAGTGCTCCGTACGGGGGACCCCAGTGCCCCGGATCACTTGGCTGCTGAAT
NM_053027.3         TTTGTGCTGCAGTGCTCCGTACGGGGGACCCCAGTGCCCCGGATCACTTGGCTGCTGAAT
NM_053026.3         TTTGTGCTGCAGTGCTCCGTACGGGGGACCCCAGTGCCCCGGATCACTTGGCTGCTGAAT
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GGGCAGCCCATCCAGTACGCTCGCTCCACCTGCGAGGCCGGCGTGGCTGAGCTCCACATC
XM_005247494.1      GGGCAGCCCATCCAGTACGCTCGCTCCACCTGCGAGGCCGGCGTGGCTGAGCTCCACATC
NM_053025.3         GGGCAGCCCATCCAGTACGCTCGCTCCACCTGCGAGGCCGGCGTGGCTGAGCTCCACATC
XM_005247492.1      GGGCAGCCCATCCAGTACGCTCGCTCCACCTGCGAGGCCGGCGTGGCTGAGCTCCACATC
NM_053027.3         GGGCAGCCCATCCAGTACGCTCGCTCCACCTGCGAGGCCGGCGTGGCTGAGCTCCACATC
NM_053026.3         GGGCAGCCCATCCAGTACGCTCGCTCCACCTGCGAGGCCGGCGTGGCTGAGCTCCACATC
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CAGGATGCCCTGCCGGAGGACCATGGCACCTACACCTGCCTAGCTGAGAATGCCTTGGGG
XM_005247494.1      CAGGATGCCCTGCCGGAGGACCATGGCACCTACACCTGCCTAGCTGAGAATGCCTTGGGG
NM_053025.3         CAGGATGCCCTGCCGGAGGACCATGGCACCTACACCTGCCTAGCTGAGAATGCCTTGGGG
XM_005247492.1      CAGGATGCCCTGCCGGAGGACCATGGCACCTACACCTGCCTAGCTGAGAATGCCTTGGGG
NM_053027.3         CAGGATGCCCTGCCGGAGGACCATGGCACCTACACCTGCCTAGCTGAGAATGCCTTGGGG
NM_053026.3         CAGGATGCCCTGCCGGAGGACCATGGCACCTACACCTGCCTAGCTGAGAATGCCTTGGGG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CAGGTGTCCTGCAGCGCCTGGGTCACCGTCCATGAAAAGAAGAGTAGCAGGAAGAGTGAG
XM_005247494.1      CAGGTGTCCTGCAGCGCCTGGGTCACCGTCCATGAAAAGAAGAGTAGCAGGAAGAGTGAG
NM_053025.3         CAGGTGTCCTGCAGCGCCTGGGTCACCGTCCATGAAAAGAAGAGTAGCAGGAAGAGTGAG
XM_005247492.1      CAGGTGTCCTGCAGCGCCTGGGTCACCGTCCATGAAAAGAAGAGTAGCAGGAAGAGTGAG
NM_053027.3         CAGGTGTCCTGCAGCGCCTGGGTCACCGTCCATGAAAAGAAGAGTAGCAGGAAGAGTGAG
NM_053026.3         CAGGTGTCCTGCAGCGCCTGGGTCACCGTCCATGAAAAGAAGAGTAGCAGGAAGAGTGAG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         TACCTTCTGCCTGTGGCTCCCAGCAAGCCCACTGCACCCATCTTCCTGCAGGGCCTCTCT
XM_005247494.1      TACCTTCTGCCTGTGGCTCCCAGCAAGCCCACTGCACCCATCTTCCTGCAGGGCCTCTCT
NM_053025.3         TACCTTCTGCCTGTGGCTCCCAGCAAGCCCACTGCACCCATCTTCCTGCAGGGCCTCTCT
XM_005247492.1      TACCTTCTGCCTGTGGCTCCCAGCAAGCCCACTGCACCCATCTTCCTGCAGGGCCTCTCT
NM_053027.3         TACCTTCTGCCTGTGGCTCCCAGCAAGCCCACTGCACCCATCTTCCTGCAGGGCCTCTCT
NM_053026.3         TACCTTCTGCCTGTGGCTCCCAGCAAGCCCACTGCACCCATCTTCCTGCAGGGCCTCTCT
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GATCTCAAAGTCATGGATGGAAGCCAGGTCACTATGACTGTCCAAGTGTCAGGGAATCCA
XM_005247494.1      GATCTCAAAGTCATGGATGGAAGCCAGGTCACTATGACTGTCCAAGTGTCAGGGAATCCA
NM_053025.3         GATCTCAAAGTCATGGATGGAAGCCAGGTCACTATGACTGTCCAAGTGTCAGGGAATCCA
XM_005247492.1      GATCTCAAAGTCATGGATGGAAGCCAGGTCACTATGACTGTCCAAGTGTCAGGGAATCCA
NM_053027.3         GATCTCAAAGTCATGGATGGAAGCCAGGTCACTATGACTGTCCAAGTGTCAGGGAATCCA
NM_053026.3         GATCTCAAAGTCATGGATGGAAGCCAGGTCACTATGACTGTCCAAGTGTCAGGGAATCCA
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CCCCCTGAAGTCATCTGGCTGCACAATGGGAATGAGATCCAAGAGTCAGAGGACTTCCAC
XM_005247494.1      CCCCCTGAAGTCATCTGGCTGCACAATGGGAATGAGATCCAAGAGTCAGAGGACTTCCAC
NM_053025.3         CCCCCTGAAGTCATCTGGCTGCACAATGGGAATGAGATCCAAGAGTCAGAGGACTTCCAC
XM_005247492.1      CCCCCTGAAGTCATCTGGCTGCACAATGGGAATGAGATCCAAGAGTCAGAGGACTTCCAC
NM_053027.3         CCCCCTGAAGTCATCTGGCTGCACAATGGGAATGAGATCCAAGAGTCAGAGGACTTCCAC
NM_053026.3         CCCCCTGAAGTCATCTGGCTGCACAATGGGAATGAGATCCAAGAGTCAGAGGACTTCCAC
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         TTTGAACAGAGAGGAACTCAGCACAGCCTTTGTATCCAGGAAGTGTTCCCGGAGGACACG
XM_005247494.1      TTTGAACAGAGAGGAACTCAGCACAGCCTTTGTATCCAGGAAGTGTTCCCGGAGGACACG
NM_053025.3         TTTGAACAGAGAGGAACTCAGCACAGCCTTTGTATCCAGGAAGTGTTCCCGGAGGACACG
XM_005247492.1      TTTGAACAGAGAGGAACTCAGCACAGCCTTTGTATCCAGGAAGTGTTCCCGGAGGACACG
NM_053027.3         TTTGAACAGAGAGGAACTCAGCACAGCCTTTGTATCCAGGAAGTGTTCCCGGAGGACACG
NM_053026.3         TTTGAACAGAGAGGAACTCAGCACAGCCTTTGTATCCAGGAAGTGTTCCCGGAGGACACG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GGCACGTACACCTGCGAGGCCTGGAACAGCGCTGGAGAGGTCCGCACCCAGGCCGTGCTC
XM_005247494.1      GGCACGTACACCTGCGAGGCCTGGAACAGCGCTGGAGAGGTCCGCACCCAGGCCGTGCTC
NM_053025.3         GGCACGTACACCTGCGAGGCCTGGAACAGCGCTGGAGAGGTCCGCACCCAGGCCGTGCTC
XM_005247492.1      GGCACGTACACCTGCGAGGCCTGGAACAGCGCTGGAGAGGTCCGCACCCAGGCCGTGCTC
NM_053027.3         GGCACGTACACCTGCGAGGCCTGGAACAGCGCTGGAGAGGTCCGCACCCAGGCCGTGCTC
NM_053026.3         GGCACGTACACCTGCGAGGCCTGGAACAGCGCTGGAGAGGTCCGCACCCAGGCCGTGCTC
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         ACGGTACAAGAGCCTCACGATGGCACCCAGCCCTGGTTCATCAGTAAGCCTCGCTCAGTG
XM_005247494.1      ACGGTACAAGAGCCTCACGATGGCACCCAGCCCTGGTTCATCAGTAAGCCTCGCTCAGTG
NM_053025.3         ACGGTACAAGAGCCTCACGATGGCACCCAGCCCTGGTTCATCAGTAAGCCTCGCTCAGTG
XM_005247492.1      ACGGTACAAGAGCCTCACGATGGCACCCAGCCCTGGTTCATCAGTAAGCCTCGCTCAGTG
NM_053027.3         ACGGTACAAGAGCCTCACGATGGCACCCAGCCCTGGTTCATCAGTAAGCCTCGCTCAGTG
NM_053026.3         ACGGTACAAGAGCCTCACGATGGCACCCAGCCCTGGTTCATCAGTAAGCCTCGCTCAGTG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         ACAGCCTCCCTGGGCCAGAGTGTCCTCATCTCCTGCGCCATAGCTGGTGACCCCTTTCCT
XM_005247494.1      ACAGCCTCCCTGGGCCAGAGTGTCCTCATCTCCTGCGCCATAGCTGGTGACCCCTTTCCT
NM_053025.3         ACAGCCTCCCTGGGCCAGAGTGTCCTCATCTCCTGCGCCATAGCTGGTGACCCCTTTCCT
XM_005247492.1      ACAGCCTCCCTGGGCCAGAGTGTCCTCATCTCCTGCGCCATAGCTGGTGACCCCTTTCCT
NM_053027.3         ACAGCCTCCCTGGGCCAGAGTGTCCTCATCTCCTGCGCCATAGCTGGTGACCCCTTTCCT
NM_053026.3         ACAGCCTCCCTGGGCCAGAGTGTCCTCATCTCCTGCGCCATAGCTGGTGACCCCTTTCCT
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         ACCGTGCACTGGCTCAGAGATGGCAAAGCCCTCTGCAAAGACACTGGCCACTTCGAGGTG
XM_005247494.1      ACCGTGCACTGGCTCAGAGATGGCAAAGCCCTCTGCAAAGACACTGGCCACTTCGAGGTG
NM_053025.3         ACCGTGCACTGGCTCAGAGATGGCAAAGCCCTCTGCAAAGACACTGGCCACTTCGAGGTG
XM_005247492.1      ACCGTGCACTGGCTCAGAGATGGCAAAGCCCTCTGCAAAGACACTGGCCACTTCGAGGTG
NM_053027.3         ACCGTGCACTGGCTCAGAGATGGCAAAGCCCTCTGCAAAGACACTGGCCACTTCGAGGTG
NM_053026.3         ACCGTGCACTGGCTCAGAGATGGCAAAGCCCTCTGCAAAGACACTGGCCACTTCGAGGTG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CTTCAGAATGAGGACGTGTTCACCCTGGTTCTAAAGAAGGTGCAGCCCTGGCATGCCGGC
XM_005247494.1      CTTCAGAATGAGGACGTGTTCACCCTGGTTCTAAAGAAGGTGCAGCCCTGGCATGCCGGC
NM_053025.3         CTTCAGAATGAGGACGTGTTCACCCTGGTTCTAAAGAAGGTGCAGCCCTGGCATGCCGGC
XM_005247492.1      CTTCAGAATGAGGACGTGTTCACCCTGGTTCTAAAGAAGGTGCAGCCCTGGCATGCCGGC
NM_053027.3         CTTCAGAATGAGGACGTGTTCACCCTGGTTCTAAAGAAGGTGCAGCCCTGGCATGCCGGC
NM_053026.3         CTTCAGAATGAGGACGTGTTCACCCTGGTTCTAAAGAAGGTGCAGCCCTGGCATGCCGGC
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CAGTATGAGATCCTGCTCAAGAACCGGGTTGGCGAATGCAGTTGCCAGGTGTCACTGATG
XM_005247494.1      CAGTATGAGATCCTGCTCAAGAACCGGGTTGGCGAATGCAGTTGCCAGGTGTCACTGATG
NM_053025.3         CAGTATGAGATCCTGCTCAAGAACCGGGTTGGCGAATGCAGTTGCCAGGTGTCACTGATG
XM_005247492.1      CAGTATGAGATCCTGCTCAAGAACCGGGTTGGCGAATGCAGTTGCCAGGTGTCACTGATG
NM_053027.3         CAGTATGAGATCCTGCTCAAGAACCGGGTTGGCGAATGCAGTTGCCAGGTGTCACTGATG
NM_053026.3         CAGTATGAGATCCTGCTCAAGAACCGGGTTGGCGAATGCAGTTGCCAGGTGTCACTGATG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CTACAGAACAGCTCTGCCAGAGCCCTTCCACGGGGGAGGGAGCCTGCCAGCTGCGAGGAC
XM_005247494.1      CTACAGAACAGCTCTGCCAGAGCCCTTCCACGGGGGAGGGAGCCTGCCAGCTGCGAGGAC
NM_053025.3         CTACAGAACAGCTCTGCCAGAGCCCTTCCACGGGGGAGGGAGCCTGCCAGCTGCGAGGAC
XM_005247492.1      CTACAGAACAGCTCTGCCAGAGCCCTTCCACGGGGGAGGGAGCCTGCCAGCTGCGAGGAC
NM_053027.3         CTACAGAACAGCTCTGCCAGAGCCCTTCCACGGGGGAGGGAGCCTGCCAGCTGCGAGGAC
NM_053026.3         CTACAGAACAGCTCTGCCAGAGCCCTTCCACGGGGGAGGGAGCCTGCCAGCTGCGAGGAC
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CTCTGTGGTGGAGGAGTTGGTGCTGATGGTGGTGGTAGTGACCGCTATGGGTCCCTGAGG
XM_005247494.1      CTCTGTGGTGGAGGAGTTGGTGCTGATGGTGGTGGTAGTGACCGCTATGGGTCCCTGAGG
NM_053025.3         CTCTGTGGTGGAGGAGTTGGTGCTGATGGTGGTGGTAGTGACCGCTATGGGTCCCTGAGG
XM_005247492.1      CTCTGTGGTGGAGGAGTTGGTGCTGATGGTGGTGGTAGTGACCGCTATGGGTCCCTGAGG
NM_053027.3         CTCTGTGGTGGAGGAGTTGGTGCTGATGGTGGTGGTAGTGACCGCTATGGGTCCCTGAGG
NM_053026.3         CTCTGTGGTGGAGGAGTTGGTGCTGATGGTGGTGGTAGTGACCGCTATGGGTCCCTGAGG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         CCTGGCTGGCCAGCAAGAGGGCAGGGTTGGCTAGAGGAGGAAGACGGCGAGGACGTGCGA
XM_005247494.1      CCTGGCTGGCCAGCAAGAGGGCAGGGTTGGCTAGAGGAGGAAGACGGCGAGGACGTGCGA
NM_053025.3         CCTGGCTGGCCAGCAAGAGGGCAGGGTTGGCTAGAGGAGGAAGACGGCGAGGACGTGCGA
XM_005247492.1      CCTGGCTGGCCAGCAAGAGGGCAGGGTTGGCTAGAGGAGGAAGACGGCGAGGACGTGCGA
NM_053027.3         CCTGGCTGGCCAGCAAGAGGGCAGGGTTGGCTAGAGGAGGAAGACGGCGAGGACGTGCGA
NM_053026.3         CCTGGCTGGCCAGCAAGAGGGCAGGGTTGGCTAGAGGAGGAAGACGGCGAGGACGTGCGA
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GGGGTGCTGAAGAGGCGCGTGGAGACGAGGCAGCACACTGAGGAGGCGATCCGCCAGCAG
XM_005247494.1      GGGGTGCTGAAGAGGCGCGTGGAGACGAGGCAGCACACTGAGGAGGCGATCCGCCAGCAG
NM_053025.3         GGGGTGCTGAAGAGGCGCGTGGAGACGAGGCAGCACACTGAGGAGGCGATCCGCCAGCAG
XM_005247492.1      GGGGTGCTGAAGAGGCGCGTGGAGACGAGGCAGCACACTGAGGAGGCGATCCGCCAGCAG
NM_053027.3         GGGGTGCTGAAGAGGCGCGTGGAGACGAGGCAGCACACTGAGGAGGCGATCCGCCAGCAG
NM_053026.3         GGGGTGCTGAAGAGGCGCGTGGAGACGAGGCAGCACACTGAGGAGGCGATCCGCCAGCAG
                                                                                

HsCD00039037        ------------------------------------------------------------
NM_053028.3         GAGGTGGAGCAGCTGGACTTCCGAGACCTCCTGGGGAAGAAGGTGAGTACAAAGACCCTA
XM_005247494.1      GAGGTGGAGCAGCTGGACTTCCGAGACCTCCTGGGGAAGAAGGTGAGTACAAAGACCCTA
NM_053025.3         GAGGTGGAGCAGCTGGACTTCCGAGACCTCCTGGGGAAGAAGGTGAGTACAAAGACCCTA
XM_005247492.1      GAGGTGGAGCAGCTGGACTTCCGAGACCTCCTGGGGAAGAAGGTGAGTACAAAGACCCTA
NM_053027.3         GAGGTGGAGCAGCTGGACTTCCGAGACCTCCTGGGGAAGAAGGTGAGTACAAAGACCCTA
NM_053026.3         GAGGTGGAGCAGCTGGACTTCCGAGACCTCCTGGGGAAGAAGGTGAGTACAAAGACCCTA
                                                                                

HsCD00039037        ------------------------------------ATGGATTTCCGTGCCAACCTGCAG
NM_053028.3         TCGGAAGACGACCTGAAGGAGATCCCAGCCGAGCAGATGGATTTCCGTGCCAACCTGCAG
XM_005247494.1      TCGGAAGACGACCTGAAGGAGATCCCAGCCGAGCAGATGGATTTCCGTGCCAACCTGCAG
NM_053025.3         TCGGAAGACGACCTGAAGGAGATCCCAGCCGAGCAGATGGATTTCCGTGCCAACCTGCAG
XM_005247492.1      TCGGAAGACGACCTGAAGGAGATCCCAGCCGAGCAGATGGATTTCCGTGCCAACCTGCAG
NM_053027.3         TCGGAAGACGACCTGAAGGAGATCCCAGCCGAGCAGATGGATTTCCGTGCCAACCTGCAG
NM_053026.3         TCGGAAGACGACCTGAAGGAGATCCCAGCCGAGCAGATGGATTTCCGTGCCAACCTGCAG
                                                        ************************

HsCD00039037        CGGCAAGTGAAGCCAAAGACTGTGTCTGAGGAAGAGAGGAAGGTGCACAGCCCCCAGCAG
NM_053028.3         CGGCAAGTGAAGCCAAAGACTGTGTCTGAGGAAGAGAGGAAGGTGCACAGCCCCCAGCAG
XM_005247494.1      CGGCAAGTGAAGCCAAAGACTGTGTCTGAGGAAGAGAGGAAGGTGCACAGCCCCCAGCAG
NM_053025.3         CGGCAAGTGAAGCCAAAGACTGTGTCTGAGGAAGAGAGGAAGGTGCACAGCCCCCAGCAG
XM_005247492.1      CGGCAAGTGAAGCCAAAGACTGTGTCTGAGGAAGAGAGGAAGGTGCACAGCCCCCAGCAG
NM_053027.3         CGGCAAGTGAAGCCAAAGACTGTGTCTGAGGAAGAGAGGAAGGTGCACAGCCCCCAGCAG
NM_053026.3         CGGCAAGTGAAGCCAAAGACTGTGTCTGAGGAAGAGAGGAAGGTGCACAGCCCCCAGCAG
                    ************************************************************

HsCD00039037        GTCGATTTTCGCTCTGTCCTGGCCAAGAAGGGGACTTCCAAGACCCCCGTGCCTGAGAAG
NM_053028.3         GTCGATTTTCGCTCTGTCCTGGCCAAGAAGGGGACTTCCAAGACCCCCGTGCCTGAGAAG
XM_005247494.1      GTCGATTTTCGCTCTGTCCTGGCCAAGAAGGGGACTTCCAAGACCCCCGTGCCTGAGAAG
NM_053025.3         GTCGATTTTCGCTCTGTCCTGGCCAAGAAGGGGACTTCCAAGACCCCCGTGCCTGAGAAG
XM_005247492.1      GTCGATTTTCGCTCTGTCCTGGCCAAGAAGGGGACTTCCAAGACCCCCGTGCCTGAGAAG
NM_053027.3         GTCGATTTTCGCTCTGTCCTGGCCAAGAAGGGGACTTCCAAGACCCCCGTGCCTGAGAAG
NM_053026.3         GTCGATTTTCGCTCTGTCCTGGCCAAGAAGGGGACTTCCAAGACCCCCGTGCCTGAGAAG
                    ************************************************************

HsCD00039037        GTGCCACCGCCAAAACCTGCCACCCCGGATTTTCGCTCAGTGCTGGGTGGCAAGAAGAAA
NM_053028.3         GTGCCACCGCCAAAACCTGCCACCCCGGATTTTCGCTCAGTGCTGGGTGGCAAGAAGAAA
XM_005247494.1      GTGCCACCGCCAAAACCTGCCACCCCGGATTTTCGCTCAGTGCTGGGTGGCAAGAAGAAA
NM_053025.3         GTGCCACCGCCAAAACCTGCCACCCCGGATTTTCGCTCAGTGCTGGGTGGCAAGAAGAAA
XM_005247492.1      GTGCCACCGCCAAAACCTGCCACCCCGGATTTTCGCTCAGTGCTGGGTGGCAAGAAGAAA
NM_053027.3         GTGCCACCGCCAAAACCTGCCACCCCGGATTTTCGCTCAGTGCTGGGTGGCAAGAAGAAA
NM_053026.3         GTGCCACCGCCAAAACCTGCCACCCCGGATTTTCGCTCAGTGCTGGGTGGCAAGAAGAAA
                    ************************************************************

HsCD00039037        TTACCAGCAGAGAATGGCAGCAGCAGTGCCGAGACCCTGAATGCCAAGGCAGTGGAAAGT
NM_053028.3         TTACCAGCAGAGAATGGCAGCAGCAGTGCCGAGACCCTGAATGCCAAGGCAGTGGAGAGT
XM_005247494.1      TTACCAGCAGAGAATGGCAGCAGCAGTGCCGAGACCCTGAATGCCAAGGCAGTGGAGAGT
NM_053025.3         TTACCAGCAGAGAATGGCAGCAGCAGTGCCGAGACCCTGAATGCCAAGGCAGTGGAGAGT
XM_005247492.1      TTACCAGCAGAGAATGGCAGCAGCAGTGCCGAGACCCTGAATGCCAAGGCAGTGGAGAGT
NM_053027.3         TTACCAGCAGAGAATGGCAGCAGCAGTGCCGAGACCCTGAATGCCAAGGCAGTGGAGAGT
NM_053026.3         TTACCAGCAGAGAATGGCAGCAGCAGTGCCGAGACCCTGAATGCCAAGGCAGTGGAGAGT
                    ********************************************************.***

HsCD00039037        TCCAAGCCCCTGAGCAATGCACAGCCTTCAGGGCCCTTGAAACCCGTGGGCAACGCCAAG
NM_053028.3         TCCAAGCCCCTGAGCAATGCACAGCCTTCAGGGCCCTTGAAACCCGTGGGCAACGCCAAG
XM_005247494.1      TCCAAGCCCCTGAGCAATGCACAGCCTTCAGGGCCCTTGAAACCCGTGGGCAACGCCAAG
NM_053025.3         TCCAAGCCCCTGAGCAATGCACAGCCTTCAGGGCCCTTGAAACCCGTGGGCAACGCCAAG
XM_005247492.1      TCCAAGCCCCTGAGCAATGCACAGCCTTCAGGGCCCTTGAAACCCGTGGGCAACGCCAAG
NM_053027.3         TCCAAGCCCCTGAGCAATGCACAGCCTTCAGGGCCCTTGAAACCCGTGGGCAACGCCAAG
NM_053026.3         TCCAAGCCCCTGAGCAATGCACAGCCTTCAGGGCCCTTGAAACCCGTGGGCAACGCCAAG
                    ************************************************************

HsCD00039037        CCTGCTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGCCGAGACCCTGAAGCCCATG
NM_053028.3         CCTGCTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGCCGAGACCCTGAAGCCCATG
XM_005247494.1      CCTGCTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGCCGAGACCCTGAAGCCCATG
NM_053025.3         CCTGCTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGCCGAGACCCTGAAGCCCATG
XM_005247492.1      CCTGCTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGCCGAGACCCTGAAGCCCATG
NM_053027.3         CCTGCTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGCCGAGACCCTGAAGCCCATG
NM_053026.3         CCTGCTGAGACCCTGAAGCCAATGGGCAACGCCAAGCCTGCCGAGACCCTGAAGCCCATG
                    ************************************************************

HsCD00039037        GGCAATGCCAAGCCTGATGAGAACCTGAAATCCGCTAGCAAAGAA---CTCAAGAAAGAC
NM_053028.3         GGCAATGCCAAGCCTGATGAGAACCTGAAATCCGCTAGCAAAGAAGAACTCAAGAAAGAC
XM_005247494.1      GGCAATGCCAAGCCTGATGAGAACCTGAAATCCGCTAGCAAAGAAGAACTCAAGAAAGAC
NM_053025.3         GGCAATGCCAAGCCTGATGAGAACCTGAAATCCGCTAGCAAAGAAGAACTCAAGAAAGAC
XM_005247492.1      GGCAATGCCAAGCCTGATGAGAACCTGAAATCCGCTAGCAAAGAAGAACTCAAGAAAGAC
NM_053027.3         GGCAATGCCAAGCCTGATGAGAACCTGAAATCCGCTAGCAAAGAAGAACTCAAGAAAGAC
NM_053026.3         GGCAATGCCAAGCCTGATGAGAACCTGAAATCCGCTAGCAAAGAAGAACTCAAGAAAGAC
                    *********************************************   ************

HsCD00039037        GTTAAGAATGATGTGAACTGCAAGAGAGGCCATGCAGGGACCACAGATAATGAAAAGAGA
NM_053028.3         GTTAAGAATGATGTGAACTGCAAGAGAGGCCATGCAGGGACCACAGATAATGAAAAGAGA
XM_005247494.1      GTTAAGAATGATGTGAACTGCAAGAGAGGCCATGCAGGGACCACAGATAATGAAAAGAGA
NM_053025.3         GTTAAGAATGATGTGAACTGCAAGAGAGGCCATGCAGGGACCACAGATAATGAAAAGAGA
XM_005247492.1      GTTAAGAATGATGTGAACTGCAAGAGAGGCCATGCAGGGACCACAGATAATGAAAAGAGA
NM_053027.3         GTTAAGAATGATGTGAACTGCAAGAGAGGCCATGCAGGGACCACAGATAATGAAAAGAGA
NM_053026.3         GTTAAGAATGATGTGAACTGCAAGAGAGGCCATGCAGGGACCACAGATAATGAAAAGAGA
                    ************************************************************

HsCD00039037        TCAGAGAGCCAGGGGACAGCCCCAGCCTTCAAGCAGAAGCTGCAAGATGTTCATGTGGCA
NM_053028.3         TCAGAGAGCCAGGGGACAGCCCCAGCCTTCAAGCAGAAGCTGCAAGATGTTCATGTGGCA
XM_005247494.1      TCAGAGAGCCAGGGGACAGCCCCAGCCTTCAAGCAGAAGCTGCAAGATGTTCATGTGGCA
NM_053025.3         TCAGAGAGCCAGGGGACAGCCCCAGCCTTCAAGCAGAAGCTGCAAGATGTTCATGTGGCA
XM_005247492.1      TCAGAGAGCCAGGGGACAGCCCCAGCCTTCAAGCAGAAGCTGCAAGATGTTCATGTGGCA
NM_053027.3         TCAGAGAGCCAGGGGACAGCCCCAGCCTTCAAGCAGAAGCTGCAAGATGTTCATGTGGCA
NM_053026.3         TCAGAGAGCCAGGGGACAGCCCCAGCCTTCAAGCAGAAGCTGCAAGATGTTCATGTGGCA
                    ************************************************************

HsCD00039037        GAGGGCAAGAAGCTGCTGCTCCAGTGCCAGGTGTCTTCTGACCCCCCAGCCACCATCATC
NM_053028.3         GAGGGCAAGAAGCTGCTGCTCCAGTGCCAGGTGTCTTCTGACCCCCCAGCCACCATCATC
XM_005247494.1      GAGGGCAAGAAGCTGCTGCTCCAGTGCCAGGTGTCTTCTGACCCCCCAGCCACCATCATC
NM_053025.3         GAGGGCAAGAAGCTGCTGCTCCAGTGCCAGGTGTCTTCTGACCCCCCAGCCACCATCATC
XM_005247492.1      GAGGGCAAGAAGCTGCTGCTCCAGTGCCAGGTGTCTTCTGACCCCCCAGCCACCATCATC
NM_053027.3         GAGGGCAAGAAGCTGCTGCTCCAGTGCCAGGTGTCTTCTGACCCCCCAGCCACCATCATC
NM_053026.3         GAGGGCAAGAAGCTGCTGCTCCAGTGCCAGGTGTCTTCTGACCCCCCAGCCACCATCATC
                    ************************************************************

HsCD00039037        TGGACGCTGAATGGAAAGACCCTCAAGACCACCAAGTTCATCATCCTCTCCCAGGAAGGC
NM_053028.3         TGGACGCTGAACGGAAAGACCCTCAAGACCACCAAGTTCATCATCCTCTCCCAGGAAGGC
XM_005247494.1      TGGACGCTGAACGGAAAGACCCTCAAGACCACCAAGTTCATCATCCTCTCCCAGGAAGGC
NM_053025.3         TGGACGCTGAACGGAAAGACCCTCAAGACCACCAAGTTCATCATCCTCTCCCAGGAAGGC
XM_005247492.1      TGGACGCTGAACGGAAAGACCCTCAAGACCACCAAGTTCATCATCCTCTCCCAGGAAGGC
NM_053027.3         TGGACGCTGAACGGAAAGACCCTCAAGACCACCAAGTTCATCATCCTCTCCCAGGAAGGC
NM_053026.3         TGGACGCTGAACGGAAAGACCCTCAAGACCACCAAGTTCATCATCCTCTCCCAGGAAGGC
                    *********** ************************************************

HsCD00039037        TCACTCTGCTCCGTCTCCATCGAGAAGGCACTGCCTGAGGACAGAGGCTTATACAAGTGT
NM_053028.3         TCACTCTGCTCCGTCTCCATCGAGAAGGCACTGCCTGAGGACAGAGGCTTATACAAGTGT
XM_005247494.1      TCACTCTGCTCCGTCTCCATCGAGAAGGCACTGCCTGAGGACAGAGGCTTATACAAGTGT
NM_053025.3         TCACTCTGCTCCGTCTCCATCGAGAAGGCACTGCCTGAGGACAGAGGCTTATACAAGTGT
XM_005247492.1      TCACTCTGCTCCGTCTCCATCGAGAAGGCACTGCCTGAGGACAGAGGCTTATACAAGTGT
NM_053027.3         TCACTCTGCTCCGTCTCCATCGAGAAGGCACTGCCTGAGGACAGAGGCTTATACAAGTGT
NM_053026.3         TCACTCTGCTCCGTCTCCATCGAGAAGGCACTGCCTGAGGACAGAGGCTTATACAAGTGT
                    ************************************************************

HsCD00039037        GTAGCCAAGAATGACGCTGGCCAGGCGGAGTGCTCCTGCCAAGTCACCGTGGATGATGCT
NM_053028.3         GTAGCCAAGAATGACGCTGGCCAGGCGGAGTGCTCCTGCCAAGTCACCGTGGATGATGCT
XM_005247494.1      GTAGCCAAGAATGACGCTGGCCAGGCGGAGTGCTCCTGCCAAGTCACCGTGGATGATGCT
NM_053025.3         GTAGCCAAGAATGACGCTGGCCAGGCGGAGTGCTCCTGCCAAGTCACCGTGGATGATGCT
XM_005247492.1      GTAGCCAAGAATGACGCTGGCCAGGCGGAGTGCTCCTGCCAAGTCACCGTGGATGATGCT
NM_053027.3         GTAGCCAAGAATGACGCTGGCCAGGCGGAGTGCTCCTGCCAAGTCACCGTGGATGATGCT
NM_053026.3         GTAGCCAAGAATGACGCTGGCCAGGCGGAGTGCTCCTGCCAAGTCACCGTGGATGATGCT
                    ************************************************************

HsCD00039037        CCAGCCAGTGAGAACACCAAGGCCCCAGAGATGAAATCCCGGAGGCCCAAGAGCTCTCTT
NM_053028.3         CCAGCCAGTGAGAACACCAAGGCCCCAGAGATGAAATCCCGGAGGCCCAAGAGCTCTCTT
XM_005247494.1      CCAGCCAGTGAGAACACCAAGGCCCCAGAGATGAAATCCCGGAGGCCCAAGAGCTCTCTT
NM_053025.3         CCAGCCAGTGAGAACACCAAGGCCCCAGAGATGAAATCCCGGAGGCCCAAGAGCTCTCTT
XM_005247492.1      CCAGCCAGTGAGAACACCAAGGCCCCAGAGATGAAATCCCGGAGGCCCAAGAGCTCTCTT
NM_053027.3         CCAGCCAGTGAGAACACCAAGGCCCCAGAGATGAAATCCCGGAGGCCCAAGAGCTCTCTT
NM_053026.3         CCAGCCAGTGAGAACACCAAGGCCCCAGAGATGAAATCCCGGAGGCCCAAGAGCTCTCTT
                    ************************************************************

HsCD00039037        CCTCCCGTGCTAGGAACTGAGAGTGATGCGACTGTGAAAAAGAAACCTGCCCCCAAGACA
NM_053028.3         CCTCCCGTGCTAGGAACTGAGAGTGATGCGACTGTGAAAAAGAAACCTGCCCCCAAGACA
XM_005247494.1      CCTCCCGTGCTAGGAACTGAGAGTGATGCGACTGTGAAAAAGAAACCTGCCCCCAAGACA
NM_053025.3         CCTCCCGTGCTAGGAACTGAGAGTGATGCGACTGTGAAAAAGAAACCTGCCCCCAAGACA
XM_005247492.1      CCTCCCGTGCTAGGAACTGAGAGTGATGCGACTGTGAAAAAGAAACCTGCCCCCAAGACA
NM_053027.3         CCTCCCGTGCTAGGAACTGAGAGTGATGCGACTGTGAAAAAGAAACCTGCCCCCAAGACA
NM_053026.3         CCTCCCGTGCTAGGAACTGAGAGTGATGCGACTGTGAAAAAGAAACCTGCCCCCAAGACA
                    ************************************************************

HsCD00039037        CCTCCGAAGGCAGCAATGCCCCCTCAGATCATCCAGTTCCCTGAGGACCAGAAGGTACGC
NM_053028.3         CCTCCGAAGGCAGCAATGCCCCCTCAGATCATCCAGTTCCCTGAGGACCAGAAGGTACGC
XM_005247494.1      CCTCCGAAGGCAGCAATGCCCCCTCAGATCATCCAGTTCCCTGAGGACCAGAAGGTACGC
NM_053025.3         CCTCCGAAGGCAGCAATGCCCCCTCAGATCATCCAGTTCCCTGAGGACCAGAAGGTACGC
XM_005247492.1      CCTCCGAAGGCAGCAATGCCCCCTCAGATCATCCAGTTCCCTGAGGACCAGAAGGTACGC
NM_053027.3         CCTCCGAAGGCAGCAATGCCCCCTCAGATCATCCAGTTCCCTGAGGACCAGAAGGTACGC
NM_053026.3         CCTCCGAAGGCAGCAATGCCCCCTCAGATCATCCAGTTCCCTGAGGACCAGAAGGTACGC
                    ************************************************************

HsCD00039037        GCAGGAGAGTCAGTGGAGCTGTTTGGCAAAGTGACAGGCACTCAGCCCATCACCTGTACC
NM_053028.3         GCAGGAGAGTCAGTGGAGCTGTTTGGCAAAGTGACAGGCACTCAGCCCATCACCTGTACC
XM_005247494.1      GCAGGAGAGTCAGTGGAGCTGTTTGGCAAAGTGACAGGCACTCAGCCCATCACCTGTACC
NM_053025.3         GCAGGAGAGTCAGTGGAGCTGTTTGGCAAAGTGACAGGCACTCAGCCCATCACCTGTACC
XM_005247492.1      GCAGGAGAGTCAGTGGAGCTGTTTGGCAAAGTGACAGGCACTCAGCCCATCACCTGTACC
NM_053027.3         GCAGGAGAGTCAGTGGAGCTGTTTGGCAAAGTGACAGGCACTCAGCCCATCACCTGTACC
NM_053026.3         GCAGGAGAGTCAGTGGAGCTGTTTGGCAAAGTGACAGGCACTCAGCCCATCACCTGTACC
                    ************************************************************

HsCD00039037        TGGATGAAGTTCCGAAAGCAGATCCAGGAAAGCGAGCACATGAAGGTGGAGAACAGCGAG
NM_053028.3         TGGATGAAGTTCCGAAAGCAGATCCAGGAAAGCGAGCACATGAAGGTGGAGAACAGCGAG
XM_005247494.1      TGGATGAAGTTCCGAAAGCAGATCCAGGAAAGCGAGCACATGAAGGTGGAGAACAGCGAG
NM_053025.3         TGGATGAAGTTCCGAAAGCAGATCCAGGAAAGCGAGCACATGAAGGTGGAGAACAGCGAG
XM_005247492.1      TGGATGAAGTTCCGAAAGCAGATCCAGGAAAGCGAGCACATGAAGGTGGAGAACAGCGAG
NM_053027.3         TGGATGAAGTTCCGAAAGCAGATCCAGGAAAGCGAGCACATGAAGGTGGAGAACAGCGAG
NM_053026.3         TGGATGAAGTTCCGAAAGCAGATCCAGGAAAGCGAGCACATGAAGGTGGAGAACAGCGAG
                    ************************************************************

HsCD00039037        AATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAGCACTGCGGCTGCTACACACTG
NM_053028.3         AATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAGCACTGCGGCTGCTACACACTG
XM_005247494.1      AATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAGCACTGCGGCTGCTACACACTG
NM_053025.3         AATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAGCACTGCGGCTGCTACACACTG
XM_005247492.1      AATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAGCACTGCGGCTGCTACACACTG
NM_053027.3         AATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAGCACTGCGGCTGCTACACACTG
NM_053026.3         AATGGCAGCAAGCTCACCATCCTGGCCGCGCGCCAGGAGCACTGCGGCTGCTACACACTG
                    ************************************************************

HsCD00039037        CTGGTGGAGAACAAGCTGGGCAGCAGGCGGGCCCAGGTCAACCTCACTGTCGTGGATAAG
NM_053028.3         CTGGTGGAGAACAAGCTGGGCAGCAGGCAGGCCCAGGTCAACCTCACTGTCGTGGATAAG
XM_005247494.1      CTGGTGGAGAACAAGCTGGGCAGCAGGCAGGCCCAGGTCAACCTCACTGTCGTGGATAAG
NM_053025.3         CTGGTGGAGAACAAGCTGGGCAGCAGGCAGGCCCAGGTCAACCTCACTGTCGTGGATAAG
XM_005247492.1      CTGGTGGAGAACAAGCTGGGCAGCAGGCAGGCCCAGGTCAACCTCACTGTCGTGGATAAG
NM_053027.3         CTGGTGGAGAACAAGCTGGGCAGCAGGCAGGCCCAGGTCAACCTCACTGTCGTGGATAAG
NM_053026.3         CTGGTGGAGAACAAGCTGGGCAGCAGGCAGGCCCAGGTCAACCTCACTGTCGTGGATAAG
                    ****************************.*******************************

HsCD00039037        CCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTCACTGACCCTG
NM_053028.3         CCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTCACTGACCCTG
XM_005247494.1      CCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTCACTGACCCTG
NM_053025.3         CCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTCACTGACCCTG
XM_005247492.1      CCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTCACTGACCCTG
NM_053027.3         CCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTCACTGACCCTG
NM_053026.3         CCAGACCCCCCAGCTGGCACACCTTGTGCCTCTGACATTCGGAGCTCCTCACTGACCCTG
                    ************************************************************

HsCD00039037        TCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTACAGTCCTACAGCATCGAGATC
NM_053028.3         TCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTACAGTCCTACAGCATCGAGATC
XM_005247494.1      TCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTACAGTCCTACAGCATCGAGATC
NM_053025.3         TCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTACAGTCCTACAGCATCGAGATC
XM_005247492.1      TCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTACAGTCCTACAGCATCGAGATC
NM_053027.3         TCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTACAGTCCTACAGCATCGAGATC
NM_053026.3         TCCTGGTATGGCTCCTCATATGATGGGGGCAGTGCTGTACAGTCCTACAGCATCGAGATC
                    ************************************************************

HsCD00039037        TGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACATGCCGCAGCACCTCTTTCAAC
NM_053028.3         TGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACATGCCGCAGCACCTCTTTCAAC
XM_005247494.1      TGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACATGCCGCAGCACCTCTTTCAAC
NM_053025.3         TGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACATGCCGCAGCACCTCTTTCAAC
XM_005247492.1      TGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACATGCCGCAGCACCTCTTTCAAC
NM_053027.3         TGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACATGCCGCAGCACCTCTTTCAAC
NM_053026.3         TGGGACTCAGCCAACAAGACGTGGAAGGAACTAGCCACATGCCGCAGCACCTCTTTCAAC
                    ************************************************************

HsCD00039037        GTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGTGTACGTGCAATCAACGTGTAT
NM_053028.3         GTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGTGTACGTGCAATCAACGTGTAT
XM_005247494.1      GTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGTGTACGTGCAATCAACGTGTAT
NM_053025.3         GTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGTGTACGTGCAATCAACGTGTAT
XM_005247492.1      GTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGTGTACGTGCAATCAACGTGTAT
NM_053027.3         GTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGTGTACGTGCAATCAACGTGTAT
NM_053026.3         GTCCAGGACCTGCTGCCTGACCACGAATATAAGTTCCGTGTACGTGCAATCAACGTGTAT
                    ************************************************************

HsCD00039037        GGAACCAGTGAGCCAAGCCAGGAGTCTGAACTCACAACGGTAGGAGAGAAACCTGAAGAG
NM_053028.3         GGAACCAGTGAGCCAAGCCAGGAGTCTGAACTCACAACGGTAGGAGAGAAACCTGAAGAG
XM_005247494.1      GGAACCAGTGAGCCAAGCCAGGAGTCTGAACTCACAACGGTAGGAGAGAAACCTGAAGAG
NM_053025.3         GGAACCAGTGAGCCAAGCCAGGAGTCTGAACTCACAACGGTAGGAGAGAAACCTGAAGAG
XM_005247492.1      GGAACCAGTGAGCCAAGCCAGGAGTCTGAACTCACAACGGTAGGAGAGAAACCTGAAGAG
NM_053027.3         GGAACCAGTGAGCCAAGCCAGGAGTCTGAACTCACAACGGTAGGAGAGAAACCTGAAGAG
NM_053026.3         GGAACCAGTGAGCCAAGCCAGGAGTCTGAACTCACAACGGTAGGAGAGAAACCTGAAGAG
                    ************************************************************

HsCD00039037        CCGAAGGATGAAGTGGAGGTGTCAGACGATGATGAGAAGGAGCCCGAGGTTGATTACCGG
NM_053028.3         CCGAAGGATGAAGTGGAGGTGTCAGATGATGATGAGAAGGAGCCCGAGGTTGATTACCGG
XM_005247494.1      CCGAAGGATGAAGTGGAGGTGTCAGATGATGATGAGAAGGAGCCCGAGGTTGATTACCGG
NM_053025.3         CCGAAGGATGAAGTGGAGGTGTCAGATGATGATGAGAAGGAGCCCGAGGTTGATTACCGG
XM_005247492.1      CCGAAGGATGAAGTGGAGGTGTCAGATGATGATGAGAAGGAGCCCGAGGTTGATTACCGG
NM_053027.3         CCGAAGGATGAAGTGGAGGTGTCAGATGATGATGAGAAGGAGCCCGAGGTTGATTACCGG
NM_053026.3         CCGAAGGATGAAGTGGAGGTGTCAGATGATGATGAGAAGGAGCCCGAGGTTGATTACCGG
                    ************************** *********************************

HsCD00039037        ACAGTGACAATCAATACTGAACAAAAAGTATCTGACTTCTACGACATTGAGGAGAGATTA
NM_053028.3         ACAGTGACAATCAATACTGAACAAAAAGTATCTGACTTCTACGACATTGAGGAGAGATTA
XM_005247494.1      ACAGTGACAATCAATACTGAACAAAAAGTATCTGACTTCTACGACATTGAGGAGAGATTA
NM_053025.3         ACAGTGACAATCAATACTGAACAAAAAGTATCTGACTTCTACGACATTGAGGAGAGATTA
XM_005247492.1      ACAGTGACAATCAATACTGAACAAAAAGTATCTGACTTCTACGACATTGAGGAGAGATTA
NM_053027.3         ACAGTGACAATCAATACTGAACAAAAAGTATCTGACTTCTACGACATTGAGGAGAGATTA
NM_053026.3         ACAGTGACAATCAATACTGAACAAAAAGTATCTGACTTCTACGACATTGAGGAGAGATTA
                    ************************************************************

HsCD00039037        GGATCTGGGAAATTTGGACAGGTCTTTCGACTTGTAGAAAAGAAAACTCGAAAAGTCTGG
NM_053028.3         GGATCTGGGAAATTTGGACAGGTCTTTCGACTTGTAGAAAAGAAAACTCGAAAAGTCTGG
XM_005247494.1      GGATCTGGGAAATTTGGACAGGTCTTTCGACTTGTAGAAAAGAAAACTCGAAAAGTCTGG
NM_053025.3         GGATCTGGGAAATTTGGACAGGTCTTTCGACTTGTAGAAAAGAAAACTCGAAAAGTCTGG
XM_005247492.1      GGATCTGGGAAATTTGGACAGGTCTTTCGACTTGTAGAAAAGAAAACTCGAAAAGTCTGG
NM_053027.3         GGATCTGGGAAATTTGGACAGGTCTTTCGACTTGTAGAAAAGAAAACTCGAAAAGTCTGG
NM_053026.3         GGATCTGGGAAATTTGGACAGGTCTTTCGACTTGTAGAAAAGAAAACTCGAAAAGTCTGG
                    ************************************************************

HsCD00039037        GCAGGGAAGTTCTTCAAGGCATATTCAGCAAAAGAGAAAGAGAATATCCGGCAGGAGATT
NM_053028.3         GCAGGGAAGTTCTTCAAGGCATATTCAGCAAAAGAGAAAGAGAATATCCGGCAGGAGATT
XM_005247494.1      GCAGGGAAGTTCTTCAAGGCATATTCAGCAAAAGAGAAAGAGAATATCCGGCAGGAGATT
NM_053025.3         GCAGGGAAGTTCTTCAAGGCATATTCAGCAAAAGAGAAAGAGAATATCCGGCAGGAGATT
XM_005247492.1      GCAGGGAAGTTCTTCAAGGCATATTCAGCAAAAGAGAAAGAGAATATCCGGCAGGAGATT
NM_053027.3         GCAGGGAAGTTCTTCAAGGCATATTCAGCAAAAGAGAAAGAGAATATCCGGCAGGAGATT
NM_053026.3         GCAGGGAAGTTCTTCAAGGCATATTCAGCAAAAGAGAAAGAGAATATCCGGCAGGAGATT
                    ************************************************************

HsCD00039037        AGCATCATGAACTGCCTCCACCACCCTAAGCTGGTCCAGTGTGTGGATGCCTTTGAAGAA
NM_053028.3         AGCATCATGAACTGCCTCCACCACCCTAAGCTGGTCCAGTGTGTGGATGCCTTTGAAGAA
XM_005247494.1      AGCATCATGAACTGCCTCCACCACCCTAAGCTGGTCCAGTGTGTGGATGCCTTTGAAGAA
NM_053025.3         AGCATCATGAACTGCCTCCACCACCCTAAGCTGGTCCAGTGTGTGGATGCCTTTGAAGAA
XM_005247492.1      AGCATCATGAACTGCCTCCACCACCCTAAGCTGGTCCAGTGTGTGGATGCCTTTGAAGAA
NM_053027.3         AGCATCATGAACTGCCTCCACCACCCTAAGCTGGTCCAGTGTGTGGATGCCTTTGAAGAA
NM_053026.3         AGCATCATGAACTGCCTCCACCACCCTAAGCTGGTCCAGTGTGTGGATGCCTTTGAAGAA
                    ************************************************************

HsCD00039037        AAGGCCAACATCGTCATGGTCCTGGAGATCGTGTCAGGAGGGGAGCTGTTTGAGCGCATC
NM_053028.3         AAGGCCAACATCGTCATGGTCCTGGAGATCGTGTCAGGAGGGGAGCTGTTTGAGCGCATC
XM_005247494.1      AAGGCCAACATCGTCATGGTCCTGGAGATCGTGTCAGGAGGGGAGCTGTTTGAGCGCATC
NM_053025.3         AAGGCCAACATCGTCATGGTCCTGGAGATCGTGTCAGGAGGGGAGCTGTTTGAGCGCATC
XM_005247492.1      AAGGCCAACATCGTCATGGTCCTGGAGATCGTGTCAGGAGGGGAGCTGTTTGAGCGCATC
NM_053027.3         AAGGCCAACATCGTCATGGTCCTGGAGATCGTGTCAGGAGGGGAGCTGTTTGAGCGCATC
NM_053026.3         AAGGCCAACATCGTCATGGTCCTGGAGATCGTGTCAGGAGGGGAGCTGTTTGAGCGCATC
                    ************************************************************

HsCD00039037        ATTGACGAGGACTTTGAGCTGACGGAGCGTGAGTGCATCAAGTACATGCGGCAGATCTCG
NM_053028.3         ATTGACGAGGACTTTGAGCTGACGGAGCGTGAGTGCATCAAGTACATGCGGCAGATCTCG
XM_005247494.1      ATTGACGAGGACTTTGAGCTGACGGAGCGTGAGTGCATCAAGTACATGCGGCAGATCTCG
NM_053025.3         ATTGACGAGGACTTTGAGCTGACGGAGCGTGAGTGCATCAAGTACATGCGGCAGATCTCG
XM_005247492.1      ATTGACGAGGACTTTGAGCTGACGGAGCGTGAGTGCATCAAGTACATGCGGCAGATCTCG
NM_053027.3         ATTGACGAGGACTTTGAGCTGACGGAGCGTGAGTGCATCAAGTACATGCGGCAGATCTCG
NM_053026.3         ATTGACGAGGACTTTGAGCTGACGGAGCGTGAGTGCATCAAGTACATGCGGCAGATCTCG
                    ************************************************************

HsCD00039037        GAGGGAGTGGAGTACATCCACAAGCAGGGCATCGTGCACCTGGACCTCAAGCCGGAGAAC
NM_053028.3         GAGGGAGTGGAGTACATCCACAAGCAGGGCATCGTGCACCTGGACCTCAAGCCGGAGAAC
XM_005247494.1      GAGGGAGTGGAGTACATCCACAAGCAGGGCATCGTGCACCTGGACCTCAAGCCGGAGAAC
NM_053025.3         GAGGGAGTGGAGTACATCCACAAGCAGGGCATCGTGCACCTGGACCTCAAGCCGGAGAAC
XM_005247492.1      GAGGGAGTGGAGTACATCCACAAGCAGGGCATCGTGCACCTGGACCTCAAGCCGGAGAAC
NM_053027.3         GAGGGAGTGGAGTACATCCACAAGCAGGGCATCGTGCACCTGGACCTCAAGCCGGAGAAC
NM_053026.3         GAGGGAGTGGAGTACATCCACAAGCAGGGCATCGTGCACCTGGACCTCAAGCCGGAGAAC
                    ************************************************************

HsCD00039037        ATCATGTGTGTCAACAAGACGGGCACCAGGATCAAGCTCATCGACTTTGGTCTGGCCAGG
NM_053028.3         ATCATGTGTGTCAACAAGACGGGCACCAGGATCAAGCTCATCGACTTTGGTCTGGCCAGG
XM_005247494.1      ATCATGTGTGTCAACAAGACGGGCACCAGGATCAAGCTCATCGACTTTGGTCTGGCCAGG
NM_053025.3         ATCATGTGTGTCAACAAGACGGGCACCAGGATCAAGCTCATCGACTTTGGTCTGGCCAGG
XM_005247492.1      ATCATGTGTGTCAACAAGACGGGCACCAGGATCAAGCTCATCGACTTTGGTCTGGCCAGG
NM_053027.3         ATCATGTGTGTCAACAAGACGGGCACCAGGATCAAGCTCATCGACTTTGGTCTGGCCAGG
NM_053026.3         ATCATGTGTGTCAACAAGACGGGCACCAGGATCAAGCTCATCGACTTTGGTCTGGCCAGG
                    ************************************************************

HsCD00039037        AGGCTGGAGAATGCGGGGTCTCTGAAGGTCCTCTTTGGCACCCCAGAATTTGTGGCTCCT
NM_053028.3         AGGCTGGAGAATGCGGGGTCTCTGAAGGTCCTCTTTGGCACCCCAGAATTTGTGGCTCCT
XM_005247494.1      AGGCTGGAGAATGCGGGGTCTCTGAAGGTCCTCTTTGGCACCCCAGAATTTGTGGCTCCT
NM_053025.3         AGGCTGGAGAATGCGGGGTCTCTGAAGGTCCTCTTTGGCACCCCAGAATTTGTGGCTCCT
XM_005247492.1      AGGCTGGAGAATGCGGGGTCTCTGAAGGTCCTCTTTGGCACCCCAGAATTTGTGGCTCCT
NM_053027.3         AGGCTGGAGAATGCGGGGTCTCTGAAGGTCCTCTTTGGCACCCCAGAATTTGTGGCTCCT
NM_053026.3         AGGCTGGAGAATGCGGGGTCTCTGAAGGTCCTCTTTGGCACCCCAGAATTTGTGGCTCCT
                    ************************************************************

HsCD00039037        GAAGTGATCAACTATGAGCCCATCGGCTACGCCACAGACATGTGGAGCATCGGGGTCATC
NM_053028.3         GAAGTGATCAACTATGAGCCCATCGGCTACGCCACAGACATGTGGAGCATCGGGGTCATC
XM_005247494.1      GAAGTGATCAACTATGAGCCCATCGGCTACGCCACAGACATGTGGAGCATCGGGGTCATC
NM_053025.3         GAAGTGATCAACTATGAGCCCATCGGCTACGCCACAGACATGTGGAGCATCGGGGTCATC
XM_005247492.1      GAAGTGATCAACTATGAGCCCATCGGCTACGCCACAGACATGTGGAGCATCGGGGTCATC
NM_053027.3         GAAGTGATCAACTATGAGCCCATCGGCTACGCCACAGACATGTGGAGCATCGGGGTCATC
NM_053026.3         GAAGTGATCAACTATGAGCCCATCGGCTACGCCACAGACATGTGGAGCATCGGGGTCATC
                    ************************************************************

HsCD00039037        TGCTACATCCTAGTCAGTGGCCTTTCCCCCTTCATGGGAGACAACGATAACGAAACCTTG
NM_053028.3         TGCTACATCCTAAACCG-------------------------------------------
XM_005247494.1      TGCTACATCCTAGTCAGTGGCCTTTCCCCCTTCATGGGAGACAACGATAACGAAACCTTG
NM_053025.3         TGCTACATCCTAGTCAGTGGCCTTTCCCCCTTCATGGGAGACAACGATAACGAAACCTTG
XM_005247492.1      TGCTACATCCTAGTCAGTGGCCTTTCCCCCTTCATGGGAGACAACGATAACGAAACCTTG
NM_053027.3         TGCTACATCCTAAACCG-------------------------------------------
NM_053026.3         TGCTACATCCTAGTCAGTGGCCTTTCCCCCTTCATGGGAGACAACGATAACGAAACCTTG
                    ************.:*.*                                           

HsCD00039037        GCCAACGTTACCTCAGCCACCTGGGACTTCGACGACGAGGCATTCGATGAGATCTCCGAC
NM_053028.3         ------------------------------------------------------------
XM_005247494.1      GCCAACGTTACCTCAGCCACCTGGGACTTCGACGACGAGGCATTCGATGAGATCTCCGAC
NM_053025.3         GCCAACGTTACCTCAGCCACCTGGGACTTCGACGACGAGGCATTCGATGAGATCTCCGAC
XM_005247492.1      GCCAACGTTACCTCAGCCACCTGGGACTTCGACGACGAGGCATTCGATGAGATCTCCGAC
NM_053027.3         ------------------------------------------------------------
NM_053026.3         GCCAACGTTACCTCAGCCACCTGGGACTTCGACGACGAGGCATTCGATGAGATCTCCGAC
                                                                                

HsCD00039037        GATGCCAAGGATTTCATCAGCAATCTGCTGAAGAAAGATATGAAAAACCGCCTGGACTGC
NM_053028.3         --------------------------------------------------CCTGGACTGC
XM_005247494.1      GATGCCAAGGATTTCATCAGCAATCTGCTGAAGAAAGATATGAAAAACCGCCTGGACTGC
NM_053025.3         GATGCCAAGGATTTCATCAGCAATCTGCTGAAGAAAGATATGAAAAACCGCCTGGACTGC
XM_005247492.1      GATGCCAAGGATTTCATCAGCAATCTGCTGAAGAAAGATATGAAAAACCGCCTGGACTGC
NM_053027.3         --------------------------------------------------CCTGGACTGC
NM_053026.3         GATGCCAAGGATTTCATCAGCAATCTGCTGAAGAAAGATATGAAAAACCGCCTGGACTGC
                                                                      **********

HsCD00039037        ACGCAGTGCCTTCAGCATCCATGGCTAATGAAAGATACCAAGAACATGGAGGCCAAGAAA
NM_053028.3         ACGCAGTGCCTTCAGCATCCATGGCTAATGAAAGATACCAAGAACATGGAGGCCAAGAAA
XM_005247494.1      ACGCAGTGCCTTCAGCATCCATGGCTAATGAAAGATACCAAGAACATGGAGGCCAAGAAA
NM_053025.3         ACGCAGTGCCTTCAGCATCCATGGCTAATGAAAGATACCAAGAACATGGAGGCCAAGAAA
XM_005247492.1      ACGCAGTGCCTTCAGCATCCATGGCTAATGAAAGATACCAAGAACATGGAGGCCAAGAAA
NM_053027.3         ACGCAGTGCCTTCAGCATCCATGGCTAATGAAAGATACCAAGAACATGGAGGCCAAGAAA
NM_053026.3         ACGCAGTGCCTTCAGCATCCATGGCTAATGAAAGATACCAAGAACATGGAGGCCAAGAAA
                    ************************************************************

HsCD00039037        CTCTCCAAGGACCGGATGAAGAAGTACATGGCAAGAAGGAAATGGCAGAAAACGGGCAAT
NM_053028.3         CTCTCCAAGGACCGGATGAAGAAGTACATGGCAAGAAGGAAATGGCAGAAAACGGGCAAT
XM_005247494.1      CTCTCCAAGGACCGGATGAAGAAGTACATGGCAAGAAGGAAATGGCAGAAAACGGGCAAT
NM_053025.3         CTCTCCAAGGACCGGATGAAGAAGTACATGGCAAGAAGGAAATGGCAGAAAACGGGCAAT
XM_005247492.1      CTCTCCAAGGACCGGATGAAGAAGTACATGGCAAGAAGGAAATGGCAGAAAACGGGCAAT
NM_053027.3         CTCTCCAAGGACCGGATGAAGAAGTACATGGCAAGAAGGAAATGGCAGAAAACGGGCAAT
NM_053026.3         CTCTCCAAGGACCGGATGAAGAAGTACATGGCAAGAAGGAAATGGCAGAAAACGGGCAAT
                    ************************************************************

HsCD00039037        GCTGTGAGAGCCATTGGAAGACTGTCCTCTATGGCAATGATCTCAGGGCTCAGTGGCAGG
NM_053028.3         GCTGTGAGAGCCATTGGAAGACTGTCCTCTATGGCAATGATCTCAGGGCTCAGTGGCAGG
XM_005247494.1      GCTGTGAGAGCCATTGGAAGACTGTCCTCTATGGCAATGATCTCAGGGCTCAGTGGCAGG
NM_053025.3         GCTGTGAGAGCCATTGGAAGACTGTCCTCTATGGCAATGATCTCAGGGCTCAGTGGCAGG
XM_005247492.1      GCTGTGAGAGCCATTGGAAGACTGTCCTCTATGGCAATGATCTCAGGGCTCAGTGGCAGG
NM_053027.3         GCTGTGAGAGCCATTGGAAGACTGTCCTCTATGGCAATGATCTCAGGGCTCAGTGGCAGG
NM_053026.3         GCTGTGAGAGCCATTGGAAGACTGTCCTCTATGGCAATGATCTCAGGGCTCAGTGGCAGG
                    ************************************************************

HsCD00039037        AAATCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCAGAAAAACTAGAATCTGAAGAA
NM_053028.3         AAATCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCAGAAAAACTAGAATCTGAAGAA
XM_005247494.1      AAATCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCAGAAAAACTAGAATCTGAAGAA
NM_053025.3         AAATCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCAGAAAAACTAGAATCTGAAGAA
XM_005247492.1      AAATCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCAGAAAAACTAGAATCTGAAGAA
NM_053027.3         AAATCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCAGAAAAACTAGAATCTGAAGAA
NM_053026.3         AAATCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCAGAAAAACTAGAATCTGAAGAA
                    ************************************************************

HsCD00039037        GATGTGTCCCAAGCTTTCCTTGAGGCTGTTGCTGAGGAAAAGCCTCATGTAAAACCCTAT
NM_053028.3         GATGTGTCCCAAGCTTTCCTTGAGGCTGTTGCTGAGGAAAAGCCTCATGTAAAACCCTAT
XM_005247494.1      GATGTGTCCCAAGCTTTCCTTGAGGCTGTTGCTGAGGAAAAGCCTCATGTAAAACCCTAT
NM_053025.3         GATGTGTCCCAAGCTTTCCTTGAGGCTGTTGCTGAGGAAAAGCCTCATGTAAAACCCTAT
XM_005247492.1      GATGTGTCCCAAGCTTTCCTTGAGGCTGTTGCTGAGGAAAAGCCTCATGTAAAACCCTAT
NM_053027.3         GATGTGTCCCAAGCTTTCCTTGAGGCTGTTGCTGAGGAAAAGCCTCATGTAAAACCCTAT
NM_053026.3         GATGTGTCCCAAGCTTTCCTTGAGGCTGTTGCTGAGGAAAAGCCTCATGTAAAACCCTAT
                    ************************************************************

HsCD00039037        TTCTCTAAGACCATTCGCGATTTAGAAGTTGTGGAGGGAAGTGCTGCTAGATTTGACTGC
NM_053028.3         TTCTCTAAGACCATTCGCGATTTAGAAGTTGTGGAGGGAAGTGCTGCTAGATTTGACTGC
XM_005247494.1      TTCTCTAAGACCATTCGCGATTTAGAAGTTGTGGAGGGAAGTGCTGCTAGATTTGACTGC
NM_053025.3         TTCTCTAAGACCATTCGCGATTTAGAAGTTGTGGAGGGAAGTGCTGCTAGATTTGACTGC
XM_005247492.1      TTCTCTAAGACCATTCGCGATTTAGAAGTTGTGGAGGGAAGTGCTGCTAGATTTGACTGC
NM_053027.3         TTCTCTAAGACCATTCGCGATTTAGAAGTTGTGGAGGGAAGTGCTGCTAGATTTGACTGC
NM_053026.3         TTCTCTAAGACCATTCGCGATTTAGAAGTTGTGGAGGGAAGTGCTGCTAGATTTGACTGC
                    ************************************************************

HsCD00039037        AAGATTGAAGGATACCCAGACCCCGAGGTTGTCTGGTTCAAAGATGACCAGTCAATCAGG
NM_053028.3         AAGATTGAAGGATACCCAGACCCCGAGGTTGTCTGGTTCAAAGATGACCAGTCAATCAGG
XM_005247494.1      AAGATTGAAGGATACCCAGACCCCGAGGTTGTCTGGTTCAAAGATGACCAGTCAATCAGG
NM_053025.3         AAGATTGAAGGATACCCAGACCCCGAGGTTGTCTGGTTCAAAGATGACCAGTCAATCAGG
XM_005247492.1      AAGATTGAAGGATACCCAGACCCCGAGGTTGTCTGGTTCAAAGATGACCAGTCAATCAGG
NM_053027.3         AAGATTGAAGGATACCCAGACCCCGAGGTTGTCTGGTTCAAAGATGACCAGTCAATCAGG
NM_053026.3         AAGATTGAAGGATACCCAGACCCCGAGGTTGTCTGGTTCAAAGATGACCAGTCAATCAGG
                    ************************************************************

HsCD00039037        GAGTCCCGCCACTTCCAGATAGACTACGATGAGGACGGGAACTGCTCTTTAATTATTAGT
NM_053028.3         GAGTCCCGCCACTTCCAGATAGACTACGATGAGGACGGGAACTGCTCTTTAATTATTAGT
XM_005247494.1      GAGTCCCGCCACTTCCAGATAGACTACGATGAGGACGGGAACTGCTCTTTAATTATTAGT
NM_053025.3         GAGTCCCGCCACTTCCAGATAGACTACGATGAGGACGGGAACTGCTCTTTAATTATTAGT
XM_005247492.1      GAGTCCCGCCACTTCCAGATAGACTACGATGAGGACGGGAACTGCTCTTTAATTATTAGT
NM_053027.3         GAGTCCCGCCACTTCCAGATAGACTACGATGAGGACGGGAACTGCTCTTTAATTATTAGT
NM_053026.3         GAGTCCCGCCACTTCCAGATAGACTACGATGAGGACGGGAACTGCTCTTTAATTATTAGT
                    ************************************************************

HsCD00039037        GATGTTTGCGGGGATGACGATGCCAAGTACACCTGCAAGGCTGTCAACAGTCTTGGAGAA
NM_053028.3         GATGTTTGCGGGGATGACGATGCCAAGTACACCTGCAAGGCTGTCAACAGTCTTGGAGAA
XM_005247494.1      GATGTTTGCGGGGATGACGATGCCAAGTACACCTGCAAGGCTGTCAACAGTCTTGGAGAA
NM_053025.3         GATGTTTGCGGGGATGACGATGCCAAGTACACCTGCAAGGCTGTCAACAGTCTTGGAGAA
XM_005247492.1      GATGTTTGCGGGGATGACGATGCCAAGTACACCTGCAAGGCTGTCAACAGTCTTGGAGAA
NM_053027.3         GATGTTTGCGGGGATGACGATGCCAAGTACACCTGCAAGGCTGTCAACAGTCTTGGAGAA
NM_053026.3         GATGTTTGCGGGGATGACGATGCCAAGTACACCTGCAAGGCTGTCAACAGTCTTGGAGAA
                    ************************************************************

HsCD00039037        GCCACCTGCACAGCAGAGCTCATTGTGGAAACGATGGAGGAAGGTGAAGGGGAAGGGGAA
NM_053028.3         GCCACCTGCACAGCAGAGCTCATTGTGGAAACGATGGAGGAAGGTGAAGGGGAAGGGGAA
XM_005247494.1      GCCACCTGCACAGCAGAGCTCATTGTGGAAACGATGGAGGAAGGTGAAGGGGAAGGGGAA
NM_053025.3         GCCACCTGCACAGCAGAGCTCATTGTGGAAACGATGGAGGAAGGTGAAGGGGAAGGGGAA
XM_005247492.1      GCCACCTGCACAGCAGAGCTCATTGTGGAAACGATGGAGGAAGGTGAAGGGGAAGGGGAA
NM_053027.3         GCCACCTGCACAGCAGAGCTCATTGTGGAAACGATGGAGGAAGGTGAAGGGGAAGGGGAA
NM_053026.3         GCCACCTGCACAGCAGAGCTCATTGTGGAAACGATGGAGGAAGGTGAAGGGGAAGGGGAA
                    ************************************************************

HsCD00039037        GAGGAAGAAGAGTTG
NM_053028.3         GAGGAAGAAGAGTGA
XM_005247494.1      GAGGAAGAAGAGTGA
NM_053025.3         GAGGAAGAAGAGTGA
XM_005247492.1      GAGGAAGAAGAGTGA
NM_053027.3         GAGGAAGAAGAGTGA
NM_053026.3         GAGGAAGAAGAGTGA
                    ************* .

Pathways

NCI : Aurora B signaling
Panther : Cytoskeletal regulation by Rho GTPase
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Reactome : Muscle contraction
Reactome : Smooth Muscle Contraction
WikiPathway : Focal Adhesion
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Regulation of Actin Cytoskeleton

Clone

Cloning Information : 214454
HIP Master Clone ID : 136218
Original Clone ID : FLH214454.01L

Organism


TAX_ID : 9606
Species Specific ID: 4638

Genome

Chromosome : 3
Map Location : 3q21
Ensembl : ENSG00000065534

Reagents

Labome : MYLK-antibody