DNASU Plasmid Repository • 480.965.5697 | Email

PIK4CA (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PI4KA
Gene Name:  phosphatidylinositol 4-kinase, catalytic, alpha
Sequence             
Original Clone ID: FLH222232.01L
Keyword: short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00039116

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2565nts        
Open reading frame : 1 to 2565
Reference Sequence Alignment

ATGCGGGAGATGGCAGGGGCCTGGCACATGACGGTGGAGCAGAAATTTGGCCTGTTTTCT
GCTGAGATAAAGGAAGCAGACCCCCTGGCTGCCTCGGAAGCAAGTCAACCCAAACCCTGT
CCCCCCGAAGTGACCCCCCACTACATCTGGATCGACTTCCTGGTGCAGCGGTTTGAGATC
GCCAAGTACTGCAGCTCTGACCAAGTGGAGATCTTCTCCAGCCTGCTGCAGCGCTCCATG
TCCCTGAACATCGGCGGGGCCAAGGGGAGCATGAACCGGCACGTGGCGGCCATCGGGCCC
CGCTTCAAGCTGCTGACCCTGGGGCTGTCCCTCCTGCATGCCGATGTGGTTCCAAATGCA
ACCATCCGCAATGTGCTTCGCGAGAAGATCTACTCCACTGCCTTTGACTACTTCAGCTGT
CCCCCAAAGTTCCCTACTCAAGGAGAGAAGCGGCTGCGTGAAGACATAAGCATCATGATT
AAATTTTGGACCGCCATGTTCTCAGATAAGAAGTACCTGACCGCCAGCCAGCTTGTTCCC
CCAGATAATCAGGACACCCGGAGCAACCTGGACATAACTGTCGGCTCTCGGCAACAAGCC
ACCCAAGGCTGGATCAACACATACCCCCTGTCCAGCGGCATGTCCACCATCTCCAAGAAA
TCAGGCATGTCTAAGAAAACCAACCGGGGCTCCCAGCTGCACAAATACTACATGAAGCGC
AGGACGCTGCTGCTGTCCCTGCTGGCCACTGAGATCGAGCGTCTCATCACATGGTACAAC
CCGCTGTCAGCCCCGGAACTGGAACTAGACCAGGCCGGAGAGAACAGCGTGGCCAACTGG
AGATCTAAGTACATCAGCCTGAGTGAGAAGCAGTGGAAGGACAACGTGAACCTCGCCTGG
AGCATCTCTCCCTACCTAGCCGTGCAGCTGCCTGCCAGGTTTAAGAACACAGAAGCCATT
GGGAACGAAGTGACCCGTCTCGTTCGGTTGGACCCGGGAGCCGTTAGTGATGTGCCTGAA
GCAATCAAGTTCCTGGTCACCTGGCACACCATCGACGCCGATGCTCCAGAGCTCAGCCAT
GTGCTGTGCTGGGCGCCCACGGACCCACCCACAGGCCTCTCCTACTTCTCCAGCATGTAC
CCGCCGCACCCTCTCACGGCGCAGTACGGGGTGAAAGTCCTGCGGTCCTTCCCTCCGGAC
GCCATCCTCTTCTACATCCCCCAGATTGTGCAGGCCCTCAGGTACGACAAGATGGGCTAT
GTGCGGGAGTATATTCTGTGGGCAGCGTCTAAATCCCAGCTTCTGGCACACCAGTTCATC
TGGAACATGAAGACTAACATTTATCTAGATGAAGAGGGCCACCAGAAAGACCCTGACATC
GGCGACCTCCTGGATCAGTTGGTAGAGGAGATCACAGGCTCCTTGTCCGGCCCAGCGAAG
GACTTTTACCAGCGGGAGTTTGATTTCTTTAACAAGATCACCAACGTGTCGGCTATCATC
AAGCCCTACCCTAAAGGCGACGAGAGAAAGAAGGCTTGTCTGTCGGCCCTGTCTGAAGTG
AAGGTGCAGCCGGGCTGCTACCTGCCCAGCAACCCTGAGGCCATTGTGCTGGACATCGAC
TACAAGTCTGGGACCCCGATGCAGAGTGCTGCAAAAGCCCCATATCTGGCCAAGTTCAAG
GTGAAGCGATGTGGAGTTAGTGAACTTGAAAAAGAAGGTCTGCGGTGCCGCTCAGACTCC
GAGGATGAGTGCAGCACGCAGGAGGCCGACGGCCAGAAGATCTCCTGGCAGGCAGCCATC
TTCAAGGTGGGAGACGACTGCCGGCAGGACATGCTGGCCCTGCAGATCATCGACCTCTTC
AAGAACATCTTCCAGCTGGTCGGCCTGGACCTCTTTGTTTTTCCCTACCGCGTGGTGGCC
ACTGCCCCTGGGTGCGGGGTGATCGAGTGCATCCCCGACTGCACCTCCCGGGACCAGCTG
GGCCGCCAGACAGACTTCGGCATGTACGACTACTTCACACGCCAGTACGGGGATGAGTCC
ACTCTGGCCTTCCAGCAGGCCCGCTACAACTTCATCCGAAGCATGGCCGCCTACAGCCTC
CTGCTGTTCCTGCTGCAGATCAAGGACAGACACAACGGCAACATTATGCTGGACAAGAAG
GGTCATATCATCCACATCGACTTTGGCTTCATGTTTGAAAGCTCGCCGGGCGGCAATCTC
GGCTGGGAACCCGACATCAAGCTGACGGATGAGATGGTGATGATCATGGGGGGCAAGATG
GAGGCCACACCCTTCAAGTGGTTCATGGAGATGTGTGTCCGAGGCTACCTGGCTGTGCGG
CCCTACATGGACGCGGTCGTCTCCCTGGTCACTCTCATGTTGGACACGGGCCTGCCCTGT
TTTCGCGGCCAGACAATCAAGCTCTTGAAGCACAGGTTTAGCCCCAACATGACTGAGCGC
GAGGCTGCAAATTTCATCATGAAGGTCATCCAGAGCTGCTTCCTCAGCAACAGGAGCCGG
ACCTACGACATGATCCAGTACTATCAGAATGACATCCCCTACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
Start on reference sequence 149
End on reference sequence 2713
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  mammalian    Marker:  blasticidin
Host Type:  bacterial    Marker:  chloramphenicol
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PI4KA
Symbol Nomenclature : PI4KA
SYNONYM : PI4K-ALPHA; PIK4CA; pi4K230
Designation : PI4-kinase alpha|phosphatidylinositol 4-kinase 230|phosphatidylinositol 4-kinase alpha|phosphatidylinositol 4-kinase, type III, alpha|ptdIns-4-kinase alpha
Full Nomenclature : phosphatidylinositol 4-kinase, catalytic, alpha
GENEID : 5297
HGNC : 8983
MIM : 600286
Vega : OTTHUMG00000167440
Target GenBank: BC018120

 

Reference Sequence Alignment

  

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         ATGGCGGCGGCCCCGGCCCGGGGAGGCGGAGGCGGAGGCGGAGGCGGCGGCGGCTGCTCC
XM_005261634.1      ---------ATGCACCTACGCCTGCGCCCTGAGGTCGGGCGCTCGCGGGCCAGGAGCGGG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         GGCTCCGGCTCCAGCGCCTCGCGGGGCTTCTATTTCAACACGGTCCTGTCACTGGCCCGC
XM_005261634.1      GAGCCGGCGGGCAGCGCCGCGGCTCGTGAGGTGATGGCGGCGGCCCCGGCCCGGGGAGGC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         TCCCTGGCGGTGCAGAGACCAGCATCCTTGGAGAAGGTCCAAAAGCTTCTTTGCATGTGT
XM_005261634.1      GGAGGCGGAGGCGGAGGCGGCGGCGGCTGCTCCGGCTCCGGCTCCAGCGCCTCGCGGGGC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         CCAGTGGATTTCCATGGGATCTTCCAGTTAGATGAAAGACGGAGAGATGCAGTGATTGCA
XM_005261634.1      TTCTATTTCAACACGGTCCTGTCACTGGCCCGCTCCCTGGCGGTGCAGAGACCAGCATCC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         TTGGGCATTTTTCTGATTGAATCTGATCTTCAGCACAAAGATTGTGTGGTTCCTTACCTT
XM_005261634.1      TTGGAGAAGGTCCAAAAGCTTCTTTGCATGTGTCCAGTGGATTTCCATGGGATCTTCCAG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         CTTCGACTTCTCAAAGGTCTTCCAAAAGTGTATTGGGTAGAAGAAAGCACAGCTCGGAAA
XM_005261634.1      TTAGATGAAAGACGGAGAGATGCAGTGATTGCATTGGGCATTTTTCTGATTGAATCTGAT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         GGCAGAGGTGCCCTCCCGGTTGCAGAGAGCTTCAGCTTCTGCTTGGTAACTCTGCTGTCT
XM_005261634.1      CTTCAGCACAAAGATTGTGTGGTTCCTTACCTTCTTCGACTTCTCAAAGGTCTTCCAAAA
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         GATGTGGCCTATAGGGATCCTTCACTTAGGGATGAGATTTTAGAGGTGCTTTTGCAGGTT
XM_005261634.1      GTGTATTGGGTAGAAGAAAGCACAGCTCGGAAAGGCAGAGGTGCCCTCCCGGTTGCAGAG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         TTGCATGTCCTCTTGGGGATGTGCCAGGCCTTGGAGATTCAAGACAAAGAATACCTTTGC
XM_005261634.1      AGCTTCAGCTTCTGCTTGGTAACTCTGCTGTCTGATGTGGCCTATAGGGATCCTTCACTT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         AAGTATGCTATCCCATGCCTGATAGGAATCTCGCGAGCATTTGGGCGTTACAGCAACATG
XM_005261634.1      AGGGATGAGATTTTAGAGGTGCTTTTGCAGGTTTTGCATGTCCTCTTGGGGATGTGCCAG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         GAAGAGTCTCTCCTCTCAAAGCTCTTTCCCAAAATCCCTCCTCATTCCCTCCGTGTCCTG
XM_005261634.1      GCCTTGGAGATTCAAGACAAAGAATACCTTTGCAAGTATGCTATCCCATGCCTGATAGGA
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         GAAGAGCTTGAAGGTGTTCGAAGGCGTTCCTTTAATGACTTCCGCTCCATCCTCCCCAGC
XM_005261634.1      ATCTCGCGAGCATTTGGGCGTTACAGCAACATGGAAGAGTCTCTCCTCTCAAAGCTCTTT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         AATCTGCTGACTGTCTGTCAGGAGGGTACCCTGAAGAGGAAAACCAGCAGTGTGTCCAGC
XM_005261634.1      CCCAAAATCCCTCCTCATTCCCTCCGTGTCCTGGAAGAGCTTGAAGGTGTTCGAAGGCGT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         ATCTCTCAGGTCAGCCCTGAACGCGGCATGCCCCCTCCCAGTTCCCCTGGAGGATCTGCC
XM_005261634.1      TCCTTTAATGACTTCCGCTCCATCCTCCCCAGCAATCTGCTGACTGTCTGTCAGGAGGGT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         TTTCACTACTTTGAAGCCTCCTGCTTGCCCGATGGGACTGCCCTAGAGCCTGAGTACTAC
XM_005261634.1      ACCCTGAAGAGGAAAACCAGCAGTGTGTCCAGCATCTCTCAGGTCAGCCCTGAACGCGGC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         TTTTCAACCATCAGCTCCAGCTTCTCAGTCTCTCCCCTTTTCAACGGTGTCACATATAAG
XM_005261634.1      ATGCCCCCTCCCAGTTCCCCTGGAGGATCTGCCTTTCACTACTTTGAAGCCTCCTGCTTG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         GAGTTTAACATTCCATTGGAAATGCTTCGGGAACTCTTAAACCTGGTGAAGAAGATCGTT
XM_005261634.1      CCCGATGGGACTGCCCTAGAGCCTGAGTACTACTTTTCAACCATCAGCTCCAGCTTCTCA
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         GAGGAGGCTGTTCTCAAATCTTTGGATGCCATTGTAGCCAGTGTGATGGAGGCCAACCCC
XM_005261634.1      GTCTCTCCCCTTTTCAACGGTGTCACATATAAGGAGTTTAACATTCCATTGGAAATGCTT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ------------------------------------------------------------
NM_058004.3         AGTGCTGATCTCTACTACACTTCCTTCAGTGACCCTCTCTACCTGACCATGTTCAAGATG
XM_005261634.1      CGGGAACTCTTAAACCTGGTGAAGAAGATCGTTGAGGAGGCTGTTCTCAAATCTTTGGAT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ---------------------------------ATGCACCTACGCCTGCGCCCTGAGGTC
NM_058004.3         CTGCGTGACACTCTGTACTACATGAAGGACCTCCCGACCTCTTTTGTGAAGGAGATCCAT
XM_005261634.1      GCCATTGTAGCCAGTGTGATGGAGGCCAACCCCAGTGCTGATCTCTACTACACTTCCTTC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GGGCGCTCGCGGGCCAGGAGCGGGGAGCCGGCGGGCAGCGCCGCGGCTCGTGAGGTGATG
NM_058004.3         GATTTTGTGCTGGAGCAGTTCAACACGAGCCAGGGGGAGCTCCAGAAGATTCTACATGAC
XM_005261634.1      AGTGACCCTCTCTACCTGACCATGTTCAAGATGCTGCGTGACACTCTGTACTACATGAAG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GCGGCGGCCCCGGCCCGGGGAGGCGGAGGCGGAGGCGGAGGCGGCGGCGGCTGCTCCGGC
NM_058004.3         GCAGACCGGATCCACAATGAGCTGAGCCCCCTCAAACTGCGCTGTCAGGCGAATGCTGCC
XM_005261634.1      GACCTCCCGACCTCTTTTGTGAAGGAGATCCATGATTTTGTGCTGGAGCAGTTCAACACG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TCCGGCTCCAGCGCCTCGCGGGGCTTCTATTTCAACACGGTCCTGTCACTGGCCCGCTCC
NM_058004.3         TGTGTGGACCTCATGGTGTGGGCTGTGAAGGACGAGCAGGGTGCAGAAAACCTTTGCATC
XM_005261634.1      AGCCAGGGGGAGCTCCAGAAGATTCTACATGACGCAGACCGGATCCACAATGAGCTGAGC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      CTGGCGGTGCAGAGACCAGCATCCTTGGAGAAGGTCCAAAAGCTTCTTTGCATGTGTCCA
NM_058004.3         AAGCTATCTGAGAAGCTGCAGTCCAAGACGTCCAGCAAAGTCATTATTGCTCACTTGCCC
XM_005261634.1      CCCCTCAAACTGCGCTGTCAGGCGAATGCTGCCTGTGTGGACCTCATGGTGTGGGCTGTG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GTGGATTTCCATGGGATCTTCCAGTTAGATGAAAGACGGAGAGATGCAGTGATTGCATTG
NM_058004.3         CTGCTGATCTGCTGTCTGCAGGGTTTGGGCCGCCTGTGCGAGAGGTTCCCGGTGGTGGTG
XM_005261634.1      AAGGACGAGCAGGGTGCAGAAAACCTTTGCATCAAGCTATCTGAGAAGCTGCAGTCCAAG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GGCATTTTTCTGATTGAATCTGATCTTCAGCACAAAGATTGTGTGGTTCCTTACCTTCTT
NM_058004.3         CACTCTGTGACACCGTCCTTGCGAGACTTCCTGGTCATCCCGTCCCCAGTTCTGGTGAAG
XM_005261634.1      ACGTCCAGCAAAGTCATTATTGCTCACTTGCCCCTGCTGATCTGCTGTCTGCAGGGTTTG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      CGACTTCTCAAAGGTCTTCCAAAAGTGTATTGGGTAGAAGAAAGCACAGCTCGGAAAGGC
NM_058004.3         CTCTACAAGTACCACAGTCAGTACCACACAGTTGCTGGCAATGATATAAAAATCAGTGTG
XM_005261634.1      GGCCGCCTGTGCGAGAGGTTCCCGGTGGTGGTGCACTCTGTGACACCGTCCTTGCGAGAC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      AGAGGTGCCCTCCCGGTTGCAGAGAGCTTCAGCTTCTGCTTGGTAACTCTGCTGTCTGAT
NM_058004.3         ACCAATGAGCATTCCGAGTCAACCCTGAACGTCATGTCGGGTAAGAAGAGCCAGCCCTCC
XM_005261634.1      TTCCTGGTCATCCCGTCCCCAGTTCTGGTGAAGCTCTACAAGTACCACAGTCAGTACCAC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GTGGCCTATAGGGATCCTTCACTTAGGGATGAGATTTTAGAGGTGCTTTTGCAGGTTTTG
NM_058004.3         ATGTACGAGCAGCTCCGAGACATCGCTATTGACAACATCTGCAGGTGCCTGAAGGCTGGA
XM_005261634.1      ACAGTTGCTGGCAATGATATAAAAATCAGTGTGACCAATGAGCATTCCGAGTCAACCCTG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      CATGTCCTCTTGGGGATGTGCCAGGCCTTGGAGATTCAAGACAAAGAATACCTTTGCAAG
NM_058004.3         TTGACGGTGGACCCAGTGATTGTGGAGGCGTTCTTGGCCAGCCTGTCCAACCGGCTCTAC
XM_005261634.1      AACGTCATGTCGGGTAAGAAGAGCCAGCCCTCCATGTACGAGCAGCTCCGAGACATCGCT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TATGCTATCCCATGCCTGATAGGAATCTCGCGAGCATTTGGGCGTTACAGCAACATGGAA
NM_058004.3         ATCTCTCAGGAGAGCGACAAGGACGCTCACTTGATTCCCGACCACACAATCCGAGCCTTG
XM_005261634.1      ATTGACAACATCTGCAGGTGCCTGAAGGCTGGATTGACGGTGGACCCAGTGATTGTGGAG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GAGTCTCTCCTCTCAAAGCTCTTTCCCAAAATCCCTCCTCATTCCCTCCGTGTCCTGGAA
NM_058004.3         GGACACATTGCGGTGGCCTTGAGGGACACCCCGAAGGTCATGGAGCCCATTCTGCAGATC
XM_005261634.1      GCGTTCTTGGCCAGCCTGTCCAACCGGCTCTACATCTCTCAGGAGAGCGACAAGGACGCT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GAGCTTGAAGGTGTTCGAAGGCGTTCCTTTAATGACTTCCGCTCCATCCTCCCCAGCAAT
NM_058004.3         CTACAGCAGAAATTCTGCCAGCCACCCTCCCCCCTCGATGTGCTGATTATTGACCAGCTG
XM_005261634.1      CACTTGATTCCCGACCACACAATCCGAGCCTTGGGACACATTGCGGTGGCCTTGAGGGAC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      CTGCTGACTGTCTGTCAGGAGGGTACCCTGAAGAGGAAAACCAGCAGTGTGTCCAGCATC
NM_058004.3         GGCTGCCTGGTTATCACCGGAAATCAATACATCTATCAGGAAGTGTGGAACCTCTTCCAG
XM_005261634.1      ACCCCGAAGGTCATGGAGCCCATTCTGCAGATCCTACAGCAGAAATTCTGCCAGCCACCC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TCTCAGGTCAGCCCTGAACGCGGCATGCCCCCTCCCAGTTCCCCTGGAGGATCTGCCTTT
NM_058004.3         CAGATCAGTGTGAAGGCCAGCTCCGTTGTATACTCAGCCACCAAAGATTACAAGGACCAC
XM_005261634.1      TCCCCCCTCGATGTGCTGATTATTGACCAGCTGGGCTGCCTGGTTATCACCGGAAATCAA
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      CACTACTTTGAAGCCTCCTGCTTGCCCGATGGGACTGCCCTAGAGCCTGAGTACTACTTT
NM_058004.3         GGCTATAGGCATTGCTCCCTGGCAGTGATTAATGCCCTGGCCAACATCGCGGCCAACATC
XM_005261634.1      TACATCTATCAGGAAGTGTGGAACCTCTTCCAGCAGATCAGTGTGAAGGCCAGCTCCGTT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TCAACCATCAGCTCCAGCTTCTCAGTCTCTCCCCTTTTCAACGGTGTCACATATAAGGAG
NM_058004.3         CAAGACGAGCACCTGGTGGATGAGCTGCTCATGAACCTGTTGGAGTTGTTTGTGCAGCTG
XM_005261634.1      GTATACTCAGCCACCAAAGATTACAAGGACCACGGCTATAGGCATTGCTCCCTGGCAGTG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TTTAACATTCCATTGGAAATGCTTCGGGAACTCTTAAACCTGGTGAAGAAGATCGTTGAG
NM_058004.3         GGGCTGGAGGGGAAGCGAGCCAGCGAGAGGGCAAGCGAGAAGGGCCCTGCCCTAAAGGCT
XM_005261634.1      ATTAATGCCCTGGCCAACATCGCGGCCAACATCCAAGACGAGCACCTGGTGGATGAGCTG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GAGGCTGTTCTCAAATCTTTGGATGCCATTGTAGCCAGTGTGATGGAGGCCAACCCCAGT
NM_058004.3         TCTAGCAGTGCAGGGAACTTGGGAGTACTCATTCCTGTAATAGCTGTGCTCACCCGACGA
XM_005261634.1      CTCATGAACCTGTTGGAGTTGTTTGTGCAGCTGGGGCTGGAGGGGAAGCGAGCCAGCGAG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GCTGATCTCTACTACACTTCCTTCAGTGACCCTCTCTACCTGACCATGTTCAAGATGCTG
NM_058004.3         CTGCCACCCATCAAAGAAGCTAAGCCTCGGTTACAGAAGCTCTTCCGAGACTTCTGGCTG
XM_005261634.1      AGGGCAAGCGAGAAGGGCCCTGCCCTAAAGGCTTCTAGCAGTGCAGGGAACTTGGGAGTA
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      CGTGACACTCTGTACTACATGAAGGACCTCCCGACCTCTTTTGTGAAGGAGATCCATGAT
NM_058004.3         TATTCCGTTCTGATGGGATTCGCTGTGGAGGGCTCAGGACTCTGGCCAGAAGAATGGTAC
XM_005261634.1      CTCATTCCTGTAATAGCTGTGCTCACCCGACGACTGCCACCCATCAAAGAAGCTAAGCCT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TTTGTGCTGGAGCAGTTCAACACGAGCCAGGGGGAGCTCCAGAAGATTCTACATGACGCA
NM_058004.3         GAGGGGGTCTGTGAAATAGCCACTAAGTCCCCCTTGCTCACCTTTCCCAGCAAGGAGCCA
XM_005261634.1      CGGTTACAGAAGCTCTTCCGAGACTTCTGGCTGTATTCCGTTCTGATGGGATTCGCTGTG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GACCGGATCCACAATGAGCTGAGCCCCCTCAAACTGCGCTGTCAGGCGAATGCTGCCTGT
NM_058004.3         CTGCGGTCCGTCCTCCAGTATAACTCAGCCATGAAGAATGACACGGTCACCCCCGCTGAG
XM_005261634.1      GAGGGCTCAGGACTCTGGCCAGAAGAATGGTACGAGGGGGTCTGTGAAATAGCCACTAAG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GTGGACCTCATGGTGTGGGCTGTGAAGGACGAGCAGGGTGCAGAAAACCTTTGCATCAAG
NM_058004.3         CTGAGTGAGCTCCGCAGCACTATCATCAACCTGCTGGACCCCCCTCCCGAGGTGTCCGCA
XM_005261634.1      TCCCCCTTGCTCACCTTTCCCAGCAAGGAGCCACTGCGGTCCGTCCTCCAGTATAACTCA
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      CTATCTGAGAAGCTGCAGTCCAAGACGTCCAGCAAAGTCATTATTGCTCACTTGCCCCTG
NM_058004.3         CTCATCAACAAGCTGGACTTCGCCATGTCCACCTACCTCCTCTCTGTGTACCGGCTGGAG
XM_005261634.1      GCCATGAAGAATGACACGGTCACCCCCGCTGAGCTGAGTGAGCTCCGCAGCACTATCATC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      CTGATCTGCTGTCTGCAGGGTTTGGGCCGCCTGTGCGAGAGGTTCCCGGTGGTGGTGCAC
NM_058004.3         TACATGAGGGTACTGCGTTCAACAGATCCTGATCGCTTCCAGGTAATGTTCTGCTACTTT
XM_005261634.1      AACCTGCTGGACCCCCCTCCCGAGGTGTCCGCACTCATCAACAAGCTGGACTTCGCCATG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TCTGTGACACCGTCCTTGCGAGACTTCCTGGTCATCCCGTCCCCAGTTCTGGTGAAGCTC
NM_058004.3         GAGGATAAAGCTATTCAGAAAGACAAATCTGGGATGATGCAGTGTGTGATTGCAGTCGCG
XM_005261634.1      TCCACCTACCTCCTCTCTGTGTACCGGCTGGAGTACATGAGGGTACTGCGTTCAACAGAT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TACAAGTACCACAGTCAGTACCACACAGTTGCTGGCAATGATATAAAAATCAGTGTGACC
NM_058004.3         GACAAAGTATTCGATGCCTTCCTGAACATGATGGCGGATAAAGCCAAGACCAAGGAGAAC
XM_005261634.1      CCTGATCGCTTCCAGGTAATGTTCTGCTACTTTGAGGATAAAGCTATTCAGAAAGACAAA
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      AATGAGCATTCCGAGTCAACCCTGAACGTCATGTCGGGTAAGAAGAGCCAGCCCTCCATG
NM_058004.3         GAGGAGGAGCTGGAGCGGCACGCTCAGTTCCTGTTGGTGAACTTCAACCACATCCACAAG
XM_005261634.1      TCTGGGATGATGCAGTGTGTGATTGCAGTCGCGGACAAAGTATTCGATGCCTTCCTGAAC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TACGAGCAGCTCCGAGACATCGCTATTGACAACATCTGCAGGTGCCTGAAGGCTGGATTG
NM_058004.3         AGGATAAGGAGGGTGGCAGACAAGTATCTATCTGGTCTGGTGGATAAGTTTCCCCACTTG
XM_005261634.1      ATGATGGCGGATAAAGCCAAGACCAAGGAGAACGAGGAGGAGCTGGAGCGGCACGCTCAG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ACGGTGGACCCAGTGATTGTGGAGGCGTTCTTGGCCAGCCTGTCCAACCGGCTCTACATC
NM_058004.3         CTCTGGAGCGGGACTGTGCTGAAGACCATGCTGGACATCCTGCAGACCCTGTCACTGTCA
XM_005261634.1      TTCCTGTTGGTGAACTTCAACCACATCCACAAGAGGATAAGGAGGGTGGCAGACAAGTAT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TCTCAGGAGAGCGACAAGGACGCTCACTTGATTCCCGACCACACAATCCGAGCCTTGGGA
NM_058004.3         CTGAGCGCTGATATTCACAAGGATCAGCCTTACTATGACATCCCCGACGCCCCCTACCGG
XM_005261634.1      CTATCTGGTCTGGTGGATAAGTTTCCCCACTTGCTCTGGAGCGGGACTGTGCTGAAGACC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      CACATTGCGGTGGCCTTGAGGGACACCCCGAAGGTCATGGAGCCCATTCTGCAGATCCTA
NM_058004.3         ATCACGGTTCCTGACACGTACGAAGCCCGTGAGAGCATTGTGAAGGACTTCGCTGCACGC
XM_005261634.1      ATGCTGGACATCCTGCAGACCCTGTCACTGTCACTGAGCGCTGATATTCACAAGGATCAG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      CAGCAGAAATTCTGCCAGCCACCCTCCCCCCTCGATGTGCTGATTATTGACCAGCTGGGC
NM_058004.3         TGTGGGATGATCCTCCAGGAGGCCATGAAGTGGGCACCTACCGTCACCAAGTCCCACCTG
XM_005261634.1      CCTTACTATGACATCCCCGACGCCCCCTACCGGATCACGGTTCCTGACACGTACGAAGCC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TGCCTGGTTATCACCGGAAATCAATACATCTATCAGGAAGTGTGGAACCTCTTCCAGCAG
NM_058004.3         CAGGAATATCTGAACAAACATCAGAACTGGGTATCGGGACTGTCCCAGCACACGGGGCTG
XM_005261634.1      CGTGAGAGCATTGTGAAGGACTTCGCTGCACGCTGTGGGATGATCCTCCAGGAGGCCATG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ATCAGTGTGAAGGCCAGCTCCGTTGTATACTCAGCCACCAAAGATTACAAGGACCACGGC
NM_058004.3         GCCATGGCCACTGAGAGCATCCTTCACTTTGCTGGCTACAACAAGCAGAACACAACTCTT
XM_005261634.1      AAGTGGGCACCTACCGTCACCAAGTCCCACCTGCAGGAATATCTGAACAAACATCAGAAC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TATAGGCATTGCTCCCTGGCAGTGATTAATGCCCTGGCCAACATCGCGGCCAACATCCAA
NM_058004.3         GGGGCAACTCAGCTGAGCGAGCGCCCGGCCTGTGTGAAGAAAGACTACTCCAACTTCATG
XM_005261634.1      TGGGTATCGGGACTGTCCCAGCACACGGGGCTGGCCATGGCCACTGAGAGCATCCTTCAC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GACGAGCACCTGGTGGATGAGCTGCTCATGAACCTGTTGGAGTTGTTTGTGCAGCTGGGG
NM_058004.3         GCATCCCTGAATCTGCGCAACCGCTACGCGGGCGAGGTGTATGGAATGATTCGGTTCTCA
XM_005261634.1      TTTGCTGGCTACAACAAGCAGAACACAACTCTTGGGGTGTATGGAATGATTCGGTTCTCA
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      CTGGAGGGGAAGCGAGCCAGCGAGAGGGCAAGCGAGAAGGGCCCTGCCCTAAAGGCTTCT
NM_058004.3         GGCACCACAGGCCAGATGTCTGACCTGAACAAAATGATGGTCCAGGATCTACATTCAGCT
XM_005261634.1      GGCACCACAGGCCAGATGTCTGACCTGAACAAAATGATGGTCCAGGATCTACATTCAGCT
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      AGCAGTGCAGGGAACTTGGGAGTACTCATTCCTGTAATAGCTGTGCTCACCCGACGACTG
NM_058004.3         TTAGACCGCAGTCATCCTCAGCACTACACGCAGGCCATGTTCAAGCTGACCGCAATGCTC
XM_005261634.1      TTAGACCGCAGTCATCCTCAGCACTACACGCAGGCCATGTTCAAGCTGACCGCAATGCTC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      CCACCCATCAAAGAAGCTAAGCCTCGGTTACAGAAGCTCTTCCGAGACTTCTGGCTGTAT
NM_058004.3         ATTAGCAGTAAAGATTGTGACCCGCAGCTCCTTCATCATCTGTGCTGGGGTCCCCTCCGG
XM_005261634.1      ATTAGCAGTAAAGATTGTGACCCGCAGCTCCTTCATCATCTGTGCTGGGGTCCCCTCCGG
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      TCCGTTCTGATGGGATTCGCTGTGGAGGGCTCAGGACTCTGGCCAGAAGAATGGTACGAG
NM_058004.3         ATGTTCAATGAGCATGGCATGGAGACGGCCCTGGCCTGCTGGGAGTGGCTGCTGGCTGGC
XM_005261634.1      ATGTTCAATGAGCATGGCATGGAGACGGCCCTGGCCTGCTGGGAGTGGCTGCTGGCTGGC
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------ATGCGGGAGATGGCAGGGGCCTGGCACATGACGGTG
XM_005261635.1      GGGGTCTGTGAAATAGCCACTAAGTCCCCCTTGCTCACCTTTCCCAGCAAGGAGCCACTG
NM_058004.3         AAGGATGGAGTGGAAGTGCCGTTCATGCGGGAGATGGCAGGGGCCTGGCACATGACGGTG
XM_005261634.1      AAGGATGGAGTGGAAGTGCCGTTCATGCGGGAGATGGCAGGGGCCTGGCACATGACGGTG
NM_002650.2         ------------------------ATGCGGGAGATGGCAGGGGCCTGGCACATGACGGTG
                                            :  *   :*.* .*.    **:* .* .:*.*. **

HsCD00039116        GAGCAGAAATTTGGCCTGTTTTCTGCTGAGATAAAGGAAGCAGACCCCCTGGCTGCCTCG
XM_005261635.1      CGGTCCGTCCTCCAGTATAACTCAGCCATGAAGAATGACACGGTCACCCCCGCTGAGCTG
NM_058004.3         GAGCAGAAATTTGGCCTGTTTTCTGCTGAGATAAAGGAAGCAGACCCCCTGGCTGCCTCG
XM_005261634.1      GAGCAGAAATTTGGCCTGTTTTCTGCTGAGATAAAGGAAGCAGACCCCCTGGCTGCCTCG
NM_002650.2         GAGCAGAAATTTGGCCTGTTTTCTGCTGAGATAAAGGAAGCAGACCCCCTGGCTGCCTCG
                     .* . .:. *  .  : :: **:** .:**:.** **..*.*:*.***  ****.   *

HsCD00039116        GAAGCAAGTCAACCCAAACCCTGTCCCCCCGAAGTGACCCCCCACTACATCTGGATCGAC
XM_005261635.1      AGTGAGCTCCGCAGCACTATCATCAACCTGCTGGACCCCCCTCCCGAGGTGTCCGCACTC
NM_058004.3         GAAGCAAGTCAACCCAAACCCTGTCCCCCCGAAGTGACCCCCCACTACATCTGGATCGAC
XM_005261634.1      GAAGCAAGTCAACCCAAACCCTGTCCCCCCGAAGTGACCCCCCACTACATCTGGATCGAC
NM_002650.2         GAAGCAAGTCAACCCAAACCCTGTCCCCCCGAAGTGACCCCCCACTACATCTGGATCGAC
                    ..:*...  *... **.:. *:  ..**   :.*: .**** *.* * .* *  . . :*

HsCD00039116        TTCCTGGTGCAGCGGTTTGAGATCGCCAAGTACTGCAGCTCTGACCAAG-----------
XM_005261635.1      ATCAACAAGCTGGACTTCGCCATGTCCACCTACCTCCTCTCTGTGTACCGGCTGGAGTAC
NM_058004.3         TTCCTGGTGCAGCGGTTTGAGATCGCCAAGTACTGCAGCTCTGACCAAG-----------
XM_005261634.1      TTCCTGGTGCAGCGGTTTGAGATCGCCAAGTACTGCAGCTCTGACCAAG-----------
NM_002650.2         TTCCTGGTGCAGCGGTTTGAGATCGCCAAGTACTGCAGCTCTGACCAAG-----------
                    :**.: .:**:* . ** *. **  ***. ***  *. *****:  *.            

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ATGAGGGTACTGCGTTCAACAGATCCTGATCGCTTCCAGGTAATGTTCTGCTACTTTGAG
NM_058004.3         ------------------------------------------------------------
XM_005261634.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      GATAAAGCTATTCAGAAAGACAAATCTGGGATGATGCAGTGTGTGATTGCAGTCGCGGAC
NM_058004.3         ------------------------------------------------------------
XM_005261634.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      AAAGTATTCGATGCCTTCCTGAACATGATGGCGGATAAAGCCAAGACCAAGGAGAACGAG
NM_058004.3         ------------------------------------------------------------
XM_005261634.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        -------------------------------TGGAGATCTTCTCCAGCCTGCTGCAGCGC
XM_005261635.1      GAGGAGCTGGAGCGGCACGCTCAGTTCCTGTTGGTGAACTTCAACCACATCCACAAGAGG
NM_058004.3         -------------------------------TGGAGATCTTCTCCAGCCTGCTGCAGCGC
XM_005261634.1      -------------------------------TGGAGATCTTCTCCAGCCTGCTGCAGCGC
NM_002650.2         -------------------------------TGGAGATCTTCTCCAGCCTGCTGCAGCGC
                                                   ***:**:****:.*..*.* *: .**.* 

HsCD00039116        TCCATGTCCCTGAACATCGGCGGGGCCAAGGGGAGCATGAACCGGCACGTGGCGGCCATC
XM_005261635.1      ATAAGGAGGGTGGCAGACAAGTATCTATCTGGTCTGGTGGATAAGTTTCCCCACTTGCTC
NM_058004.3         TCCATGTCCCTGAACATCGGCGGGGCCAAGGGGAGCATGAACCGGCACGTGGCGGCCATC
XM_005261634.1      TCCATGTCCCTGAACATCGGCGGGGCCAAGGGGAGCATGAACCGGCACGTGGCGGCCATC
NM_002650.2         TCCATGTCCCTGAACATCGGCGGGGCCAAGGGGAGCATGAACCGGCACGTGGCGGCCATC
                    : .* *:   **....:*..  .   .:. ** .  .**.* ..* :     .    .**

HsCD00039116        GGGCCCCGCTTCAAGCTGCTGACCCTGGGGCTGTCCCTCCTGCATGCCGATGTGGTTCCA
XM_005261635.1      TGGAGCGGGACTGTGCTGAAGACCATGCTGGACATCCTGCAGACCCTGTCACTGTCACTG
NM_058004.3         GGGCCCCGCTTCAAGCTGCTGACCCTGGGGCTGTCCCTCCTGCATGCCGATGTGGTTCCA
XM_005261634.1      GGGCCCCGCTTCAAGCTGCTGACCCTGGGGCTGTCCCTCCTGCATGCCGATGTGGTTCCA
NM_002650.2         GGGCCCCGCTTCAAGCTGCTGACCCTGGGGCTGTCCCTCCTGCATGCCGATGTGGTTCCA
                     **. * * :  .:****.:****.**  * : : *** *:*..     .: **  :* .

HsCD00039116        AATGCAACCATCCGCAATGTGCTTCGCGAGAAGATCTACTCCACTGCCTTTGACTACTTC
XM_005261635.1      AGCGCTGATATTCACAAGGATCAGCCTTACTATGACATCCCCGACGCCCCCTACCGGATC
NM_058004.3         AATGCAACCATCCGCAATGTGCTTCGCGAGAAGATCTACTCCACTGCCTTTGACTACTTC
XM_005261634.1      AATGCAACCATCCGCAATGTGCTTCGCGAGAAGATCTACTCCACTGCCTTTGACTACTTC
NM_002650.2         AATGCAACCATCCGCAATGTGCTTCGCGAGAAGATCTACTCCACTGCCTTTGACTACTTC
                    *. **:.. ** *.*** *: *: *   * :* .:*::* **.. ***    ** . :**

HsCD00039116        AGCTGTCCCCCAAAGTTCCCTACTCAAGGAGAGAAGCGGCTGCGTGAAGACATAAGCATC
XM_005261635.1      ACGGTTCCTGACACGTACGAAGCCCGTGAGAGCATTGTGAAGGACTTCGCTGCACGCTGT
NM_058004.3         AGCTGTCCCCCAAAGTTCCCTACTCAAGGAGAGAAGCGGCTGCGTGAAGACATAAGCATC
XM_005261634.1      AGCTGTCCCCCAAAGTTCCCTACTCAAGGAGAGAAGCGGCTGCGTGAAGACATAAGCATC
NM_002650.2         AGCTGTCCCCCAAAGTTCCCTACTCAAGGAGAGAAGCGGCTGCGTGAAGACATAAGCATC
                    *    ***  ..*.**:* .:.* *.:*.... *:   *.:* .  :.*. . *.**:  

HsCD00039116        ATGATTAAATTTTGGACCGCCATGTTCTCAGATAAGAAGTACCTGACCGCCAGCCAGCTT
XM_005261635.1      GGGATGATCCTCCAGGAGGCCATGAAGTGGGCACCTACCGTCACCAAGTCCCACCTGCAG
NM_058004.3         ATGATTAAATTTTGGACCGCCATGTTCTCAGATAAGAAGTACCTGACCGCCAGCCAGCTT
XM_005261634.1      ATGATTAAATTTTGGACCGCCATGTTCTCAGATAAGAAGTACCTGACCGCCAGCCAGCTT
NM_002650.2         ATGATTAAATTTTGGACCGCCATGTTCTCAGATAAGAAGTACCTGACCGCCAGCCAGCTT
                    . *** *:. *  .*.. ******:: * .*.:.. *.  :*.  *.  **..**:**: 

HsCD00039116        GTTCCCCCAGATAATCAGGACACCCGG---------------------------------
XM_005261635.1      GAATATCTGAACAAACATCAGAACTGGGTATCGGGACTGTCCCAGCACACGGGGCTGGCC
NM_058004.3         GTTCCCCCAGATAATCAGGACACCCGG---------------------------------
XM_005261634.1      GTTCCCCCAGATAATCAGGACACCCGG---------------------------------
NM_002650.2         GTTCCCCCAGATAATCAGGACACCCGG---------------------------------
                    *:: . * ..* **:**  * *.* **                                 

HsCD00039116        ------------------------------------------------------------
XM_005261635.1      ATGGCCACTGAGAGCATCCTTCACTTTGCTGGCTACAACAAGCAGAACACAACTCTTGGG
NM_058004.3         ------------------------------------------------------------
XM_005261634.1      ------------------------------------------------------------
NM_002650.2         ------------------------------------------------------------
                                                                                

HsCD00039116        ------------------------------------AGCAACCTGGACATAACTGTCGGC
XM_005261635.1      GCAACTCAGCTGAGCGAGCGCCCGGCCTGTGTGAAGAAAGACTACTCCAACTTCATGGCA
NM_058004.3         ------------------------------------AGCAACCTGGACATAACTGTCGGC
XM_005261634.1      ------------------------------------AGCAACCTGGACATAACTGTCGGC
NM_002650.2         ------------------------------------AGCAACCTGGACATAACTGTCGGC
                                                        *...** :  .**:.:  .* * .

HsCD00039116        TCTCGGCAACAAGCCACCCAAGGCTGGATCAACACATACCCCCTGTCCAGCGGCATGTCC
XM_005261635.1      TCCCTGAATCTGCGCAACCGCTACGCGGGCGAGGTGTATGGAATGATTCGGTTCTCAGGC
NM_058004.3         TCTCGGCAACAAGCCACCCAAGGCTGGATCAACACATACCCCCTGTCCAGCGGCATGTCC
XM_005261634.1      TCTCGGCAACAAGCCACCCAAGGCTGGATCAACACATACCCCCTGTCCAGCGGCATGTCC
NM_002650.2         TCTCGGCAACAAGCCACCCAAGGCTGGATCAACACATACCCCCTGTCCAGCGGCATGTCC
                    ** * *.*:*:.  **.**.. .*  *. *.* . .**   ..**:  .*   *: .  *

HsCD00039116        ACCATCTCCAAGAAATCAGGCATGTCTAAGAAAACCAACCGGGGCTCCCAGCTGCACAAA
XM_005261635.1      ACCACAGGCCAGATGTCTGACCTGAACAAAATGATGGTCCAGGATCTACATTCAGCTTTA
NM_058004.3         ACCATCTCCAAGAAATCAGGCATGTCTAAGAAAACCAACCGGGGCTCCCAGCTGCACAAA
XM_005261634.1      ACCATCTCCAAGAAATCAGGCATGTCTAAGAAAACCAACCGGGGCTCCCAGCTGCACAAA
NM_002650.2         ACCATCTCCAAGAAATCAGGCATGTCTAAGAAAACCAACCGGGGCTCCCAGCTGCACAAA
                    **** .  *.***:.**:*.*.**:. **.*:.*  .:**.**.   .**   . . ::*

HsCD00039116        TACTACATGAAGCGCAGGACGCTGCTGCTGTCCCTGCTGGCCACTGAGATCGAGCGTCTC
XM_005261635.1      GACCGCAGTCATCCTCAGCACTACACGCAGGCCATGTTCAAGCTGACCGCAATGCTCATT
NM_058004.3         TACTACATGAAGCGCAGGACGCTGCTGCTGTCCCTGCTGGCCACTGAGATCGAGCGTCTC
XM_005261634.1      TACTACATGAAGCGCAGGACGCTGCTGCTGTCCCTGCTGGCCACTGAGATCGAGCGTCTC
NM_002650.2         TACTACATGAAGCGCAGGACGCTGCTGCTGTCCCTGCTGGCCACTGAGATCGAGCGTCTC
                     ** .**  .* *  ..*..  : . **:* **.** * .. .  .. . ..:**  .* 

HsCD00039116        ATCACATGGTACAACCCGCTGTCAGCCCCGGAACTGGAACTAGACCAGGCCGGAGAGAAC
XM_005261635.1      AGCAGTAAAGATTGTGACCCGCAGCTCCTTCATCATCTGTGCTGGGGTCCCCTCCGGATG
NM_058004.3         ATCACATGGTACAACCCGCTGTCAGCCCCGGAACTGGAACTAGACCAGGCCGGAGAGAAC
XM_005261634.1      ATCACATGGTACAACCCGCTGTCAGCCCCGGAACTGGAACTAGACCAGGCCGGAGAGAAC
NM_002650.2         ATCACATGGTACAACCCGCTGTCAGCCCCGGAACTGGAACTAGACCAGGCCGGAGAGAAC
                    * ** ::.. * :.  . * * ..  **   *:*:  :.  . .  .  **  . .**: 

HsCD00039116        AGCGTGGCCAACTGGAGATCTAAGTACATCAGCCTGAGTGAGAAGCAGTGGAAGGACAAC
XM_005261635.1      TTCAATGAGCATGGCATGGAGACGGCCCTGGCCTGCTGGGAGTGGCTGCTGGCTGGCAAG
NM_058004.3         AGCGTGGCCAACTGGAGATCTAAGTACATCAGCCTGAGTGAGAAGCAGTGGAAGGACAAC
XM_005261634.1      AGCGTGGCCAACTGGAGATCTAAGTACATCAGCCTGAGTGAGAAGCAGTGGAAGGACAAC
NM_002650.2         AGCGTGGCCAACTGGAGATCTAAGTACATCAGCCTGAGTGAGAAGCAGTGGAAGGACAAC
                    : *.: *. .*  * * . . *.* .*.* . *   :* ***:.**:*  *.. *.*** 

HsCD00039116        GTGAACCTCGCCTGGAGCATCTCTCCCTACCTAGCCGTGCAGCTGCCTGCCAGGTTTAAG
XM_005261635.1      GATGGAGTGGAAGTGCCGTTCATGCGGGAGATGGCAGGGGCCTGGCACATGACGGTGGAG
NM_058004.3         GTGAACCTCGCCTGGAGCATCTCTCCCTACCTAGCCGTGCAGCTGCCTGCCAGGTTTAAG
XM_005261634.1      GTGAACCTCGCCTGGAGCATCTCTCCCTACCTAGCCGTGCAGCTGCCTGCCAGGTTTAAG
NM_002650.2         GTGAACCTCGCCTGGAGCATCTCTCCCTACCTAGCCGTGCAGCTGCCTGCCAGGTTTAAG
                    *: ... * *..  *.  :**:  *   * .*.**.* * .   **. .  * * * .**

HsCD00039116        AACACAGAAGCCATTGGGAACGAAGTGACCCGTCTCGTTCGGTTGGACCCGGGAGCCGTT
XM_005261635.1      CAGAAATTTGGCCTGTTTTCTGCTGAGATAAAGGAAGCAGACCCCCTGGCTGCCTCGGAA
NM_058004.3         AACACAGAAGCCATTGGGAACGAAGTGACCCGTCTCGTTCGGTTGGACCCGGGAGCCGTT
XM_005261634.1      AACACAGAAGCCATTGGGAACGAAGTGACCCGTCTCGTTCGGTTGGACCCGGGAGCCGTT
NM_002650.2         AACACAGAAGCCATTGGGAACGAAGTGACCCGTCTCGTTCGGTTGGACCCGGGAGCCGTT
                    .* *.* ::* *.*    :. *.:*:** ...  :.* : .     :  * * . * *::

HsCD00039116        AGTGATGTGCCTGAAGCAATCAAGTTCCTGGTCACCTGGCACACCATCGACGCCGATGCT
XM_005261635.1      GCAAGTCAACCCAAACCCTGTCCCCCCGAAGTGACCCCCCACTACATCTGGATCGACTTC
NM_058004.3         AGTGATGTGCCTGAAGCAATCAAGTTCCTGGTCACCTGGCACACCATCGACGCCGATGCT
XM_005261634.1      AGTGATGTGCCTGAAGCAATCAAGTTCCTGGTCACCTGGCACACCATCGACGCCGATGCT
NM_002650.2         AGTGATGTGCCTGAAGCAATCAAGTTCCTGGTCACCTGGCACACCATCGACGCCGATGCT
                    . :..* :.** .** *.:  ..   * :.** ***   ***:.**** . . ***    

HsCD00039116        CCAGAGCTCAGCCATGTGCTGTGCTGGGCGCCCACGGACCCACCCACAGGCCTCTCCTAC
XM_005261635.1      CTGGTGCAGCGGTTTGAGATCGCCAAGTACTGCAGCTCTGACCAAGTGGAGATCTTCTCC
NM_058004.3         CCAGAGCTCAGCCATGTGCTGTGCTGGGCGCCCACGGACCCACCCACAGGCCTCTCCTAC
XM_005261634.1      CCAGAGCTCAGCCATGTGCTGTGCTGGGCGCCCACGGACCCACCCACAGGCCTCTCCTAC
NM_002650.2         CCAGAGCTCAGCCATGTGCTGTGCTGGGCGCCCACGGACCCACCCACAGGCCTCTCCTAC
                    * .*:**: .*  :**:*.*   *:.* .   **   .  ..*... .*. .*** **.*

HsCD00039116        TTCTCCAGCATGTACCCGCCGCACCCTCTCACGGCGCAGTACGGGGTGAAAGTCCTGCGG
XM_005261635.1      AGCCTGCTGCAGCGCTCCATGTCCCTGAACATCGGCGGGGCCAAGGGGAGCATGAACCGG
NM_058004.3         TTCTCCAGCATGTACCCGCCGCACCCTCTCACGGCGCAGTACGGGGTGAAAGTCCTGCGG
XM_005261634.1      TTCTCCAGCATGTACCCGCCGCACCCTCTCACGGCGCAGTACGGGGTGAAAGTCCTGCGG
NM_002650.2         TTCTCCAGCATGTACCCGCCGCACCCTCTCACGGCGCAGTACGGGGTGAAAGTCCTGCGG
                    : *   .  .:* .* * . * .**  .:**  *   .* .*..** **...* .: ***

HsCD00039116        TCCTTCCCTCCGGACGCCATCCTCTTCTACATCCCCCAGATTGTGCAGGCCCTCAGGTAC
XM_005261635.1      CACGTGGCGGCCATCGGGCCCCGCTTCAAGCTGCTGACCCTGGGGCTGTCCCTCCTGCAT
NM_058004.3         TCCTTCCCTCCGGACGCCATCCTCTTCTACATCCCCCAGATTGTGCAGGCCCTCAGGTAC
XM_005261634.1      TCCTTCCCTCCGGACGCCATCCTCTTCTACATCCCCCAGATTGTGCAGGCCCTCAGGTAC
NM_002650.2         TCCTTCCCTCCGGACGCCATCCTCTTCTACATCCCCCAGATTGTGCAGGCCCTCAGGTAC
                     .* *  *  * .:**  . ** ****:* .* *  .. .* * **:* *****. * * 

HsCD00039116        GACAAGATGGGCTATGTGCGGGAGTATATTCTGTGGGCAGCGTCTAAATCCCAGCTTCTG
XM_005261635.1      GCCGATGTGGTTCCAAATGCAACCATCCGCAATGTGCTTCGCGAGAAGATCTACTCCACT
NM_058004.3         GACAAGATGGGCTATGTGCGGGAGTATATTCTGTGGGCAGCGTCTAAATCCCAGCTTCTG
XM_005261634.1      GACAAGATGGGCTATGTGCGGGAGTATATTCTGTGGGCAGCGTCTAAATCCCAGCTTCTG
NM_002650.2         GACAAGATGGGCTATGTGCGGGAGTATATTCTGTGGGCAGCGTCTAAATCCCAGCTTCTG
                    *.*.* .***   .:.:   ... :: .  .:   *  :    . **.: * *    .  

HsCD00039116        GCACACCAGTTCATCTGGAACATGAAGACTAACATTTATCTAGATGAAGAGGGCCACCAG
XM_005261635.1      GCCTTTGACTACTTCAGCTGTCCCCCAAAGTTCCCTACTCAAGGAGAGAAGCGGCTGCGT
NM_058004.3         GCACACCAGTTCATCTGGAACATGAAGACTAACATTTATCTAGATGAAGAGGGCCACCAG
XM_005261634.1      GCACACCAGTTCATCTGGAACATGAAGACTAACATTTATCTAGATGAAGAGGGCCACCAG
NM_002650.2         GCACACCAGTTCATCTGGAACATGAAGACTAACATTTATCTAGATGAAGAGGGCCACCAG
                    **. :  * *:*:**:* :. .  ...*. ::*. *:.**:**.:**..** * *: *. 

HsCD00039116        AAAGACCCTG--------------------------------------------------
XM_005261635.1      GAAGACATAAGCATCATGATTAAATTTTGGACCGCCATGTTCTCAGATAAGAAGTACCTG
NM_058004.3         AAAGACCCTG--------------------------------------------------
XM_005261634.1      AAAGACCCTG--------------------------------------------------
NM_002650.2         AAAGACCCTG--------------------------------------------------
                    .*****. :.                                                  

HsCD00039116        ----------------------------ACATCGGCGACCTCCTGGATCAGTTGGTAGAG
XM_005261635.1      ACCGCCAGCCAGCTTGTTCCCCCAGCTGACATCGGCGACCTCCTGGATCAGTTGGTAGAG
NM_058004.3         ----------------------------ACATCGGCGACCTCCTGGATCAGTTGGTAGAG
XM_005261634.1      ----------------------------ACATCGGCGACCTCCTGGATCAGTTGGTAGAG
NM_002650.2         ----------------------------ACATCGGCGACCTCCTGGATCAGTTGGTAGAG
                                                ********************************

HsCD00039116        GAGATCACAGGCTCCTTGTCCGGCCCAGCGAAGGACTTTTACCAGCGGGAGTTTGATTTC
XM_005261635.1      GAGATCACAGGCTCCTTGTCCGGCCCAGCGAAGGACTTTTACCAGCGGGAGTTTGATTTC
NM_058004.3         GAGATCACAGGCTCCTTGTCCGGCCCAGCGAAGGACTTTTACCAGCGGGAGTTTGATTTC
XM_005261634.1      GAGATCACAGGCTCCTTGTCCGGCCCAGCGAAGGACTTTTACCAGCGGGAGTTTGATTTC
NM_002650.2         GAGATCACAGGCTCCTTGTCCGGCCCAGCGAAGGACTTTTACCAGCGGGAGTTTGATTTC
                    ************************************************************

HsCD00039116        TTTAACAAGATCACCAACGTGTCGGCTATCATCAAGCCCTACCCTAAAGGCGACGAGAGA
XM_005261635.1      TTTAACAAGATCACCAACGTGTCGGCTATCATCAAGCCCTACCCTAAAGGCGACGAGAGA
NM_058004.3         TTTAACAAGATCACCAACGTGTCGGCTATCATCAAGCCCTACCCTAAAGGCGACGAGAGA
XM_005261634.1      TTTAACAAGATCACCAACGTGTCGGCTATCATCAAGCCCTACCCTAAAGGCGACGAGAGA
NM_002650.2         TTTAACAAGATCACCAACGTGTCGGCTATCATCAAGCCCTACCCTAAAGGCGACGAGAGA
                    ************************************************************

HsCD00039116        AAGAAGGCTTGTCTGTCGGCCCTGTCTGAAGTGAAGGTGCAGCCGGGCTGCTACCTGCCC
XM_005261635.1      AAGAAGGCTTGTCTGTCGGCCCTGTCTGAAGTGAAGGTGCAGCCGGGCTGCTACCTGCCC
NM_058004.3         AAGAAGGCTTGTCTGTCGGCCCTGTCTGAAGTGAAGGTGCAGCCGGGCTGCTACCTGCCC
XM_005261634.1      AAGAAGGCTTGTCTGTCGGCCCTGTCTGAAGTGAAGGTGCAGCCGGGCTGCTACCTGCCC
NM_002650.2         AAGAAGGCTTGTCTGTCGGCCCTGTCTGAAGTGAAGGTGCAGCCGGGCTGCTACCTGCCC
                    ************************************************************

HsCD00039116        AGCAACCCTGAGGCCATTGTGCTGGACATCGACTACAAGTCTGGGACCCCGATGCAGAGT
XM_005261635.1      AGCAACCCTGAGGCCATTGTGCTGGACATCGACTACAAGTCTGGGACCCCGATGCAGAGT
NM_058004.3         AGCAACCCTGAGGCCATTGTGCTGGACATCGACTACAAGTCTGGGACCCCGATGCAGAGT
XM_005261634.1      AGCAACCCTGAGGCCATTGTGCTGGACATCGACTACAAGTCTGGGACCCCGATGCAGAGT
NM_002650.2         AGCAACCCTGAGGCCATTGTGCTGGACATCGACTACAAGTCTGGGACCCCGATGCAGAGT
                    ************************************************************

HsCD00039116        GCTGCAAAAGCCCCATATCTGGCCAAGTTCAAGGTGAAGCGATGTGGAGTTAGTGAACTT
XM_005261635.1      GCTGCAAAAGCCCCATATCTGGCCAAGTTCAAGGTGAAGCGATGTGGAGTTAGTGAACTT
NM_058004.3         GCTGCAAAAGCCCCATATCTGGCCAAGTTCAAGGTGAAGCGATGTGGAGTTAGTGAACTT
XM_005261634.1      GCTGCAAAAGCCCCATATCTGGCCAAGTTCAAGGTGAAGCGATGTGGAGTTAGTGAACTT
NM_002650.2         GCTGCAAAAGCCCCATATCTGGCCAAGTTCAAGGTGAAGCGATGTGGAGTTAGTGAACTT
                    ************************************************************

HsCD00039116        GAAAAAGAAGGTCTGCGGTGCCGCTCAGACTCCGAGGATGAGTGCAGCACGCAGGAGGCC
XM_005261635.1      GAAAAAGAAGGTCTGCGGTGCCGCTCAGACTCCGAGGATGAGTGCAGCACGCAGGAGGCC
NM_058004.3         GAAAAAGAAGGTCTGCGGTGCCGCTCAGACTCCGAGGATGAGTGCAGCACGCAGGAGGCC
XM_005261634.1      GAAAAAGAAGGTCTGCGGTGCCGCTCAGACTCCGAGGATGAGTGCAGCACGCAGGAGGCC
NM_002650.2         GAAAAAGAAGGTCTGCGGTGCCGCTCAGACTCCGAGGATGAGTGCAGCACGCAGGAGGCC
                    ************************************************************

HsCD00039116        GACGGCCAGAAGATCTCCTGGCAGGCAGCCATCTTCAAGGTGGGAGACGACTGCCGGCAG
XM_005261635.1      GACGGCCAGAAGATCTCCTGGCAGGCAGCCATCTTCAAGGTGGGAGACGACTGCCGGCAG
NM_058004.3         GACGGCCAGAAGATCTCCTGGCAGGCAGCCATCTTCAAGGTGGGAGACGACTGCCGGCAG
XM_005261634.1      GACGGCCAGAAGATCTCCTGGCAGGCAGCCATCTTCAAGGTGGGAGACGACTGCCGGCAG
NM_002650.2         GACGGCCAGAAGATCTCCTGGCAGGCAGCCATCTTCAAGGTGGGAGACGACTGCCGGCAG
                    ************************************************************

HsCD00039116        GACATGCTGGCCCTGCAGATCATCGACCTCTTCAAGAACATCTTCCAGCTGGTCGGCCTG
XM_005261635.1      GACATGCTGGCCCTGCAGATCATCGACCTCTTCAAGAACATCTTCCAGCTGGTCGGCCTG
NM_058004.3         GACATGCTGGCCCTGCAGATCATCGACCTCTTCAAGAACATCTTCCAGCTGGTCGGCCTG
XM_005261634.1      GACATGCTGGCCCTGCAGATCATCGACCTCTTCAAGAACATCTTCCAGCTGGTCGGCCTG
NM_002650.2         GACATGCTGGCCCTGCAGATCATCGACCTCTTCAAGAACATCTTCCAGCTGGTCGGCCTG
                    ************************************************************

HsCD00039116        GACCTCTTTGTTTTTCCCTACCGCGTGGTGGCCACTGCCCCTGGGTGCGGGGTGATCGAG
XM_005261635.1      GACCTCTTTGTTTTTCCCTACCGCGTGGTGGCCACTGCCCCTGGGTGCGGGGTGATCGAG
NM_058004.3         GACCTCTTTGTTTTTCCCTACCGCGTGGTGGCCACTGCCCCTGGGTGCGGGGTGATCGAG
XM_005261634.1      GACCTCTTTGTTTTTCCCTACCGCGTGGTGGCCACTGCCCCTGGGTGCGGGGTGATCGAG
NM_002650.2         GACCTCTTTGTTTTTCCCTACCGCGTGGTGGCCACTGCCCCTGGGTGCGGGGTGATCGAG
                    ************************************************************

HsCD00039116        TGCATCCCCGACTGCACCTCCCGGGACCAGCTGGGCCGCCAGACAGACTTCGGCATGTAC
XM_005261635.1      TGCATCCCCGACTGCACCTCCCGGGACCAGCTGGGCCGCCAGACAGACTTCGGCATGTAC
NM_058004.3         TGCATCCCCGACTGCACCTCCCGGGACCAGCTGGGCCGCCAGACAGACTTCGGCATGTAC
XM_005261634.1      TGCATCCCCGACTGCACCTCCCGGGACCAGCTGGGCCGCCAGACAGACTTCGGCATGTAC
NM_002650.2         TGCATCCCCGACTGCACCTCCCGGGACCAGCTGGGCCGCCAGACAGACTTCGGCATGTAC
                    ************************************************************

HsCD00039116        GACTACTTCACACGCCAGTACGGGGATGAGTCCACTCTGGCCTTCCAGCAGGCCCGCTAC
XM_005261635.1      GACTACTTCACACGCCAGTACGGGGATGAGTCCACTCTGGCCTTCCAGCAGGCCCGCTAC
NM_058004.3         GACTACTTCACACGCCAGTACGGGGATGAGTCCACTCTGGCCTTCCAGCAGGCCCGCTAC
XM_005261634.1      GACTACTTCACACGCCAGTACGGGGATGAGTCCACTCTGGCCTTCCAGCAGGCCCGCTAC
NM_002650.2         GACTACTTCACACGCCAGTACGGGGATGAGTCCACTCTGGCCTTCCAGCAGGCCCGCTAC
                    ************************************************************

HsCD00039116        AACTTCATCCGAAGCATGGCCGCCTACAGCCTCCTGCTGTTCCTGCTGCAGATCAAGGAC
XM_005261635.1      AACTTCATCCGAAGCATGGCCGCCTACAGCCTCCTGCTGTTCCTGCTGCAGATCAAGGAC
NM_058004.3         AACTTCATCCGAAGCATGGCCGCCTACAGCCTCCTGCTGTTCCTGCTGCAGATCAAGGAC
XM_005261634.1      AACTTCATCCGAAGCATGGCCGCCTACAGCCTCCTGCTGTTCCTGCTGCAGATCAAGGAC
NM_002650.2         AACTTCATCCGAAGCATGGCCGCCTACAGCCTCCTGCTGTTCCTGCTGCAGATCAAGGAC
                    ************************************************************

HsCD00039116        AGACACAACGGCAACATTATGCTGGACAAGAAGGGTCATATCATCCACATCGACTTTGGC
XM_005261635.1      AGACACAACGGCAACATTATGCTGGACAAGAAGGGTCATATCATCCACATCGACTTTGGC
NM_058004.3         AGACACAACGGCAACATTATGCTGGACAAGAAGGGTCATATCATCCACATCGACTTTGGC
XM_005261634.1      AGACACAACGGCAACATTATGCTGGACAAGAAGGGTCATATCATCCACATCGACTTTGGC
NM_002650.2         AGACACAACGGCAACATTATGCTGGACAAGAAGGGTCATATCATCCACATCGACTTTGGC
                    ************************************************************

HsCD00039116        TTCATGTTTGAAAGCTCGCCGGGCGGCAATCTCGGCTGGGAACCCGACATCAAGCTGACG
XM_005261635.1      TTCATGTTTGAAAGCTCGCCGGGCGGCAATCTCGGCTGGGAACCCGACATCAAGCTGACG
NM_058004.3         TTCATGTTTGAAAGCTCGCCGGGCGGCAATCTCGGCTGGGAACCCGACATCAAGCTGACG
XM_005261634.1      TTCATGTTTGAAAGCTCGCCGGGCGGCAATCTCGGCTGGGAACCCGACATCAAGCTGACG
NM_002650.2         TTCATGTTTGAAAGCTCGCCGGGCGGCAATCTCGGCTGGGAACCCGACATCAAGCTGACG
                    ************************************************************

HsCD00039116        GATGAGATGGTGATGATCATGGGGGGCAAGATGGAGGCCACACCCTTCAAGTGGTTCATG
XM_005261635.1      GATGAGATGGTGATGATCATGGGGGGCAAGATGGAGGCCACACCCTTCAAGTGGTTCATG
NM_058004.3         GATGAGATGGTGATGATCATGGGGGGCAAGATGGAGGCCACACCCTTCAAGTGGTTCATG
XM_005261634.1      GATGAGATGGTGATGATCATGGGGGGCAAGATGGAGGCCACACCCTTCAAGTGGTTCATG
NM_002650.2         GATGAGATGGTGATGATCATGGGGGGCAAGATGGAGGCCACACCCTTCAAGTGGTTCATG
                    ************************************************************

HsCD00039116        GAGATGTGTGTCCGAGGCTACCTGGCTGTGCGGCCCTACATGGACGCGGTCGTCTCCCTG
XM_005261635.1      GAGATGTGTGTCCGAGGCTACCTGGCTGTGCGGCCCTACATGGACGCGGTCGTCTCCCTG
NM_058004.3         GAGATGTGTGTCCGAGGCTACCTGGCTGTGCGGCCCTACATGGACGCGGTCGTCTCCCTG
XM_005261634.1      GAGATGTGTGTCCGAGGCTACCTGGCTGTGCGGCCCTACATGGACGCGGTCGTCTCCCTG
NM_002650.2         GAGATGTGTGTCCGAGGCTACCTGGCTGTGCGGCCCTACATGGACGCGGTCGTCTCCCTG
                    ************************************************************

HsCD00039116        GTCACTCTCATGTTGGACACGGGCCTGCCCTGTTTTCGCGGCCAGACAATCAAGCTCTTG
XM_005261635.1      GTCACTCTCATGTTGGACACGGGCCTGCCCTGTTTTCGCGGCCAGACAATCAAGCTCTTG
NM_058004.3         GTCACTCTCATGTTGGACACGGGCCTGCCCTGTTTTCGCGGCCAGACAATCAAGCTCTTG
XM_005261634.1      GTCACTCTCATGTTGGACACGGGCCTGCCCTGTTTTCGCGGCCAGACAATCAAGCTCTTG
NM_002650.2         GTCACTCTCATGTTGGACACGGGCCTGCCCTGTTTTCGCGGCCAGACAATCAAGCTCTTG
                    ************************************************************

HsCD00039116        AAGCACAGGTTTAGCCCCAACATGACTGAGCGCGAGGCTGCAAATTTCATCATGAAGGTC
XM_005261635.1      AAGCACAGGTTTAGCCCCAACATGACTGAGCGCGAGGCTGCAAATTTCATCATGAAGGTC
NM_058004.3         AAGCACAGGTTTAGCCCCAACATGACTGAGCGCGAGGCTGCAAATTTCATCATGAAGGTC
XM_005261634.1      AAGCACAGGTTTAGCCCCAACATGACTGAGCGCGAGGCTGCAAATTTCATCATGAAGGTC
NM_002650.2         AAGCACAGGTTTAGCCCCAACATGACTGAGCGCGAGGCTGCAAATTTCATCATGAAGGTC
                    ************************************************************

HsCD00039116        ATCCAGAGCTGCTTCCTCAGCAACAGGAGCCGGACCTACGACATGATCCAGTACTATCAG
XM_005261635.1      ATCCAGAGCTGCTTCCTCAGCAACAGGAGCCGGACCTACGACATGATCCAGTACTATCAG
NM_058004.3         ATCCAGAGCTGCTTCCTCAGCAACAGGAGCCGGACCTACGACATGATCCAGTACTATCAG
XM_005261634.1      ATCCAGAGCTGCTTCCTCAGCAACAGGAGCCGGACCTACGACATGATCCAGTACTATCAG
NM_002650.2         ATCCAGAGCTGCTTCCTCAGCAACAGGAGCCGGACCTACGACATGATCCAGTACTATCAG
                    ************************************************************

HsCD00039116        AATGACATCCCCTACTTG
XM_005261635.1      AATGACATCCCCTACTGA
NM_058004.3         AATGACATCCCCTACTGA
XM_005261634.1      AATGACATCCCCTACTGA
NM_002650.2         AATGACATCCCCTACTGA
                    **************** .

Pathways

NCI : Integrins in angiogenesis
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : Phospholipid metabolism
Reactome : PI Metabolism
Reactome : Synthesis of PIPs at the ER membrane
Reactome : Synthesis of PIPs at the Golgi membrane

Clone

Cloning Information : 222232
HIP Master Clone ID : 87276
Original Clone ID : FLH222232.01L

Organism


TAX_ID : 9606
Species Specific ID: 5297

Genome

Chromosome : 22
Map Location : 22q11.21
Ensembl : ENSG00000241973

Reagents

Labome : PI4KA-antibody