DNASU Plasmid Repository • 480.965.5697 | Email

GSK3B (Homo sapiens) in pJP1563 (retroviral expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GSK3B
Gene Name:  glycogen synthase kinase 3 beta
Sequence             
Original Clone ID: FLH224188.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pJP1563               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors:
HsCD00039150

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1302nts         Open reading frame : 1 to 1302
Reference Sequence Alignment

ATGTCAGGGCGGCCCAGAACCACCTCCTTTGCGGAGAGCTGCAAGCCGGTGCAGCAGCCT
TCAGCTTTTGGCAGCATGAAAGTTAGCAGAGACAAGGACGGCAGCAAGGTGACAACAGTG
GTGGCAACTCCTGGGCAGGGTCCAGACAGGCCACAAGAAGTCAGCTATACAGACACTAAA
GTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCAGGAGAA
CTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGATTTAAGAATCGAGAGCTCCAGATC
ATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGTTATTTCTTCTACTCCAGTGGT
GAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACAGTATAC
AGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTGATTTATGTCAAGTTG
TATATGTATCAGCTGTTCCGAAGTTTAGCCTATATCCATTCCTTTGGAATCTGCCATCGG
GATATTAAACCGCAGAACCTCTTGTTGGATCCTGATACTGCTGTATTAAAACTCTGTGAC
TTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAACCCAATGTTTCGTATATCTGTTCTCGG
TACTATAGGGCACCAGAGTTGATCTTTGGAGCCACTGATTATACCTCTAGTATAGATGTA
TGGTCTGCTGGCTGTGTGTTGGCTGAGCTGTTACTAGGACAACCAATATTTCCAGGGGAT
AGTGGTGTGGATCAGTTGGTAGAAATAATCAAGGTCCTGGGAACTCCAACAAGGGAGCAA
ATCAGAGAAATGAACCCAAACTACACAGAATTTAAATTCCCTCAAATTAAGGCACATCCT
TGGACTAAGGATTCGTCAGGAACAGGACATTTCACCTCAGGAGTGCGGGTCTTCCGACCC
CGAACTCCACCGGAGGCAATTGCACTGTGTAGCCGTCTGCTGGAGTATACACCAACTGCC
CGACTAACACCACTGGAAGCTTGTGCACATTCATTTTTTGATGAATTACGGGACCCAAAT
GTCAAACTACCAAATGGGCGAGACACACCTGCACTCTTCAACTTCACCACTCAAGAACTG
TCAAGTAATCCACCTCTGGCTACCATCCTTATTCCTCCTCATGCTCGGATTCAAGCAGCT
GCTTCAACCCCCACAAATGCCACAGCAGCGTCAGATGCTAATACTGGAGACCGTGGACAG
ACCAATAATGCTGCTTCTGCATCAGCTTCCAACTCCACCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Insert was fully sequenced in parent vector; Verification by restriction enzyme digest
Reference Sequence Annotations:
End on reference sequence 1534
Start on reference sequence 233
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  chloramphenicol
Host Type:  mammalian    Marker:  blasticidin
Bacterial Selection Condition:  100 ug/mL ampicillin, 34 ug/mL chloramphenicol
Growth Condition:  Growth with the double antibiotic in LB supplemented with 7% sucrose at 37 degrees is recommended.
Comments:  Conditions for Creator-type vectors in with insert (recombined) form. Selection differs for the unrecombined, empty form of the vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pJP1563

pJP1563 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  JPO113
Reverse:  Unknown
Description: Retroviral expression vector with CMV promoter, MMV-type 5p and 3p LTRs; amp resistance (blasticidin for mammalian selection); recombinational cloning.
Comments: One in a series of pJP# vectors that includes puroR, blastR, hygR vectors made by J. Pearlberg at HIP
Size (bp): 7692
Parent Vector: None
Empty Vector: EvNO00023115
Properties: Creator, acceptor (destination), loxP, mammalian expression, mammalian transduction, retroviral vector
Author Name: Ed Harlow
Joseph Pearlberg
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
gene fragment gag/pol/env non-functional gag/pol/env for packaging efficiency 1871 2644
primer site PBSQ primer binding site (glytamine tRNA primer binding site) 1140 1156
promoter bacterial bacterial promoter (for chlR ORF in Creator-type inserts) 3677 3803
recombination site LoxP LoxP site for recombinational cloning 3651 3684
selectable marker BlastR blasticidin resistance gene (blasticidin S deaminase) 2428 2823
selectable marker AmpR ampicillin resistance gene (beta-lactamase) 6237 7094
viral LTR 5p LTR 5p viral LTR (MPSV U3, R, U5) 550 1139
viral LTR 3p LTR 3p viral LTR (MPSV U3, R, U5) 3962 4551

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GSK3B
Symbol Nomenclature : GSK3B
Designation : GSK-3 beta|GSK3beta isoform|glycogen synthase kinase-3 beta|serine/threonine-protein kinase GSK3B
Full Nomenclature : glycogen synthase kinase 3 beta
GENEID : 2932
HGNC : 4617
MIM : 605004
Vega : OTTHUMG00000133765
Target GenBank: BC000251

 

Reference Sequence Alignment

  

HsCD00039150        ATGTCAGGGCGGCCCAGAACCACCTCCTTTGCGGAGAGCTGCAAGCCGGTGCAGCAGCCT
NM_001146156.1      ATGTCAGGGCGGCCCAGAACCACCTCCTTTGCGGAGAGCTGCAAGCCGGTGCAGCAGCCT
NM_002093.3         ATGTCAGGGCGGCCCAGAACCACCTCCTTTGCGGAGAGCTGCAAGCCGGTGCAGCAGCCT
                    ************************************************************

HsCD00039150        TCAGCTTTTGGCAGCATGAAAGTTAGCAGAGACAAGGACGGCAGCAAGGTGACAACAGTG
NM_001146156.1      TCAGCTTTTGGCAGCATGAAAGTTAGCAGAGACAAGGACGGCAGCAAGGTGACAACAGTG
NM_002093.3         TCAGCTTTTGGCAGCATGAAAGTTAGCAGAGACAAGGACGGCAGCAAGGTGACAACAGTG
                    ************************************************************

HsCD00039150        GTGGCAACTCCTGGGCAGGGTCCAGACAGGCCACAAGAAGTCAGCTATACAGACACTAAA
NM_001146156.1      GTGGCAACTCCTGGGCAGGGTCCAGACAGGCCACAAGAAGTCAGCTATACAGACACTAAA
NM_002093.3         GTGGCAACTCCTGGGCAGGGTCCAGACAGGCCACAAGAAGTCAGCTATACAGACACTAAA
                    ************************************************************

HsCD00039150        GTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCAGGAGAA
NM_001146156.1      GTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCAGGAGAA
NM_002093.3         GTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCAGGAGAA
                    ************************************************************

HsCD00039150        CTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGATTTAAGAATCGAGAGCTCCAGATC
NM_001146156.1      CTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGATTTAAGAATCGAGAGCTCCAGATC
NM_002093.3         CTGGTCGCCATCAAGAAAGTATTGCAGGACAAGAGATTTAAGAATCGAGAGCTCCAGATC
                    ************************************************************

HsCD00039150        ATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGTTATTTCTTCTACTCCAGTGGT
NM_001146156.1      ATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGTTATTTCTTCTACTCCAGTGGT
NM_002093.3         ATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGTTATTTCTTCTACTCCAGTGGT
                    ************************************************************

HsCD00039150        GAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACAGTATAC
NM_001146156.1      GAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACAGTATAC
NM_002093.3         GAGAAGAAAGATGAGGTCTATCTTAATCTGGTGCTGGACTATGTTCCGGAAACAGTATAC
                    ************************************************************

HsCD00039150        AGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTGATTTATGTCAAGTTG
NM_001146156.1      AGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTGATTTATGTCAAGTTG
NM_002093.3         AGAGTTGCCAGACACTATAGTCGAGCCAAACAGACGCTCCCTGTGATTTATGTCAAGTTG
                    ************************************************************

HsCD00039150        TATATGTATCAGCTGTTCCGAAGTTTAGCCTATATCCATTCCTTTGGAATCTGCCATCGG
NM_001146156.1      TATATGTATCAGCTGTTCCGAAGTTTAGCCTATATCCATTCCTTTGGAATCTGCCATCGG
NM_002093.3         TATATGTATCAGCTGTTCCGAAGTTTAGCCTATATCCATTCCTTTGGAATCTGCCATCGG
                    ************************************************************

HsCD00039150        GATATTAAACCGCAGAACCTCTTGTTGGATCCTGATACTGCTGTATTAAAACTCTGTGAC
NM_001146156.1      GATATTAAACCGCAGAACCTCTTGTTGGATCCTGATACTGCTGTATTAAAACTCTGTGAC
NM_002093.3         GATATTAAACCGCAGAACCTCTTGTTGGATCCTGATACTGCTGTATTAAAACTCTGTGAC
                    ************************************************************

HsCD00039150        TTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAACCCAATGTTTCGTATATCTGTTCTCGG
NM_001146156.1      TTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAACCCAATGTTTCGTATATCTGTTCTCGG
NM_002093.3         TTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAACCCAATGTTTCGTATATCTGTTCTCGG
                    ************************************************************

HsCD00039150        TACTATAGGGCACCAGAGTTGATCTTTGGAGCCACTGATTATACCTCTAGTATAGATGTA
NM_001146156.1      TACTATAGGGCACCAGAGTTGATCTTTGGAGCCACTGATTATACCTCTAGTATAGATGTA
NM_002093.3         TACTATAGGGCACCAGAGTTGATCTTTGGAGCCACTGATTATACCTCTAGTATAGATGTA
                    ************************************************************

HsCD00039150        TGGTCTGCTGGCTGTGTGTTGGCTGAGCTGTTACTAGGACAACCAATATTTCCAGGGGAT
NM_001146156.1      TGGTCTGCTGGCTGTGTGTTGGCTGAGCTGTTACTAGGACAACCAATATTTCCAGGGGAT
NM_002093.3         TGGTCTGCTGGCTGTGTGTTGGCTGAGCTGTTACTAGGACAACCAATATTTCCAGGGGAT
                    ************************************************************

HsCD00039150        AGTGGTGTGGATCAGTTGGTAGAAATAATCAAGGTCCTGGGAACTCCAACAAGGGAGCAA
NM_001146156.1      AGTGGTGTGGATCAGTTGGTAGAAATAATCAAGGTCCTGGGAACTCCAACAAGGGAGCAA
NM_002093.3         AGTGGTGTGGATCAGTTGGTAGAAATAATCAAGGTCCTGGGAACTCCAACAAGGGAGCAA
                    ************************************************************

HsCD00039150        ATCAGAGAAATGAACCCAAACTACACAGAATTTAAATTCCCTCAAATTAAGGCACATCCT
NM_001146156.1      ATCAGAGAAATGAACCCAAACTACACAGAATTTAAATTCCCTCAAATTAAGGCACATCCT
NM_002093.3         ATCAGAGAAATGAACCCAAACTACACAGAATTTAAATTCCCTCAAATTAAGGCACATCCT
                    ************************************************************

HsCD00039150        TGGACTAAGGATTCGTCAGGAACAGGACATTTCACCTCAGGAGTGCGGGTCTTCCGACCC
NM_001146156.1      TGGACTAAG---------------------------------------GTCTTCCGACCC
NM_002093.3         TGGACTAAGGATTCGTCAGGAACAGGACATTTCACCTCAGGAGTGCGGGTCTTCCGACCC
                    *********                                       ************

HsCD00039150        CGAACTCCACCGGAGGCAATTGCACTGTGTAGCCGTCTGCTGGAGTATACACCAACTGCC
NM_001146156.1      CGAACTCCACCGGAGGCAATTGCACTGTGTAGCCGTCTGCTGGAGTATACACCAACTGCC
NM_002093.3         CGAACTCCACCGGAGGCAATTGCACTGTGTAGCCGTCTGCTGGAGTATACACCAACTGCC
                    ************************************************************

HsCD00039150        CGACTAACACCACTGGAAGCTTGTGCACATTCATTTTTTGATGAATTACGGGACCCAAAT
NM_001146156.1      CGACTAACACCACTGGAAGCTTGTGCACATTCATTTTTTGATGAATTACGGGACCCAAAT
NM_002093.3         CGACTAACACCACTGGAAGCTTGTGCACATTCATTTTTTGATGAATTACGGGACCCAAAT
                    ************************************************************

HsCD00039150        GTCAAACTACCAAATGGGCGAGACACACCTGCACTCTTCAACTTCACCACTCAAGAACTG
NM_001146156.1      GTCAAACTACCAAATGGGCGAGACACACCTGCACTCTTCAACTTCACCACTCAAGAACTG
NM_002093.3         GTCAAACTACCAAATGGGCGAGACACACCTGCACTCTTCAACTTCACCACTCAAGAACTG
                    ************************************************************

HsCD00039150        TCAAGTAATCCACCTCTGGCTACCATCCTTATTCCTCCTCATGCTCGGATTCAAGCAGCT
NM_001146156.1      TCAAGTAATCCACCTCTGGCTACCATCCTTATTCCTCCTCATGCTCGGATTCAAGCAGCT
NM_002093.3         TCAAGTAATCCACCTCTGGCTACCATCCTTATTCCTCCTCATGCTCGGATTCAAGCAGCT
                    ************************************************************

HsCD00039150        GCTTCAACCCCCACAAATGCCACAGCAGCGTCAGATGCTAATACTGGAGACCGTGGACAG
NM_001146156.1      GCTTCAACCCCCACAAATGCCACAGCAGCGTCAGATGCTAATACTGGAGACCGTGGACAG
NM_002093.3         GCTTCAACCCCCACAAATGCCACAGCAGCGTCAGATGCTAATACTGGAGACCGTGGACAG
                    ************************************************************

HsCD00039150        ACCAATAATGCTGCTTCTGCATCAGCTTCCAACTCCACCTTG
NM_001146156.1      ACCAATAATGCTGCTTCTGCATCAGCTTCCAACTCCACCTGA
NM_002093.3         ACCAATAATGCTGCTTCTGCATCAGCTTCCAACTCCACCTGA
                    **************************************** .

Pathways

NCI : Aurora A signaling
NCI : BMP receptor signaling
NCI : C-MYC pathway
NCI : CDC42 signaling events
NCI : Canonical Wnt signaling pathway
NCI : Class I PI3K signaling events mediated by Akt
NCI : Degradation of beta catenin
NCI : Glucocorticoid receptor regulatory network
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : Insulin-mediated glucose transport
NCI : Integrin-linked kinase signaling
NCI : LKB1 signaling events
NCI : LPA receptor mediated events
NCI : Presenilin action in Notch and Wnt signaling
NCI : Reelin signaling pathway
NCI : Regulation of Androgen receptor activity
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Trk receptor signaling mediated by PI3K and PLC-gamma
NCI : Validated transcriptional targets of deltaNp63 isoforms
NCI : p53 pathway
Panther : Alzheimer disease-presenilin pathway
Panther : Angiogenesis
Panther : Cadherin signaling pathway
Panther : Hedgehog signaling pathway
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : Wnt signaling pathway
Reactome : AKT phosphorylates targets in the cytosol
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : Beta-catenin phosphorylation cascade
Reactome : CRMPs in Sema3A signaling
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Degradation of beta-catenin by the destruction complex
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : Immune System
Reactome : Innate Immune System
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Semaphorin interactions
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Wnt
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : TCF dependent signaling in response to WNT
Reactome : disassembly of the destruction complex and recruitment of AXIN to the membrane
WikiPathway : Alzheimers Disease
WikiPathway : Androgen receptor signaling pathway
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : Cell cycle
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Energy Metabolism
WikiPathway : ErbB signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : Glycogen Metabolism
WikiPathway : IL-5 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Neural Crest Differentiation
WikiPathway : Notch Signaling Pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Senescence and Autophagy
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Clone

Cloning Information : 224188
HIP Master Clone ID : 87364
Original Clone ID : FLH224188.01L

Organism


TAX_ID : 9606
Species Specific ID: 2932

Genome

Chromosome : 3
Map Location : 3q13.3
Ensembl : ENSG00000082701

Reagents

Labome : GSK3beta-antibody