DNASU Plasmid Repository • 480.965.5697 | Email

NCBP2 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NCBP2
Gene Name:  nuclear cap binding protein subunit 2, 20kDa
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH165296.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00039573

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 471nts         Open reading frame : 1 to 471
Reference Sequence Alignment

ATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACTCCTACGTGGAGCTGAGCCAGTAC
CGGGACCAGCACTTCCGGGGTGACAATGAAGAACAAGAAAAATTACTGAAGAAAAGCTGT
ACGTTATATGTTGGAAATCTTTCTTTTTACACAACTGAAGAACAAATCTATGAACTCTTC
AGCAAAAGTGGTGACATAAAGAAAATCATTATGGGTCTGGATAAAATGAAGAAAACAGCA
TGTGGATTCTGTTTTGTGGAATATTACTCACGCGCAGATGCGGAAAACGCCATGCGGTAC
ATAAATGGGACGCGTCTGGATGACCGAATCATTCGCACAGACTGGGACGCAGGCTTTAAG
GAGGGCAGGCAATACGGCCGTGGGCGATCTGGGGGCCAGGTTCGGGATGAGTATCGGCAG
GACTACGATGCTGGGAGAGGAGGCTATGGAAAACTGGCACAGAACCAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 497
Start on reference sequence 27
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NCBP2
Symbol Nomenclature : NCBP2
SYNONYM : CBC2; CBP20; NIP1
Designation : 20 kDa nuclear cap-binding protein|NCBP 20 kDa subunit|NCBP interacting protein 1|NCBP-interacting protein 1|cell proliferation-inducing gene 55 protein|nuclear cap-binding protein subunit 2
Full Nomenclature : nuclear cap binding protein subunit 2, 20kDa
GENEID : 22916
Locus Tag : PIG55
HGNC : 7659
MIM : 605133
Vega : OTTHUMG00000155520
Target GenBank: BC001255

 

Reference Sequence Alignment

  

HsCD00039573      ATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACTCCTACGTGGAGCTGAGCCAGTAC
NM_007362.3       ATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACTCCTACGTGGAGCTGAGCCAGTAC
                  ************************************************************

HsCD00039573      CGGGACCAGCACTTCCGGGGTGACAATGAAGAACAAGAAAAATTACTGAAGAAAAGCTGT
NM_007362.3       CGGGACCAGCACTTCCGGGGTGACAATGAAGAACAAGAAAAATTACTGAAGAAAAGCTGT
                  ************************************************************

HsCD00039573      ACGTTATATGTTGGAAATCTTTCTTTTTACACAACTGAAGAACAAATCTATGAACTCTTC
NM_007362.3       ACGTTATATGTTGGAAATCTTTCTTTTTACACAACTGAAGAACAAATCTATGAACTCTTC
                  ************************************************************

HsCD00039573      AGCAAAAGTGGTGACATAAAGAAAATCATTATGGGTCTGGATAAAATGAAGAAAACAGCA
NM_007362.3       AGCAAAAGTGGTGACATAAAGAAAATCATTATGGGTCTGGATAAAATGAAGAAAACAGCA
                  ************************************************************

HsCD00039573      TGTGGATTCTGTTTTGTGGAATATTACTCACGCGCAGATGCGGAAAACGCCATGCGGTAC
NM_007362.3       TGTGGATTCTGTTTTGTGGAATATTACTCACGCGCAGATGCGGAAAACGCCATGCGGTAC
                  ************************************************************

HsCD00039573      ATAAATGGGACGCGTCTGGATGACCGAATCATTCGCACAGACTGGGACGCAGGCTTTAAG
NM_007362.3       ATAAATGGGACGCGTCTGGATGACCGAATCATTCGCACAGACTGGGACGCAGGCTTTAAG
                  ************************************************************

HsCD00039573      GAGGGCAGGCAATACGGCCGTGGGCGATCTGGGGGCCAGGTTCGGGATGAGTATCGGCAG
NM_007362.3       GAGGGCAGGCAATACGGCCGTGGGCGATCTGGGGGCCAGGTTCGGGATGAGTATCGGCAG
                  ************************************************************

HsCD00039573      GACTACGATGCTGGGAGAGGAGGCTATGGAAAACTGGCACAGAACCAGTTG
NM_007362.3       GACTACGATGCTGGGAGAGGAGGCTATGGAAAACTGGCACAGAACCAGTGA
                  ************************************************* .

Pathways

Reactome : Abortive elongation of HIV-1 transcript in the absence of Tat
Reactome : Cleavage of Growing Transcript in the Termination Region
Reactome : Disease
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of the Early Elongation Complex
Reactome : Formation of the HIV-1 Early Elongation Complex
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : Late Phase of HIV Life Cycle
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Metabolism of non-coding RNA
Reactome : Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC)
Reactome : Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC)
Reactome : Nonsense-Mediated Decay (NMD)
Reactome : Post-Elongation Processing of Intron-Containing pre-mRNA
Reactome : Post-Elongation Processing of Intronless pre-mRNA
Reactome : Post-Elongation Processing of the Transcript
Reactome : Processing of Capped Intron-Containing Pre-mRNA
Reactome : Processing of Capped Intronless Pre-mRNA
Reactome : Processing of Intronless Pre-mRNAs
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : RNA Polymerase II Transcription Termination
Reactome : SLBP Dependent Processing of Replication-Dependent Histone Pre-mRNAs
Reactome : SLBP independent Processing of Histone Pre-mRNAs
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transport of Mature Transcript to Cytoplasm
Reactome : Transport of Mature mRNA Derived from an Intronless Transcript
Reactome : Transport of Mature mRNA derived from an Intron-Containing Transcript
Reactome : Transport of Mature mRNAs Derived from Intronless Transcripts
Reactome : Transport of the SLBP Dependant Mature mRNA
Reactome : Transport of the SLBP independent Mature mRNA
Reactome : mRNA 3'-end processing
Reactome : mRNA Capping
Reactome : mRNA Splicing
Reactome : mRNA Splicing - Major Pathway
Reactome : mRNA Splicing - Minor Pathway
Reactome : snRNP Assembly
WikiPathway : mRNA processing

Protein

SMART domain : RRM : RNA recognition motif
UniProt : P52298
UniProt : E9PAR5
HPRD : 05503

Clone

Cloning Information : 165296
HIP Master Clone ID : 138460
Original Clone ID : FLH165296.01L

Organism


TAX_ID : 9606
Species Specific ID: 22916

Genome

Chromosome : 3
Map Location : 3q29
Ensembl : ENSG00000114503

Reagents

Labome : NCBP2-antibody