DNASU Plasmid Repository • 480.965.5697 | Email

TAB1 (Homo sapiens) in pVP16 (His and MBP-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TAB1
Gene Name:  TGF-beta activated kinase 1/MAP3K7 binding protein 1
Sequence             
Original Clone ID: 1136.1.71_GO.37146
Keyword: full-length cds
Species: Homo sapiens
Type: cDNA
Vector Name: pVP16               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: University of Wisconsin Madison
PSI
Center for Eukaryotic Structural Genomics
HsCD00396751

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1533nts         Open reading frame : 51 to 1583
Reference Sequence Alignment

GGATCGACGAAAACCTGTACCTCACAAGTTTGTACAAAAAAGCAGGCTCCGAAAACCTGT
ACTTCCAGTCCGCGGCGCAGAGGAGGAGCTTGCTGCAGAGTGAGCAGCAGCCAAGCTGGA
CAGATGACCTGCCTCTCTGCCACCTCTCTGGGGTTGGCTCAGCCTCCAACCGCAGCTACT
CTGCTGATGGCAAGGGCACTGAGAGCCACCCGCCAGAGGACAGCTGGCTCAAGTTCAGGA
GTGAGAACAACTGCTTCCTGTATGGGGTCTTCAACGGCTATGATGGCAACCGAGTGACCA
ACTTCGTGGCCCAGCGGCTGTCCGCAGAGCTCCTGCTGGGCCAGCTGAATGCCGAGCACG
CCGAGGCCGATGTGCGGCGTGTGCTGCTGCAGGCCTTCGATGTGGTGGAGAGGAGCTTCC
TGGAGTCCATTGACGACGCCTTGGCTGAGAAGGCAAGCCTCCAGTCGCAATTGCCAGAGG
GAGTCCCTCAGCACCAGCTGCCTCCTCAGTATCAGAAGATCCTTGAGAGACTCAAGACGT
TAGAGAGGGAAATTTCGGGAGGGGCCATGGCCGTTGTGGCGGTCCTTCTCAACAACAAGC
TCTACGTCGCCAATGTCGGTACAAACCGTGCACTTTTATGCAAATCGACAGTGGATGGGT
TGCAGGTGACACAGCTGAACGTGGACCACACCACAGAGAACGAGGATGAGCTCTTCCGTC
TTTCGCAGCTGGGCTTGGATGCTGGAAAGATCAAGCAGGTGGGGATCATCTGTGGGCAGG
AGAGCACCCGGCGGATCGGGGATTACAAGGTTAAATATGGCTACACGGACATTGACCTTC
TCAGCGCTGCCAAGTCCAAACCAATCATCGCAGAGCCAGAAATCCATGGGGCACAGCCGC
TGGATGGGGTGACGGGCTTCTTGGTGCTGATGTCGGAGGGGTTGTACAAGGCCCTAGAGG
CAGCCCATGGGCCTGGGCAGGCCAACCAGGAGATTGCTGCGATGATTGACACTGAGTTTG
CCAAGCAGACCTCCCTGGACGCAGTGGCCCAGGCCGTCGTGGACCGGGTGAAGCGCATCC
ACAGCGACACCTTCGCCAGTGGTGGGGAGCGTGCCAGGTTCTGCCCCCGGCACGAGGACA
TGACCCTGCTAGTGAGGAACTTTGGCTACCCGCTGGGCGAAATGAGCCAGCCCACACCGA
GCCCAGCCCCAGCTGCAGGAGGACGAGTGTACCCTGTGTCTGTGCCATACTCCAGCGCCC
AGAGCACCAGCAAGACCAGCGTGACCCTCTCCCTTGTCATGCCCTCCCAGGGCCAGATGG
TCAACGGGGCTCACAGTGCTTCCACCCTGGACGAAGCCACCCCCACCCTCACCAACCAAA
GCCCGACCTTAACCCTGCAGTCCACCAACACGCACACGCAGAGCAGCAGCTCCAGCTCTG
ACGGAGGCCTCTTCCGCTCCCGGCCCGCCCACTCGCTCCCGCCTGGCGAGGACGGTCGTG
TTGAGCCCTATGTGGACTTTGCTGAGTTTTACCGCCTCTGGAGCGTGGACCATGGCGAGC
AGAGCGTGGTGACAGCACCGTAGTAGGACCCAGCTTTCTTGTACAAAGTGGTGATGGCGC
GCCTGTAGGACGTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ACAAGTTTGTACAAAAAAGCAGGCTCC

3' Linker Sequence:
GACCCAGCTTTCTTGTACAAAGTGGT

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Tested_Not_Soluble
Find experimental protocols in GO.37146
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pVP16

pVP16 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  MBP Forward
Reverse:  pQE Reverse
Description: Bacterial (E. coli) expression, adds N-terminal 8xHis and MBP, adds TEV site on 5p end of insert; ampicillin resistance in bacteria; recombinational cloning; Gateway cloning into this vector will remove the Gateway ccdB death casette.
Comments: TEV protease cleavage site is "partial" and not functional. The TEV cleavage site must be added to the insert by PCR, which allows amino acids encoded by the attB1 site to be cut off after protein expression. Gateway cloning into this vector will remove the Gateway cassette
Size (bp): 7631
Parent Vector: None
Empty Vector: EvNO00084279
Properties: Gateway, acceptor (destination), bacterial expression, recombinational cloning, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
Publications: PMID: 15750721
Title: Results from high-throughput DNA cloning of Arabidopsis thaliana target genes using site-specific recombination

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 6471 5789
negative selection marker ccdB ccdB death cassette gene (lost in with-insert form) 2643 2852
promoter T5 T5 promoter 5 54
recombination site AttR1 AttR1 recombination site 1316 1440
recombination site AttR2 AttR2 recombination site 3020 2896
repressor protein gene LacI LacI coding region 4132 5211
selectable marker AmpR ampicillin resistance gene 7228 6569
selectable marker CmR chloramphenicol resistance gene (CmR) (Lost in with-insert form) 1549 2205
tag His N-terminal 8xHis tag 128 145
tag MBP N-terminal MBP 148 1246

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TAB1
Symbol Nomenclature : TAB1
SYNONYM : 3'-Tab1; MAP3K7IP1
Designation : TAK1-binding protein 1|TGF-beta-activated kinase 1 and MAP3K7-binding protein 1|mitogen-activated protein kinase kinase kinase 7-interacting protein 1|transforming growth factor beta-activated kinase-binding protein 1
Full Nomenclature : TGF-beta activated kinase 1/MAP3K7 binding protein 1
GENEID : 10454
Locus Tag : RP3-407F17.2
GI : 29791645
GenBank Accession : BC050554
HGNC : 18157
MIM : 602615
Vega : OTTHUMG00000151102
Target GenBank: BC050554

 

Reference Sequence Alignment

  

HsCD00396751      GGATCGACGAAAACCTGTACCTCACAAGTTTGTACAAAAAAGCAGGCTCCGAAAACCTGT
NM_006116.2       ------------------------------------------------------------
                                                                              

HsCD00396751      ACTTCCAGTCCGCGGCGCAGAGGAGGAGCTTGCTGCAGAGTGAGCAGCAGCCAAGCTGGA
NM_006116.2       --------ATGGCGGCGCAGAGGAGGAGCTTGCTGCAGAGTGAGCAGCAGCCAAGCTGGA
                          :  *************************************************

HsCD00396751      CAGATGACCTGCCTCTCTGCCACCTCTCTGGGGTTGGCTCAGCCTCCAACCGCAGCTACT
NM_006116.2       CAGATGACCTGCCTCTCTGCCACCTCTCTGGGGTTGGCTCAGCCTCCAACCGCAGCTACT
                  ************************************************************

HsCD00396751      CTGCTGATGGCAAGGGCACTGAGAGCCACCCGCCAGAGGACAGCTGGCTCAAGTTCAGGA
NM_006116.2       CTGCTGATGGCAAGGGCACTGAGAGCCACCCGCCAGAGGACAGCTGGCTCAAGTTCAGGA
                  ************************************************************

HsCD00396751      GTGAGAACAACTGCTTCCTGTATGGGGTCTTCAACGGCTATGATGGCAACCGAGTGACCA
NM_006116.2       GTGAGAACAACTGCTTCCTGTATGGGGTCTTCAACGGCTATGATGGCAACCGAGTGACCA
                  ************************************************************

HsCD00396751      ACTTCGTGGCCCAGCGGCTGTCCGCAGAGCTCCTGCTGGGCCAGCTGAATGCCGAGCACG
NM_006116.2       ACTTCGTGGCCCAGCGGCTGTCCGCAGAGCTCCTGCTGGGCCAGCTGAATGCCGAGCACG
                  ************************************************************

HsCD00396751      CCGAGGCCGATGTGCGGCGTGTGCTGCTGCAGGCCTTCGATGTGGTGGAGAGGAGCTTCC
NM_006116.2       CCGAGGCCGATGTGCGGCGTGTGCTGCTGCAGGCCTTCGATGTGGTGGAGAGGAGCTTCC
                  ************************************************************

HsCD00396751      TGGAGTCCATTGACGACGCCTTGGCTGAGAAGGCAAGCCTCCAGTCGCAATTGCCAGAGG
NM_006116.2       TGGAGTCCATTGACGACGCCTTGGCTGAGAAGGCAAGCCTCCAGTCGCAATTGCCAGAGG
                  ************************************************************

HsCD00396751      GAGTCCCTCAGCACCAGCTGCCTCCTCAGTATCAGAAGATCCTTGAGAGACTCAAGACGT
NM_006116.2       GAGTCCCTCAGCACCAGCTGCCTCCTCAGTATCAGAAGATCCTTGAGAGACTCAAGACGT
                  ************************************************************

HsCD00396751      TAGAGAGGGAAATTTCGGGAGGGGCCATGGCCGTTGTGGCGGTCCTTCTCAACAACAAGC
NM_006116.2       TAGAGAGGGAAATTTCGGGAGGGGCCATGGCCGTTGTGGCGGTCCTTCTCAACAACAAGC
                  ************************************************************

HsCD00396751      TCTACGTCGCCAATGTCGGTACAAACCGTGCACTTTTATGCAAATCGACAGTGGATGGGT
NM_006116.2       TCTACGTCGCCAATGTCGGTACAAACCGTGCACTTTTATGCAAATCGACAGTGGATGGGT
                  ************************************************************

HsCD00396751      TGCAGGTGACACAGCTGAACGTGGACCACACCACAGAGAACGAGGATGAGCTCTTCCGTC
NM_006116.2       TGCAGGTGACACAGCTGAACGTGGACCACACCACAGAGAACGAGGATGAGCTCTTCCGTC
                  ************************************************************

HsCD00396751      TTTCGCAGCTGGGCTTGGATGCTGGAAAGATCAAGCAGGTGGGGATCATCTGTGGGCAGG
NM_006116.2       TTTCGCAGCTGGGCTTGGATGCTGGAAAGATCAAGCAGGTGGGGATCATCTGTGGGCAGG
                  ************************************************************

HsCD00396751      AGAGCACCCGGCGGATCGGGGATTACAAGGTTAAATATGGCTACACGGACATTGACCTTC
NM_006116.2       AGAGCACCCGGCGGATCGGGGATTACAAGGTTAAATATGGCTACACGGACATTGACCTTC
                  ************************************************************

HsCD00396751      TCAGCGCTGCCAAGTCCAAACCAATCATCGCAGAGCCAGAAATCCATGGGGCACAGCCGC
NM_006116.2       TCAGCGCTGCCAAGTCCAAACCAATCATCGCAGAGCCAGAAATCCATGGGGCACAGCCGC
                  ************************************************************

HsCD00396751      TGGATGGGGTGACGGGCTTCTTGGTGCTGATGTCGGAGGGGTTGTACAAGGCCCTAGAGG
NM_006116.2       TGGATGGGGTGACGGGCTTCTTGGTGCTGATGTCGGAGGGGTTGTACAAGGCCCTAGAGG
                  ************************************************************

HsCD00396751      CAGCCCATGGGCCTGGGCAGGCCAACCAGGAGATTGCTGCGATGATTGACACTGAGTTTG
NM_006116.2       CAGCCCATGGGCCTGGGCAGGCCAACCAGGAGATTGCTGCGATGATTGACACTGAGTTTG
                  ************************************************************

HsCD00396751      CCAAGCAGACCTCCCTGGACGCAGTGGCCCAGGCCGTCGTGGACCGGGTGAAGCGCATCC
NM_006116.2       CCAAGCAGACCTCCCTGGACGCAGTGGCCCAGGCCGTCGTGGACCGGGTGAAGCGCATCC
                  ************************************************************

HsCD00396751      ACAGCGACACCTTCGCCAGTGGTGGGGAGCGTGCCAGGTTCTGCCCCCGGCACGAGGACA
NM_006116.2       ACAGCGACACCTTCGCCAGTGGTGGGGAGCGTGCCAGGTTCTGCCCCCGGCACGAGGACA
                  ************************************************************

HsCD00396751      TGACCCTGCTAGTGAGGAACTTTGGCTACCCGCTGGGCGAAATGAGCCAGCCCACACCGA
NM_006116.2       TGACCCTGCTAGTGAGGAACTTTGGCTACCCGCTGGGCGAAATGAGCCAGCCCACACCGA
                  ************************************************************

HsCD00396751      GCCCAGCCCCAGCTGCAGGAGGACGAGTGTACCCTGTGTCTGTGCCATACTCCAGCGCCC
NM_006116.2       GCCCAGCCCCAGCTGCAGGAGGACGAGTGTACCCTGTGTCTGTGCCATACTCCAGCGCCC
                  ************************************************************

HsCD00396751      AGAGCACCAGCAAGACCAGCGTGACCCTCTCCCTTGTCATGCCCTCCCAGGGCCAGATGG
NM_006116.2       AGAGCACCAGCAAGACCAGCGTGACCCTCTCCCTTGTCATGCCCTCCCAGGGCCAGATGG
                  ************************************************************

HsCD00396751      TCAACGGGGCTCACAGTGCTTCCACCCTGGACGAAGCCACCCCCACCCTCACCAACCAAA
NM_006116.2       TCAACGGGGCTCACAGTGCTTCCACCCTGGACGAAGCCACCCCCACCCTCACCAACCAAA
                  ************************************************************

HsCD00396751      GCCCGACCTTAACCCTGCAGTCCACCAACACGCACACGCAGAGCAGCAGCTCCAGCTCTG
NM_006116.2       GCCCGACCTTAACCCTGCAGTCCACCAACACGCACACGCAGAGCAGCAGCTCCAGCTCTG
                  ************************************************************

HsCD00396751      ACGGAGGCCTCTTCCGCTCCCGGCCCGCCCACTCGCTCCCGCCTGGCGAGGACGGTCGTG
NM_006116.2       ACGGAGGCCTCTTCCGCTCCCGGCCCGCCCACTCGCTCCCGCCTGGCGAGGACGGTCGTG
                  ************************************************************

HsCD00396751      TTGAGCCCTATGTGGACTTTGCTGAGTTTTACCGCCTCTGGAGCGTGGACCATGGCGAGC
NM_006116.2       TTGAGCCCTATGTGGACTTTGCTGAGTTTTACCGCCTCTGGAGCGTGGACCATGGCGAGC
                  ************************************************************

HsCD00396751      AGAGCGTGGTGACAGCACCGTAGTAGGACCCAGCTTTCTTGTACAAAGTGGTGATGGCGC
NM_006116.2       AGAGCGTGGTGACAGCACCGTAG-------------------------------------
                  ***********************                                     

HsCD00396751      GCCTGTAGGACGTC
NM_006116.2       --------------
                                

Pathways

NCI : BMP receptor signaling
NCI : C-MYB transcription factor network
NCI : IL1-mediated signaling events
NCI : Noncanonical Wnt signaling pathway
NCI : Presenilin action in Notch and Wnt signaling
NCI : Regulation of p38-alpha and p38-beta
NCI : TGF-beta receptor signaling
NCI : TNF receptor signaling pathway
NCI : p38 MAPK signaling pathway
Panther : TGF-beta signaling pathway
Panther : Toll receptor signaling pathway
Panther : p38 MAPK pathway
Reactome : Activated TLR4 signalling
Reactome : Cytokine Signaling in Immune system
Reactome : FCERI mediated NF-kB activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : IRAK2 mediated activation of TAK1 complex
Reactome : IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-1 signaling
Reactome : JNK (c-Jun kinases) phosphorylation and activation mediated by activated human TAK1
Reactome : MAP kinase activation in TLR cascade
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NOD1/2 Signaling Pathway
Reactome : Nucleotide-binding domain, leucine rich repeat containing receptor (NLR) signaling pathways
Reactome : Signaling by Interleukins
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRAF6 mediated induction of TAK1 complex
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : activated TAK1 mediates p38 MAPK activation
WikiPathway : IL-1 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

SMART domain : PP2Cc : Serine/threonine phosphatases, family 2C, catalytic domain
Structural Annotation Wiki : TOPSAN
UniProt : Q15750
UniProt : Q8IZW2
UniProt : A8K6K3
HPRD : 04012

Clone

Cloning Information : 474567
HIP Master Clone ID : 396073
Original Clone ID : 1136.1.71_GO.37146

Experimental

TargetTrack - Experimental data : GO.37146

Organism


TAX_ID : 9606
Species Specific ID: 10454

Genome

Chromosome : 22
Map Location : 22q13.1
Ensembl : ENSG00000100324

Reagents

Labome : TAB1-antibody