DNASU Plasmid Repository • 480.965.2857 | Email

ESR1 (Homo sapiens) in pEU-His-FV (GST-tagged cell-free expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ESR1
Gene Name:  estrogen receptor 1
Sequence             
Original Clone ID: 5962.1.28_GO.97548
Keyword: partial cds
Species: Homo sapiens
Type: cDNA
Vector Name: pEU-His-FV               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: Linker not verified.
Mutation/
Discrepancy :
No / No
Publications: PMID: 15019994
Title: Transcription factor accessibility and histone acetylation of the progesterone receptor gene differs between parental MCF-7 cells and a subline that has lost progesterone receptor expression.
PMID: 8600466
Title: A novel 80 kDa human estrogen receptor containing a duplication of exons 6 and 7.
PMID: 9058380
Title: Estrogen-related receptor alpha 1 functionally binds as a monomer to extended half-site sequences including ones contained within estrogen-response elements.
PMID: 19574486
Title: Breast cancer subtypes based on ER/PR and Her2 expression: comparison of clinicopathologic features and survival.
PMID: 19620290
Title: Repression of ESR1 through actions of estrogen receptor alpha and Sin3A at the proximal promoter.
PMID: 16244490
Title: Association of endometriosis risk and genetic polymorphisms involving sex steroid biosynthesis and their receptors: a meta-analysis.
PMID: 17630774
Title: The DNA binding domain of estrogen receptor alpha is required for high-affinity nuclear interaction induced by estradiol.
PMID: 18096994
Title: Temporal variation in estrogen receptor-alpha protein turnover in the presence of estrogen.
PMID: 18310301
Title: Roles of estrogen receptor alpha and beta in modulating urothelial cell proliferation.
PMID: 15964799
Title: Differential regulation of estrogen-inducible proteolysis and transcription by the estrogen receptor alpha N terminus.
PMID: 16179380
Title: Altered target gene regulation controlled by estrogen receptor-alpha concentration.
Authors: University of Wisconsin Madison
PSI
Center for Eukaryotic Structural Genomics
HsCD00396981

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 405nts         Open reading frame : 51 to 455

ACATTTTACATTCTACAACTACAGCCATGGGACATCATCATCATCATCACGCGATCGCCG
AAAACCTGTACTTCCAGTCCCGGCCCCTGGGCGAGGTGTACCTGGACAGCAGCAAGCCCG
CCGTGTACAACTACCCCGAGGGCGCCGCCTACGAGTTCAACGCCGCGGCCGCCGCCAACG
CGCAGGTCTACGGTCAGACCGGCCTCCCCTACGGCCCCGGGTCTGAGGCTGCGGCGTTCG
GCTCCAACGGCCTGGGGGGTTTCCCCCCACTCAACAGCGTGTCTCCGAGCCCGCTGATGC
TACTGCACCCGCCGCCGCAGCTGTCGCCTTTCCTGCAGCCCCACGGCCAGCAGGTGCCCT
ACTACCTGGAGAACGAGCCCAGCGGCTACACGGTGCGCGAGGCCGGCCCGCCGGCATTCT
ACAGGCCAAATTCAGATAATCGACGCCAGGGTTAGTTTAAACGAATTCGAGCTCGGTACC
C


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence:
GTTTAAAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Not_Applicable
ProteinPurified: Not_Applicable
SolubleProtein: Not_Applicable
Find experimental protocols in GO.97548
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pEU-His-FV

pEU-His-FV in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pEU319 Forward
Reverse:  pEU Reverse
Description: Cell-free expression vector, adds N-terminal 6xHis tag; amp resistance; restriction enzyme cloning (SgfI, PmeI).
Comments: Cloning into this vector will remove the BarCat casstte. To avoid, the toxicity of the barnase gene, the vector pEU-HSBC (EvNO00306667) can be ordered, which substitutes sacB for barnase.
Size (bp): 4966
Parent Vector: None
Empty Vector: EvNO00084283
Properties: cell-free expression, multiple cloning site, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
Publications: PMID: 15782178
Title: Cell-free protein production and labeling protocol for NMR-based structural proteomics

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 origin 2809 3491
gene fragment TMV-L TMV-L 278 2238
gene fragment Omega TMV Omega 397 520
gene fragment BarCat-cat BarCat cassette, including CAT 1010 1667
gene fragment BarCat-bar BarCat cassette, including Barnase 572 908
primer His2 forward His2 forward sequencing primer TCTTTCAAATACTTCTAGCTAGAGTA 424 449
promoter SP6 SP6 promoter 373 390
recombination site MCS pF1K (Flexi-Vector) homology domain 1675 1803
selectable marker AmpR ampicillin resistance gene 3589 4248
tag His 6xHis tag 527 544

 


Cloning Information: 510490
GI: 118764400
GenBank Accession: BC128574
HIP Master Clone ID: 421657
Labome: ER-antibody
Original Clone ID: 5962.1.28_GO.97548
Structural Annotation Wiki: TOPSAN
TargetTrack - Experimental data: GO.97548
UniProt: Q9UBT1
UniProt: P03372
Species Specific ID: 2099
Target GenBank: BC128574