DNASU Plasmid Repository • 480.965.5697 | Email

zgc:103638 (Danio rerio) in pVP33K (His and MBP-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  enah
Gene Name:  enabled homolog (Drosophila)
Sequence             
Original Clone ID: 5470.1.64_GO.79223
Keyword: full-length cds
Species: Danio rerio
Type: cDNA
Vector Name: pVP33K               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: Linker not verified.
Mutation/
Discrepancy :
No / No
Publications: None
Authors: University of Wisconsin Madison
PSI
Center for Eukaryotic Structural Genomics
DrCD00397106

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 354nts         Open reading frame : 51 to 404

TGTTCCAGGGGCCCTGTTGCCCAGGTTGCTGTGAAAACCTGTACTTCCAGGCGATCGCCG
TTTATGATGACGCCAATAAGAAGTGGGTTCCGGCTGGTGGATCCACAGGCTTTAGCAGAG
TCCACATCTATCACCACACTGGCAACAACGCCTTCCGAGTAGTGGGCCGTAAAATTCAGG
ACCACCAGGTGGTAATAAACTGTGCCATTCCCAAGGGGCTGAAATACAACCAGGCCACGC
AAACCTTTCACCAGTGGCGAGATGCACGGCAGGTGTACGGCCTTAACTTTGGCAGCAAAG
AGGATGCCAGTGTATTTGCCAGTGCCATGATGCATGCCCTAGAGGTGCTGAACTCTCAGG
ATGCAGGTGAGAAAGCCCTTTTCACTGCAGGGTGCGAAGTTTAATAGGTTTAAACGAATT
CGAGCTCGGTACCC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence:
GTTTAAAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Not_Applicable
ProteinPurified: Not_Applicable
SolubleProtein: Not_Applicable
Find experimental protocols in GO.79223
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pVP33K

pVP33K in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  MBP Forward
Reverse:  T7 Terminator
Description: Bacterial (E. coli) expression, adds N-terminal 6xHis tag, MBP, 3CP cleavage, tetra-cys, Tev cleavage; kanamycin resistance; restriction enzyme cloning (SgfI, PmeI).
Comments: Cloning into this vector will remove the BarCat casstte
Size (bp): 7253
Parent Vector: None
Empty Vector: EvNO00084285
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
Publications: PMID: 16377204
Title: High efficiency single step production of expression plasmids from cDNA clones using the Flexi Vector cloning system

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 5502 6184
promoter T5 T5 promoter 123 169
protease cleavage site 3C 3CP cleavage site 1373 1397
protease cleavage site TEV TEV protease cleavage site 1415 1435
repressor protein gene LacI LacI cds 3842 4858
selectable marker CmR chloramphenicol resistance gene (CmR) 1900 2556
tag MBP MBP tag 267 1363
tag His 6xHis tag 237 260

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : enah
Symbol Nomenclature : enah
SYNONYM : id:ibd2798; si:ch211-215p14.1; zgc:103638
Designation : enabled homolog
Full Nomenclature : enabled homolog (Drosophila)
GENEID : 541394
Locus Tag : DKEY-1J5.1
GI : 60552545
GenBank Accession : BC090907
Zebrafish Database : ZDB-GENE-010323-11
Target GenBank: BC090907

 

Protein

SMART domain : WH1 : WASP homology region 1
Structural Annotation Wiki : TOPSAN
UniProt : Q5BKW3

Clone

Cloning Information : 510770
HIP Master Clone ID : 421937
Original Clone ID : 5470.1.64_GO.79223

Experimental

TargetTrack - Experimental data : GO.79223

Organism


TAX_ID : 7955
Species Specific ID: 541394

Genome

Chromosome : 20
Ensembl : ENSDARG00000032049

Reagents

Labome : zgc-103638-cDNA