DNASU Plasmid Repository • 480.965.5697 | Email

nosip (Danio rerio) in pVP33K (His and MBP-tagged bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  nosip
Gene Name:  nitric oxide synthase interacting protein
Sequence             
Original Clone ID: 1683.1.92_GO.79359
Keyword: full-length cds
Species: Danio rerio
Type: cDNA
Vector Name: pVP33K               Format:  CLOSED
Source: Center for Eukaryotic Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: University of Wisconsin Madison
PSI
Center for Eukaryotic Structural Genomics
DrCD00397162

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 921nts         Open reading frame : 51 to 971

TGTTCCAGGGGCCCTGTTGCCCAGGTTGCTGTGAAAACCTGTACTTCCAGGCGATCGCCA
CACGACATGGCAAGAACTGCACCGCGGGAGCCGTTTACACTTATCACGAGAAGAGGAAAG
ACACTGCGGCTTCGGGTTATGGGACACAGAGTGTGCGTTTGGGGAAGGATGCAATCAAAG
ATTTTGACTGCTGCTCTCTGTCCTTGCAGCCCTGCAGAGATCCTGTCCTAACTGAAGATG
GATACTTGTATGAAAAAGAGGCCATTCTGCAGTACATCCTTCATCAGAAAACAGAAATTG
CCAAGAAAATGAAGGCATATGAAAAGCAGAAACAGGCTCTGAAGAGTGAAGGCCAGCTGG
AGTCCAAATCTGAGGAGCGAGAGAGAGCTGAGAAGTTCAAACAGAGAGAGAATAACATCG
TCTCAAAACCTATTAACCCCTTTACTTCAGGTAAATCTAAAGATGAAGGAAACCAGAATG
GCTCAACCAGCTCCTCCAGTACTGACACGTCATCAGGAGAGTCCAGTTCCTCTTCAGCTC
TGCCCAGTTTCTGGATCCCCAGCCTCACACCAGAGGCCAAGCCCACATTGCTAAAGAAAC
CTTCAAAGACAGTGTCGTGCCCCATGTCAGGACGTCCCTTGAAGATGAGTGATTTGATTA
CAGTCCGTTTCACACCACTGGACCCCAGTTTGGACAGAGTGGCTCTTCTCACACGTCAAG
ACAGATATGTGTGTGCAGTAACCAAAGACACACTTGGAAACTCGGTGCCCTGTGCAGTTC
TCAGACCCTCTGGAGTCGTAGTCACTATGGAGTGTGTGGAGAAGCTCATAAAGAAAGACA
TGGTTGATCCAATAACTGGAGACAAACTGAAAGAAAAGGACATCATACCCATTCAGAGGG
GTGGGACTGGCTTCGCGGGCTCAGGAGTGGACCTCAAAGCTAAAGAGGCCAGACCCGTAA
TGCAAGCATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence:
GTTTAAAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Not_Tested
SolubleProtein: Not_Tested
Find experimental protocols in GO.79359
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pVP33K

pVP33K in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  MBP Forward
Reverse:  T7 Terminator
Description: Bacterial (E. coli) expression, adds N-terminal 6xHis tag, MBP, 3CP cleavage, tetra-cys, Tev cleavage; kanamycin resistance; restriction enzyme cloning (SgfI, PmeI).
Comments: Cloning into this vector will remove the BarCat casstte
Size (bp): 7253
Parent Vector: None
Empty Vector: EvNO00084285
Properties: bacterial expression, multiple cloning site, with tag/fusion/marker
Author Name: Center for Eukaryotic Structural Genomics
Publications: PMID: 16377204
Title: High efficiency single step production of expression plasmids from cDNA clones using the Flexi Vector cloning system

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1-type bacterial origin of replication 5502 6184
promoter T5 T5 promoter 123 169
protease cleavage site 3C 3CP cleavage site 1373 1397
protease cleavage site TEV TEV protease cleavage site 1415 1435
repressor protein gene LacI LacI cds 3842 4858
selectable marker CmR chloramphenicol resistance gene (CmR) 1900 2556
tag MBP MBP tag 267 1363
tag His 6xHis tag 237 260

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : nosip
Symbol Nomenclature : nosip
SYNONYM : wu:fb80a11; zgc:101669
Designation : nitric oxide synthase-interacting protein
Full Nomenclature : nitric oxide synthase interacting protein
GENEID : 492793
GI : 55925361
GenBank Accession : NM_001007434
Zebrafish Database : ZDB-GENE-041114-146
Vega : OTTDARG00000037486
Target GenBank: NM_001007434

 

Protein

SMART domain : Ubox : Modified RING finger domain
Structural Annotation Wiki : TOPSAN
UniProt : Q5U3S7

Clone

Cloning Information : 510898
HIP Master Clone ID : 422065
Original Clone ID : 1683.1.92_GO.79359

Experimental

TargetTrack - Experimental data : GO.79359

Organism


TAX_ID : 7955
Species Specific ID: 492793

Genome

Chromosome : 3
Ensembl : ENSDARG00000037958

Reagents

Labome : nosip-cDNA