DNASU Plasmid Repository • 480.965.5697 | Email

BH0826 (Bacillus halodurans C-125) in pMCSG19B (MBP and His-tagged expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BH0826
Gene Name:  transcriptional repressor
Sequence             
Original Clone ID: APC38911_SG259_pMCSG19B
Keyword: full length
Species: Bacillus halodurans C-125
Type: cDNA
Vector Name: pMCSG19B               Format:  CLOSED
Source: Midwest Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Midwest Center for Structural Genomics
Jessica Bearden
BhCD00398333

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 756nts         Open reading frame : 29 to 784

CGAGAACCTGTACTTCCAATCCAATGCCATGTTAACGATCGAACGTCATGAACAAATTGT
AAAACTAGTACAAGAAAAAGAAGTTGTAACGATTCATGACCTTGTCGAATATACGAATGC
GTCAGAGTCCACGATTCGTCGTGATTTGACCGAGCTAGAAAAACAGAAAAAATTAAAGCG
TATTCATGGCGGGGCTTCCGTCCTAAAGAAGCGCCGTGAAGAACCTACGATGGCTGAAAA
AACAGTCAAAAACAATCACGAAAAAAAGAAGATCGCGGAATTAGCTGCAAGCTTCGTAGA
GGATGGCGATTGTCTGTTTCTTGACGCAGGAACGACGACGTATGAATTAATTCCTTTTAT
TAAAACTAAAAAAATAGTCGTTGTCACAAATGGACTTGACAGCATCTCCGCACTGCTTGA
GGCAGGGGTGGAAACGTACGTTATTGGCGGGACGGTGAAGCAAGGAACACGGGCATTTGT
AGGACGCCATGCGATTCAAAGCTTACAGACGTTTCGATTTGATAAAGCGTTCCTTGGCAT
TAACGGAGTCCATTTAGAGGATGGCTTCACAACGCCTGATCCGCAAGAAGCATACGTGAA
AGAAACAGCCCTTTCCCTTTCGCGGGAAGCCTTTATGTTGGTGGACCATTCAAAATTTGG
AGAAACGACATTTGCAACCGTAGCTCCGATTCATGCCGCTACGATTGTGACGAGCAGCCA
AGTGGAGCAGCAAGTCATTCAAGCATACGAAACTCAGACAGCAGTGAAGGTGGTGACGCT
ATAACATTGGAAGTGGATAATAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GCC

3' Linker Sequence:
TAAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in APC38911
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMCSG19B

pMCSG19B in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  ANForward
Reverse:  T7 terminator
Description: Vector for solubility of insert and for purification, with T7 promoter, adds N-terminal MBP, TVMV cleavage site, His tag, and TEV protease cleavage site; ampicillin resistance; ligation independent cloning (LIC).
Comments: Similar to pMCSG19C except location of the TVMV CDS. See http://bioinformatics.anl.gov/mcsg/technologies/vectors.html for more details
Size (bp): 7468
Parent Vector: None
Empty Vector: None
Properties: bacterial expression
Author Name: PSI
Midwest Center for Structural Genomics
Midwest Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori pBR322 origin of replication 5432 5432
gene fragment TVMV cds TVMV protease coding sequence 1881 2591
promoter T7 T7 promoter 1515 1531
protease cleavage site TVMV TVMV cleavage site 286 306
protease cleavage site TEV TEV protease cleavage site 223 243
recombination site LIC Ligation Independent Cloning (LIC) recombination site 204 235
repressor binding site tet operator TetO fragment 2610 2765
repressor binding site lac operator LacO fragment 1490 1512
repressor protein gene LacI LacI cds 3072 4031
selectable marker AmpR Ampicillin resistance 6220 7080
tag MBP Maltose binding protein tag 337 1143
tag His N terminal His tag 268 285
trxn termination sequence T7 term T7 termination sequence 26 72

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Reagents

Gene

 

Gene Symbol : BH0826
GENEID : 892392
Locus Tag : BH0826
GI : 10173441
Target GenBank: None

 

Clone

Cloning Information : 577198
HIP Master Clone ID : 482797
Original Clone ID : APC38911_SG259_pMCSG19B

Experimental

TargetTrack - Experimental data : APC38911

Organism


TAX_ID : 272558
Species Specific ID: 892392

Reagents

Labome : BH0826-cDNA