DNASU Plasmid Repository • 480.965.5697 | Email

PIK3C2A (Homo sapiens) in pDONR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PIK3C2A
Gene Name:  phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100072721)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00398551

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 5058nts         Open reading frame : 1 to 5058
Reference Sequence Alignment

ATGGCTCAGATATCTAGCAACAGCGGATTTAAAGAATGTCCATCTTCACATCCGGAACCA
ACAAGAGCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCA
AAACTGCAAAAGGATAGACAAGTGACTGACAATCAGAGAGGCTTTGAGTTGTCAAGCAGC
ACCAGAAAAAAAGCACAGGTTTATAACAAGCAGGATTATGATCTCATGGTGTTTCCTGAA
TCAGATTCCCAAAAAAGAGCATTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTT
GAGAAACTATTGCTGGATGACAGTTTCGAGACTAAAAAAACACCTGTATTACCAGTTACT
CCTATTCTGAGCCCTTCCTTTTCAGCACAGCTCTATTTTAGACCTACTATTCAGAGAGGA
CAGTGGCCACCTGGATTACCTGGGCCTTCCACTTATGCTTTACCTTCTATTTATCCTTCT
ACTTACAGTAAACAGGCTGCATTCCAAAATGGCTTCAATCCAAGAATGCCCACTTTTCCA
TCTACAGAACCTATATATTTAAGTCTTCCGGGACAATCTCCATATTTCTCATATCCTTTG
ACACCTGCCACACCCTTTCATCCACAAGGAAGCTTACCTATCTATCGTCCAGTAGTCAGT
ACTGACATGGCAAAACTATTTGACAAAATAGCTAGTACATCAGAATTTTTAAAAAATGGG
AAAGCAAGGACTGATTTGGAGATAACAGATTCAAAAGTCAGCAATCTACAGGTATCTCCA
AAGTCTGAGGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAG
GTGGATAATGTGGAGGTATTAGACCATGAGGAAGAGAAAAATGTTTCAAGTTTGCTAGCA
AAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCGACAGCAAATTGTCATCTTGAA
AGAAAGGTGAATGGAAAATCCCTTTCTGTGGCAACTGTTACAAGAAGCCAGTCTTTAAAT
ATTCGAACAACTCAGCTTGCAAAAGCCCAGGGCCATATATCTCAGAAAGACCCAAATGGG
ACCAGTAGTTTGCCAACTGGAAGTTCTCTTCTTCAAGAAGTTGAAGTACAGAATGAGGAG
ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCGCAAAGAAACATATGCGGAGAA
AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
ACTGCGGCAACATACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR223

pDONR223 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Recombinational donor/master vector; spectinomycin resistance; recombinational cloning.
Comments: pDONR223 contains several improvements over the original Donor vector pDONR201. In pDONR223, the universal Forward (Fwd) and Reverse (Rev) sequencing primer sites flank the attP1 and attP2 recombination sites, the replication origin has been improved to increase copy number, and the selectable marker is spectinomycin resistance (instead of kanamycin resistance in pDONR201), which permits the use of either ampicillin or kanamycin resistance markers in Destination vectors.
Size (bp): 5005
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 bacterial origin 4339 4958
death cassette ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1200 1409
primer M13 forward M13 forward sequencing primer 536 553
primer M13 reverse M13 reverse sequencing primer 3020 3040
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only 569 652
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only 2896 2983
selectable marker SpectR spectinomycin resistance gene 3471 4262
trxn termination sequence rrnB rrnB T1 and T2 terminator 268 470

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PIK3C2A
Symbol Nomenclature : PIK3C2A
SYNONYM : CPK; PI3-K-C2(ALPHA); PI3-K-C2A
Designation : C2-containing phosphatidylinositol kinase|PI3K-C2-alpha|PI3K-C2alpha|phosphatidylinositol 4-phosphate 3-kinase C2 domain-containing subunit alpha|phosphatidylinositol-4-phosphate 3-kinase C2 domain-containing subunit alpha|phosphoinositide 3-kinase-C2-alpha|phosphoinositide-3-kinase, class 2, alpha polypeptide|ptdIns-3-kinase C2 subunit alpha
Full Nomenclature : phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
GENEID : 5286
GenBank Accession : HQ258691
HGNC : 8971
MIM : 603601
Vega : OTTHUMG00000166036
Target GenBank: HQ258691

 

Reference Sequence Alignment

  

HsCD00398551        ATGGCTCAGATATCTAGCAACAGCGGATTTAAAGAATGTCCATCTTCACATCCGGAACCA
XM_005252977.1      ATGGCTCAGATATCTAGCAACAGCGGATTTAAAGAATGTCCATCTTCACATCCGGAACCA
NM_002645.2         ATGGCTCAGATATCTAGCAACAGCGGATTTAAAGAATGTCCATCTTCACATCCGGAACCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        ACAAGAGCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCA
XM_005252977.1      ACAAGAGCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCA
NM_002645.2         ACAAGAGCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        AAACTGCAAAAGGATAGACAAGTGACTGACAATCAGAGAGGCTTTGAGTTGTCAAGCAGC
XM_005252977.1      AAACTGCAAAAGGATAGACAAGTGACTGACAATCAGAGAGGCTTTGAGTTGTCAAGCAGC
NM_002645.2         AAACTGCAAAAGGATAGACAAGTGACTGACAATCAGAGAGGCTTTGAGTTGTCAAGCAGC
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        ACCAGAAAAAAAGCACAGGTTTATAACAAGCAGGATTATGATCTCATGGTGTTTCCTGAA
XM_005252977.1      ACCAGAAAAAAAGCACAGGTTTATAACAAGCAGGATTATGATCTCATGGTGTTTCCTGAA
NM_002645.2         ACCAGAAAAAAAGCACAGGTTTATAACAAGCAGGATTATGATCTCATGGTGTTTCCTGAA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        TCAGATTCCCAAAAAAGAGCATTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTT
XM_005252977.1      TCAGATTCCCAAAAAAGAGCATTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTT
NM_002645.2         TCAGATTCCCAAAAAAGAGCATTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        GAGAAACTATTGCTGGATGACAGTTTCGAGACTAAAAAAACACCTGTATTACCAGTTACT
XM_005252977.1      GAGAAACTATTGCTGGATGACAGTTTCGAGACTAAAAAAACACCTGTATTACCAGTTACT
NM_002645.2         GAGAAACTATTGCTGGATGACAGTTTCGAGACTAAAAAAACACCTGTATTACCAGTTACT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        CCTATTCTGAGCCCTTCCTTTTCAGCACAGCTCTATTTTAGACCTACTATTCAGAGAGGA
XM_005252977.1      CCTATTCTGAGCCCTTCCTTTTCAGCACAGCTCTATTTTAGACCTACTATTCAGAGAGGA
NM_002645.2         CCTATTCTGAGCCCTTCCTTTTCAGCACAGCTCTATTTTAGACCTACTATTCAGAGAGGA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        CAGTGGCCACCTGGATTACCTGGGCCTTCCACTTATGCTTTACCTTCTATTTATCCTTCT
XM_005252977.1      CAGTGGCCACCTGGATTACCTGGGCCTTCCACTTATGCTTTACCTTCTATTTATCCTTCT
NM_002645.2         CAGTGGCCACCTGGATTACCTGGGCCTTCCACTTATGCTTTACCTTCTATTTATCCTTCT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        ACTTACAGTAAACAGGCTGCATTCCAAAATGGCTTCAATCCAAGAATGCCCACTTTTCCA
XM_005252977.1      ACTTACAGTAAACAGGCTGCATTCCAAAATGGCTTCAATCCAAGAATGCCCACTTTTCCA
NM_002645.2         ACTTACAGTAAACAGGCTGCATTCCAAAATGGCTTCAATCCAAGAATGCCCACTTTTCCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        TCTACAGAACCTATATATTTAAGTCTTCCGGGACAATCTCCATATTTCTCATATCCTTTG
XM_005252977.1      TCTACAGAACCTATATATTTAAGTCTTCCGGGACAATCTCCATATTTCTCATATCCTTTG
NM_002645.2         TCTACAGAACCTATATATTTAAGTCTTCCGGGACAATCTCCATATTTCTCATATCCTTTG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        ACACCTGCCACACCCTTTCATCCACAAGGAAGCTTACCTATCTATCGTCCAGTAGTCAGT
XM_005252977.1      ACACCTGCCACACCCTTTCATCCACAAGGAAGCTTACCTATCTATCGTCCAGTAGTCAGT
NM_002645.2         ACACCTGCCACACCCTTTCATCCACAAGGAAGCTTACCTATCTATCGTCCAGTAGTCAGT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        ACTGACATGGCAAAACTATTTGACAAAATAGCTAGTACATCAGAATTTTTAAAAAATGGG
XM_005252977.1      ACTGACATGGCAAAACTATTTGACAAAATAGCTAGTACATCAGAATTTTTAAAAAATGGG
NM_002645.2         ACTGACATGGCAAAACTATTTGACAAAATAGCTAGTACATCAGAATTTTTAAAAAATGGG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        AAAGCAAGGACTGATTTGGAGATAACAGATTCAAAAGTCAGCAATCTACAGGTATCTCCA
XM_005252977.1      AAAGCAAGGACTGATTTGGAGATAACAGATTCAAAAGTCAGCAATCTACAGGTATCTCCA
NM_002645.2         AAAGCAAGGACTGATTTGGAGATAACAGATTCAAAAGTCAGCAATCTACAGGTATCTCCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        AAGTCTGAGGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAG
XM_005252977.1      AAGTCTGAGGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAG
NM_002645.2         AAGTCTGAGGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        GTGGATAATGTGGAGGTATTAGACCATGAGGAAGAGAAAAATGTTTCAAGTTTGCTAGCA
XM_005252977.1      GTGGATAATGTGGAGGTATTAGACCATGAGGAAGAGAAAAATGTTTCAAGTTTGCTAGCA
NM_002645.2         GTGGATAATGTGGAGGTATTAGACCATGAGGAAGAGAAAAATGTTTCAAGTTTGCTAGCA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        AAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCGACAGCAAATTGTCATCTTGAA
XM_005252977.1      AAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCGACAGCAAATTGTCATCTTGAA
NM_002645.2         AAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCGACAGCAAATTGTCATCTTGAA
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        AGAAAGGTGAATGGAAAATCCCTTTCTGTGGCAACTGTTACAAGAAGCCAGTCTTTAAAT
XM_005252977.1      AGAAAGGTGAATGGAAAATCCCTTTCTGTGGCAACTGTTACAAGAAGCCAGTCTTTAAAT
NM_002645.2         AGAAAGGTGAATGGAAAATCCCTTTCTGTGGCAACTGTTACAAGAAGCCAGTCTTTAAAT
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        ATTCGAACAACTCAGCTTGCAAAAGCCCAGGGCCATATATCTCAGAAAGACCCAAATGGG
XM_005252977.1      ATTCGAACAACTCAGCTTGCAAAAGCCCAGGGCCATATATCTCAGAAAGACCCAAATGGG
NM_002645.2         ATTCGAACAACTCAGCTTGCAAAAGCCCAGGGCCATATATCTCAGAAAGACCCAAATGGG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        ACCAGTAGTTTGCCAACTGGAAGTTCTCTTCTTCAAGAAGTTGAAGTACAGAATGAGGAG
XM_005252977.1      ACCAGTAGTTTGCCAACTGGAAGTTCTCTTCTTCAAGAAGTTGAAGTACAGAATGAGGAG
NM_002645.2         ACCAGTAGTTTGCCAACTGGAAGTTCTCTTCTTCAAGAAGTTGAAGTACAGAATGAGGAG
XM_005252980.1      ------------------------------------------------------------
                                                                                

HsCD00398551        ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
XM_005252977.1      ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
NM_002645.2         ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
XM_005252980.1      ATGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAAATTTCCATATACCAATCAC
                    ************************************************************

HsCD00398551        CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCGCAAAGAAACATATGCGGAGAA
XM_005252977.1      CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCACAAAGAAACATATGCGGAGAA
NM_002645.2         CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCACAAAGAAACATATGCGGAGAA
XM_005252980.1      CGCACAAACCCAGGCTATTTGTTAAGTCCAGTCACAGCACAAAGAAACATATGCGGAGAA
                    **************************************.*********************

HsCD00398551        AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
XM_005252977.1      AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
NM_002645.2         AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
XM_005252980.1      AATGCTAGTGTGAAGGTCTCCATTGACATTGAAGGATTTCAGCTACCAGTTACTTTTACG
                    ************************************************************

HsCD00398551        TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
XM_005252977.1      TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
NM_002645.2         TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
XM_005252980.1      TGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTACATGAT
                    ************************************************************

HsCD00398551        GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
XM_005252977.1      GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
NM_002645.2         GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
XM_005252980.1      GACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTAAAAGTTTGTGGTCAAGAGGAAGTG
                    ************************************************************

HsCD00398551        CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
XM_005252977.1      CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
NM_002645.2         CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
XM_005252980.1      CTGCAGAATAATCATTGCCTTGGAAGTCATGAGCATATTCAAAACTGTCGAAAATGGGAC
                    ************************************************************

HsCD00398551        ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
XM_005252977.1      ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
NM_002645.2         ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
XM_005252980.1      ACAGAAATTAGACTACAACTCTTGACCTTCAGTGCAATGTGTCAAAATCTGGCCCGAACA
                    ************************************************************

HsCD00398551        GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
XM_005252977.1      GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
NM_002645.2         GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
XM_005252980.1      GCAGAAGATGATGAAACACCCGTGGATTTAAACAAACACCTGTATCAAATAGAAAAACCT
                    ************************************************************

HsCD00398551        TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
XM_005252977.1      TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
NM_002645.2         TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
XM_005252980.1      TGCAAAGAAGCCATGACGAGACACCCTGTTGAAGAACTCTTAGATTCTTATCACAACCAA
                    ************************************************************

HsCD00398551        GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
XM_005252977.1      GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
NM_002645.2         GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
XM_005252980.1      GTAGAACTGGCTCTTCAAATTGAAAACCAACACCGAGCAGTAGATCAAGTAATTAAAGCT
                    ************************************************************

HsCD00398551        GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
XM_005252977.1      GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
NM_002645.2         GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
XM_005252980.1      GTAAGAAAAATCTGTAGTGCTTTAGATGGTGTCGAGACTCTTGCCATTACAGAATCAGTA
                    ************************************************************

HsCD00398551        AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
XM_005252977.1      AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
NM_002645.2         AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
XM_005252980.1      AAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAACTGCTGATGTGACTTCTTTG
                    ************************************************************

HsCD00398551        TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
XM_005252977.1      TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
NM_002645.2         TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
XM_005252980.1      TTTGGAGGAGAAGACACTAGCAGGAGTTCAACTAGGGGCTCACTTAATCCTGAAAATCCT
                    ************************************************************

HsCD00398551        GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
XM_005252977.1      GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
NM_002645.2         GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
XM_005252980.1      GTTCAAGTAAGCATAAACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGCA
                    ************************************************************

HsCD00398551        AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
XM_005252977.1      AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
NM_002645.2         AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
XM_005252980.1      AATTCTGGTAGGAGTCCTACAGACTGTGCCCAAAGTAGCAAGAGTGTCAAGGAAGCATGG
                    ************************************************************

HsCD00398551        ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
XM_005252977.1      ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
NM_002645.2         ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
XM_005252980.1      ACTACAACAGAGCAGCTCCAGTTTACTATTTTTGCTGCTCATGGAATTTCAAGTAATTGG
                    ************************************************************

HsCD00398551        GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
XM_005252977.1      GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
NM_002645.2         GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
XM_005252980.1      GTATCAAATTATGAAAAATACTACTTGATATGTTCACTGTCTCACAATGGAAAGGATCTT
                    ************************************************************

HsCD00398551        TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
XM_005252977.1      TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
NM_002645.2         TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
XM_005252980.1      TTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAA
                    ************************************************************

HsCD00398551        TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
XM_005252977.1      TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
NM_002645.2         TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
XM_005252980.1      TGGGATGAACTAATCATTTTTCCTATCCAGATATCACAATTGCCATTAGAATCAGTTCTT
                    ************************************************************

HsCD00398551        CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
XM_005252977.1      CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
NM_002645.2         CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
XM_005252980.1      CACCTTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAG
                    ************************************************************

HsCD00398551        CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
XM_005252977.1      CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
NM_002645.2         CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
XM_005252980.1      CAGAGAAAGGGACCAGAAGCTTTGGGCAAAGTTTCTTTACCTCTTTTTGACTTTAAACGG
                    ************************************************************

HsCD00398551        TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
XM_005252977.1      TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
NM_002645.2         TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
XM_005252980.1      TTTTTAACATGTGGAACTAAACTTCTATATCTTTGGACTTCATCACATACAAATTCTGTT
                    ************************************************************

HsCD00398551        CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
XM_005252977.1      CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
NM_002645.2         CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
XM_005252980.1      CCTGGAACAGTTACCAAAAAAGGATATGTCATGGAAAGAATAGTGCTACAGGTTGATTTT
                    ************************************************************

HsCD00398551        CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
XM_005252977.1      CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
NM_002645.2         CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
XM_005252980.1      CCTTCTCCTGCATTTGATATTATTTATACAACTCCTCAAGTTGACAGAAGCATTATACAG
                    ************************************************************

HsCD00398551        CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
XM_005252977.1      CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
NM_002645.2         CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
XM_005252980.1      CAACATAACTTAGAAACACTAGAGAATGATATAAAAGGGAAACTTCTTGATATTCTTCAT
                    ************************************************************

HsCD00398551        AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
XM_005252977.1      AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
NM_002645.2         AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
XM_005252980.1      AAAGACTCATCACTTGGACTTTCTAAAGAAGATAAAGCTTTTTTATGGGAGAAACGTTAT
                    ************************************************************

HsCD00398551        TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
XM_005252977.1      TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
NM_002645.2         TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
XM_005252980.1      TATTGCTTCAAACACCCAAATTGTCTTCCTAAAATATTAGCAAGCGCCCCAAACTGGAAA
                    ************************************************************

HsCD00398551        TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
XM_005252977.1      TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
NM_002645.2         TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
XM_005252980.1      TGGGTTAATCTTGCCAAAACTTACTCATTGCTTCACCAGTGGCCTGCATTGTACCCACTA
                    ************************************************************

HsCD00398551        ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
XM_005252977.1      ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
NM_002645.2         ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
XM_005252980.1      ATTGCATTGGAACTTCTTGATTCAAAATTTGCTGATCAGGAAGTAAGATCCCTAGCTGTG
                    ************************************************************

HsCD00398551        ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
XM_005252977.1      ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
NM_002645.2         ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
XM_005252980.1      ACCTGGATTGAGGCCATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTACAA
                    ************************************************************

HsCD00398551        GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
XM_005252977.1      GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
NM_002645.2         GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
XM_005252980.1      GCTTTGAAATATGAAATTTACTTGAATAGTTCATTAGTGCAATTCCTTTTGTCCAGGGCA
                    ************************************************************

HsCD00398551        TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
XM_005252977.1      TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
NM_002645.2         TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
XM_005252980.1      TTGGGAAATATCCAGATAGCACACAATTTATATTGGCTTCTCAAAGATGCCCTGCATGAT
                    ************************************************************

HsCD00398551        GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
XM_005252977.1      GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
NM_002645.2         GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
XM_005252980.1      GTACAGTTTAGTACCCGATACGAACATGTTTTGGGTGCTCTCCTGTCAGTAGGAGGAAAA
                    ************************************************************

HsCD00398551        CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
XM_005252977.1      CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
NM_002645.2         CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
XM_005252980.1      CGACTTAGAGAAGAACTTCTAAAACAGACGAAACTTGTACAGCTTTTAGGAGGAGTAGCA
                    ************************************************************

HsCD00398551        GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
XM_005252977.1      GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
NM_002645.2         GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
XM_005252980.1      GAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTTCTCCAAAGAAGTATGGAA
                    ************************************************************

HsCD00398551        CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
XM_005252977.1      CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
NM_002645.2         CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
XM_005252980.1      CGAGTACAGTCCTTTTTTCAGAAAAATAAATGCCGTCTCCCTCTCAAGCCAAGTCTAGTG
                    ************************************************************

HsCD00398551        GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
XM_005252977.1      GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
NM_002645.2         GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
XM_005252980.1      GCAAAAGAATTAAATATTAAGTCGTGTTCCTTCTTCAGTTCTAATGCTGTCCCCCTAAAA
                    ************************************************************

HsCD00398551        GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
XM_005252977.1      GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
NM_002645.2         GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
XM_005252980.1      GTCACAATGGTGAATGCTGACCCTATGGGAGAAGAAATTAATGTCATGTTTAAGGTTGGT
                    ************************************************************

HsCD00398551        GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
XM_005252977.1      GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
NM_002645.2         GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
XM_005252980.1      GAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAGATTATGGATAAGATCTGG
                    ************************************************************

HsCD00398551        CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
XM_005252977.1      CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
NM_002645.2         CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
XM_005252980.1      CTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTCTCAACTGGCAGAGAT
                    ************************************************************

HsCD00398551        CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
XM_005252977.1      CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
NM_002645.2         CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
XM_005252980.1      CGAGGCATGGTGGAGCTGGTTCCTGCTTCCGATACCCTCAGGAAAATCCAAGTGGAATAT
                    ************************************************************

HsCD00398551        GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
XM_005252977.1      GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
NM_002645.2         GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
XM_005252980.1      GGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTAAGGAAATACAATCCC
                    ************************************************************

HsCD00398551        TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
XM_005252977.1      TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
NM_002645.2         TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
XM_005252980.1      TCTGAAGAAGAATATGAAAAGGCTTCAGAGAACTTTATCTATTCCTGTGCTGGATGCTGT
                    ************************************************************

HsCD00398551        GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
XM_005252977.1      GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
NM_002645.2         GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
XM_005252980.1      GTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGC
                    ************************************************************

HsCD00398551        ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
XM_005252977.1      ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
NM_002645.2         ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
XM_005252980.1      ACGGGACACATGTTTCACATTGACTTTGGAAAGTTTTTGGGACATGCACAGATGTTTGGC
                    ************************************************************

HsCD00398551        AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
XM_005252977.1      AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
NM_002645.2         AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
XM_005252980.1      AGCTTCAAAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATTAAT
                    ************************************************************

HsCD00398551        GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
XM_005252977.1      GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
NM_002645.2         GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
XM_005252980.1      GGGGGTGAAAAGCCCACCATTCGTTTTCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTAC
                    ************************************************************

HsCD00398551        AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
XM_005252977.1      AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
NM_002645.2         AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
XM_005252980.1      AACTTGATAAGAAAGCAGACAAACCTTTTTCTTAACCTCCTTTCACTGATGATTCCTTCA
                    ************************************************************

HsCD00398551        GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
XM_005252977.1      GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
NM_002645.2         GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
XM_005252980.1      GGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCC
                    ************************************************************

HsCD00398551        CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
XM_005252977.1      CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
NM_002645.2         CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
XM_005252980.1      CAAACTACAGACGCAGAAGCTACAATTTTCTTTACTAGGCTTATTGAATCAAGTTTGGGA
                    ************************************************************

HsCD00398551        AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
XM_005252977.1      AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
NM_002645.2         AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
XM_005252980.1      AGCATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTTCTGGT
                    ************************************************************

HsCD00398551        CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
XM_005252977.1      CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
NM_002645.2         CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
XM_005252980.1      CTTCCTTCTAATGATGAGCCCATCCTTTCATTTTCACCTAAAACATACTCCTTTAGACAA
                    ************************************************************

HsCD00398551        GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
XM_005252977.1      GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
NM_002645.2         GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
XM_005252980.1      GATGGTCGAATCAAGGAAGTCTCTGTTTTTACATATCATAAGAAATACAACCCAGATAAA
                    ************************************************************

HsCD00398551        CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
XM_005252977.1      CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
NM_002645.2         CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
XM_005252980.1      CATTATATTTATGTAGTCCGAATTTTGAGGGAAGGACAGATTGAACCATCATTTGTCTTC
                    ************************************************************

HsCD00398551        CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
XM_005252977.1      CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
NM_002645.2         CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
XM_005252980.1      CGAACATTTGACGAATTTCAGGAACTTCACAATAAGCTCAGTATTATTTTTCCACTTTGG
                    ************************************************************

HsCD00398551        AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
XM_005252977.1      AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
NM_002645.2         AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
XM_005252980.1      AAGTTACCAGGCTTTCCTAATAGGATGGTTCTAGGAAGAACACACATAAAAGATGTAGCA
                    ************************************************************

HsCD00398551        GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
XM_005252977.1      GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
NM_002645.2         GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
XM_005252980.1      GCCAAAAGGAAAATTGAGTTAAACAGTTACTTACAGAGTTTGATGAATGCTTCAACGGAT
                    ************************************************************

HsCD00398551        GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
XM_005252977.1      GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
NM_002645.2         GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
XM_005252980.1      GTAGCAGAGTGTGATCTTGTTTGTACTTTCTTCCACCCTTTACTTCGTGATGAGAAAGCT
                    ************************************************************

HsCD00398551        GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
XM_005252977.1      GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
NM_002645.2         GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
XM_005252980.1      GAAGGGATAGCTAGGTCTGCAGATGCAGGTTCCTTCAGTCCTACTCCAGGCCAAATAGGA
                    ************************************************************

HsCD00398551        GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
XM_005252977.1      GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
NM_002645.2         GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
XM_005252980.1      GGAGCTGTGAAATTATCCATCTCTTACCGAAATGGTACTCTTTTCATCATGGTGATGCAT
                    ************************************************************

HsCD00398551        ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
XM_005252977.1      ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
NM_002645.2         ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
XM_005252980.1      ATCAAAGATCTTGTTACTGAAGATGGAGCTGACCCAAATCCATATGTCAAAACATACCTA
                    ************************************************************

HsCD00398551        CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
XM_005252977.1      CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
NM_002645.2         CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
XM_005252980.1      CTTCCAGATAACCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACGAGGAAT
                    ************************************************************

HsCD00398551        CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
XM_005252977.1      CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
NM_002645.2         CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
XM_005252980.1      CCGACATTCAATGAAATGCTTGTATACAGTGGATATAGCAAAGAAACCCTAAGACAGCGA
                    ************************************************************

HsCD00398551        GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
XM_005252977.1      GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
NM_002645.2         GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
XM_005252980.1      GAACTTCAACTAAGTGTACTCAGTGCAGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGA
                    ************************************************************

HsCD00398551        GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
XM_005252977.1      GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
NM_002645.2         GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
XM_005252980.1      GTAACCCTGCCTTTGAAAGATTTCAACTTGAGCAAAGAGACGGTTAAATGGTATCAGCTG
                    ************************************************************

HsCD00398551        ACTGCGGCAACATACTTG---
XM_005252977.1      ACTGCGGCAACATACTTGTAA
NM_002645.2         ACTGCGGCAACATACTTGTAA
XM_005252980.1      ACTGCGGCAACATACTTGTAA
                    ******************   

Pathways

NCI : Integrins in angiogenesis
Panther : Angiogenesis
Panther : Axon guidance mediated by netrin
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Hypoxia response via HIF activation
Panther : Insulin/IGF pathway-protein kinase B signaling cascade
Panther : Integrin signalling pathway
Panther : VEGF signaling pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : Clathrin derived vesicle budding
Reactome : Golgi Associated Vesicle Biogenesis
Reactome : Membrane Trafficking
Reactome : Metabolism
Reactome : Metabolism of lipids and lipoproteins
Reactome : PI Metabolism
Reactome : Phospholipid metabolism
Reactome : Synthesis of PIPs at the Golgi membrane
Reactome : Synthesis of PIPs at the early endosome membrane
Reactome : Synthesis of PIPs at the late endosome membrane
Reactome : Synthesis of PIPs at the plasma membrane
Reactome : trans-Golgi Network Vesicle Budding
WikiPathway : Insulin Signaling
WikiPathway : Regulation of Actin Cytoskeleton

Clone

Cloning Information : 571089

Organism


TAX_ID : 9606
Species Specific ID: 5286

Genome

Chromosome : 11
Map Location : 11p15.5-p14
Ensembl : ENSG00000011405

Reagents

Labome : PIK3C2A-antibody