DNASU Plasmid Repository • 480.965.5697 | Email

TCEB1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TCEB1
Gene Name:  transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH168548.01L
Keyword: nan
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00039883

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 336nts        
Open reading frame : 1 to 336
Reference Sequence Alignment

ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 424
Start on reference sequence 86
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site U19 primer 517 535
primer site Att P2 Primer 3026 3043
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TCEB1
Symbol Nomenclature : TCEB1
SYNONYM : SIII; eloC
Designation : RNA polymerase II transcription factor SIII subunit C|SIII p15|elongin 15 kDa subunit|transcription elongation factor B polypeptide 1
Full Nomenclature : transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)
GENEID : 6921
HGNC : 11617
MIM : 600788
Vega : OTTHUMG00000164501
Target GenBank: BC013809

 

Reference Sequence Alignment

  

HsCD00039883        ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_001204859.1      ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_001204860.1      ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_001204858.1      ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_001204857.1      ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_001204861.1      ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_001204862.1      ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
NM_005648.3         ATGGATGGAGAGGAGAAAACCTATGGTGGCTGTGAAGGACCTGATGCCATGTATGTCAAA
                    ************************************************************

HsCD00039883        TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_001204859.1      TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_001204860.1      TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_001204858.1      TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_001204857.1      TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_001204861.1      TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_001204862.1      TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
NM_005648.3         TTGATATCATCTGATGGCCATGAATTTATTGTAAAAAGAGAACATGCATTAACATCAGGC
                    ************************************************************

HsCD00039883        ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_001204859.1      ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_001204860.1      ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_001204858.1      ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_001204857.1      ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_001204861.1      ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_001204862.1      ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
NM_005648.3         ACGATAAAAGCCATGTTGAGTGGCCCAGGTCAGTTTGCTGAGAACGAAACCAATGAGGTC
                    ************************************************************

HsCD00039883        AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_001204859.1      AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_001204860.1      AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_001204858.1      AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_001204857.1      AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_001204861.1      AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_001204862.1      AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
NM_005648.3         AATTTTAGAGAGATACCTTCACATGTGCTATCGAAAGTATGCATGTATTTTACGTACAAG
                    ************************************************************

HsCD00039883        GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_001204859.1      GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_001204860.1      GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_001204858.1      GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_001204857.1      GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_001204861.1      GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_001204862.1      GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
NM_005648.3         GTTCGCTACACTAACAGCTCCACCGAGATTCCTGAATTCCCAATTGCACCTGAAATTGCA
                    ************************************************************

HsCD00039883        CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTTG
NM_001204859.1      CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
NM_001204860.1      CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
NM_001204858.1      CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
NM_001204857.1      CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
NM_001204861.1      CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
NM_001204862.1      CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
NM_005648.3         CTGGAACTGCTGATGGCTGCGAACTTCTTAGATTGTTAA
                    *************************************:.

Pathways

NCI : HIF-2-alpha transcription factor network
NCI : Hypoxic and oxygen homeostasis regulation of HIF-1-alpha
Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Cellular response to hypoxia
Reactome : Cellular responses to stress
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Disease
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Gene Expression
Reactome : HIV elongation arrest and recovery
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Late Phase of HIV Life Cycle
Reactome : Oxygen-dependent proline hydroxylation of Hypoxia-inducible Factor Alpha
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : Regulation of Hypoxia-inducible Factor (HIF) by oxygen
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Vif-mediated degradation of APOBEC3G

Protein

SMART domain : Skp1 : Found in Skp1 protein family
UniProt : Q15369
UniProt : E5RGD9
HPRD : 02875

Clone

Cloning Information : 168548
HIP Master Clone ID : 142014
Original Clone ID : FLH168548.01L

Organism


TAX_ID : 9606
Species Specific ID: 6921

Genome

Chromosome : 8
Map Location : 8q21.11
Ensembl : ENSG00000154582

Reagents

Labome : TCEB1-antibody