DNASU Plasmid Repository • 480.965.5697 | Email

MRE11A (Homo sapiens) in pDONR223 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MRE11A
Gene Name:  MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Sequence             
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR223               Format:  FUSION
Source: The ORFeome Collaboration
Description: None
Comments: The ORFeome Collaboration entry clone (IMAGE:100073465)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: The ORFeome Collaboration
HsCD00399220

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 618nts         Open reading frame : 51 to 668
Reference Sequence Alignment

TCCATTAGGGATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCATGAGTACTG
CAGATGCACTTGATGATGAAAACACATTTAAAATATTAGTTGCAACAGATATTCATCTTG
GATTTATGGAGAAAGATGCAGTCAGAGGAAATGATACGTTTGTAACACTCGATGAAATTT
TAAGACTTGCCCAGGAAAATGAAGTGGATTTTATTTTGTTAGGTGGTGATCTTTTTCATG
AAAATAAGCCCTCAAGGAAAACATTACATACCTGCCTCGAGTTATTAAGAAAATATTGTA
TGGGTGATCGGCCTGTCCAGTTTGAAATTCTCAGTGATCAGTCAGTCAACTTTGGTTTTA
GTAAGTTTCCATGGGTGAACTATCAAGATGGCAACCTCAACATTTCAATTCCAGTGTTTA
GTATTCATGGCAATCATGACGATCCCACAGGGGCAGATGCACTTTGTGCCTTGGACATTT
TAAGTTGTGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAGAAGATAGACA
TTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGTTTAGGATCCA
TTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATGTTGAGACCAA
AGGAAGATTACCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  spectinomycin
Bacterial Selection Condition:  100 ug/mL spectinomycin
Growth Condition:  Growth at 37 degrees C in LB supplemented with 100 ug/mL spectinomycin.
Comments:  None
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR223

pDONR223 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: Recombinational donor/master vector; spectinomycin resistance; recombinational cloning.
Comments: pDONR223 contains several improvements over the original Donor vector pDONR201. In pDONR223, the universal Forward (Fwd) and Reverse (Rev) sequencing primer sites flank the attP1 and attP2 recombination sites, the replication origin has been improved to increase copy number, and the selectable marker is spectinomycin resistance (instead of kanamycin resistance in pDONR201), which permits the use of either ampicillin or kanamycin resistance markers in Destination vectors.
Size (bp): 5005
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pBR322 origin pBR322 bacterial origin 4339 4958
death cassette ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1200 1409
primer M13 forward M13 forward sequencing primer 536 553
primer M13 reverse M13 reverse sequencing primer 3020 3040
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only 569 652
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only 2896 2983
selectable marker SpectR spectinomycin resistance gene 3471 4262
trxn termination sequence rrnB rrnB T1 and T2 terminator 268 470

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MRE11A
Symbol Nomenclature : MRE11A
SYNONYM : ATLD; HNGS1; MRE11; MRE11B
Designation : AT-like disease|DNA recombination and repair protein|MRE11 homolog 1|MRE11 homolog A|double-strand break repair protein MRE11A|endo/exonuclease Mre11|meiotic recombination 11 homolog 1|meiotic recombination 11 homolog A
Full Nomenclature : MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
GENEID : 4361
GenBank Accession : JF432288
HGNC : 7230
MIM : 600814
Vega : OTTHUMG00000167780
Target GenBank: JF432288

 

Reference Sequence Alignment

  

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ATGAGTACTGCAGATGCACTTGATGATGAAAACACATTTAAAATATTAGTTGCAACAGAT
NM_005590.3         ATGAGTACTGCAGATGCACTTGATGATGAAAACACATTTAAAATATTAGTTGCAACAGAT
XM_005274007.1      ATGAGTACTGCAGATGCACTTGATGATGAAAACACATTTAAAATATTAGTTGCAACAGAT
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ATTCATCTTGGATTTATGGAGAAAGATGCAGTCAGAGGAAATGATACGTTTGTAACACTC
NM_005590.3         ATTCATCTTGGATTTATGGAGAAAGATGCAGTCAGAGGAAATGATACGTTTGTAACACTC
XM_005274007.1      ATTCATCTTGGATTTATGGAGAAAGATGCAGTCAGAGGAAATGATACGTTTGTAACACTC
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         GATGAAATTTTAAGACTTGCCCAGGAAAATGAAGTGGATTTTATTTTGTTAGGTGGTGAT
NM_005590.3         GATGAAATTTTAAGACTTGCCCAGGAAAATGAAGTGGATTTTATTTTGTTAGGTGGTGAT
XM_005274007.1      GATGAAATTTTAAGACTTGCCCAGGAAAATGAAGTGGATTTTATTTTGTTAGGTGGTGAT
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         CTTTTTCATGAAAATAAGCCCTCAAGGAAAACATTACATACCTGCCTCGAGTTATTAAGA
NM_005590.3         CTTTTTCATGAAAATAAGCCCTCAAGGAAAACATTACATACCTGCCTCGAGTTATTAAGA
XM_005274007.1      CTTTTTCATGAAAATAAGCCCTCAAGGAAAACATTACATACCTGCCTCGAGTTATTAAGA
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         AAATATTGTATGGGTGATCGGCCTGTCCAGTTTGAAATTCTCAGTGATCAGTCAGTCAAC
NM_005590.3         AAATATTGTATGGGTGATCGGCCTGTCCAGTTTGAAATTCTCAGTGATCAGTCAGTCAAC
XM_005274007.1      AAATATTGTATGGGTGATCGGCCTGTCCAGTTTGAAATTCTCAGTGATCAGTCAGTCAAC
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         TTTGGTTTTAGTAAGTTTCCATGGGTGAACTATCAAGATGGCAACCTCAACATTTCAATT
NM_005590.3         TTTGGTTTTAGTAAGTTTCCATGGGTGAACTATCAAGATGGCAACCTCAACATTTCAATT
XM_005274007.1      TTTGGTTTTAGTAAGTTTCCATGGGTGAACTATCAAGATGGCAACCTCAACATTTCAATT
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         CCAGTGTTTAGTATTCATGGCAATCATGACGATCCCACAGGGGCAGATGCACTTTGTGCC
NM_005590.3         CCAGTGTTTAGTATTCATGGCAATCATGACGATCCCACAGGGGCAGATGCACTTTGTGCC
XM_005274007.1      CCAGTGTTTAGTATTCATGGCAATCATGACGATCCCACAGGGGCAGATGCACTTTGTGCC
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------ATGTCTGTGGAG
NM_005591.3         TTGGACATTTTAAGTTGTGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAG
NM_005590.3         TTGGACATTTTAAGTTGTGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAG
XM_005274007.1      TTGGACATTTTAAGTTGTGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAG
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      AAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGT
NM_005591.3         AAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGT
NM_005590.3         AAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGT
XM_005274007.1      AAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGT
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      TTAGGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATG
NM_005591.3         TTAGGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATG
NM_005590.3         TTAGGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATG
XM_005274007.1      TTAGGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATG
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      TTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGG
NM_005591.3         TTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGG
NM_005590.3         TTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGG
XM_005274007.1      TTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGG
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      AGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTT
NM_005591.3         AGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTT
NM_005590.3         AGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTT
XM_005274007.1      AGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTT
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      GTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTG
NM_005591.3         GTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTG
NM_005590.3         GTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTG
XM_005274007.1      GTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTG
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      TTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTA
NM_005591.3         TTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTA
NM_005590.3         TTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTA
XM_005274007.1      TTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTA
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      AAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCT
NM_005591.3         AAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCT
NM_005590.3         AAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCT
XM_005274007.1      AAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCT
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      CTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATT
NM_005591.3         CTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATT
NM_005590.3         CTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATT
XM_005274007.1      CTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATT
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      TTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATT
NM_005591.3         TTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATT
NM_005590.3         TTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATT
XM_005274007.1      TTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATT
                                                                                

HsCD00399220        ----------------------------------------------TCCATTAGGGATGC
XM_005274008.1      GAAGAAATGCTTGAAAATGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAG
NM_005591.3         GAAGAAATGCTTGAAAATGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAG
NM_005590.3         GAAGAAATGCTTGAAAATGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAG
XM_005274007.1      GAAGAAATGCTTGAAAATGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAG
                                                                  :***  ..*..:. 

HsCD00399220        TTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCATGAGTACTGCAGATGCACTTGAT
XM_005274008.1      CCTCTTGTACGACTGCGAGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGC
NM_005591.3         CCTCTTGTACGACTGCGAGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGC
NM_005590.3         CCTCTTGTACGACTGCGAGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGC
XM_005274007.1      CCTCTTGTACGACTGCGAGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGC
                      * **.**. .* .. : ** **:*:*.:* :** :* ..:.**  ...** :*** . 

HsCD00399220        GATGAAAACACATTTAAAATATTAGTTGCAACAGATATTCATCTTGGATTTATGGAGAAA
XM_005274008.1      TTTAGCCAGAAATTTGTGGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGG
NM_005591.3         TTTAGCCAGAAATTTGTGGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGG
NM_005590.3         TTTAGCCAGAAATTTGTGGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGG
XM_005274007.1      TTTAGCCAGAAATTTGTGGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGG
                     :*....* *.****.:..::  .**:**:*.: .:*:: * .**. . :*:*  : *..

HsCD00399220        GATGCAGTCAGAGGAAATGATACGTTTGTAACACTCGATGAAATTTTAAGACTTGCCCAG
XM_005274008.1      CATAGAGAACAAAAGGAAAAAACAGGAGAAGAGATCAACTTTGGGAAACTTATCACAAAG
NM_005591.3         CATAGAGAACAAAAGGAAAAAACAGGAGAAGAGATCAACTTTGGGAAACTTATCACAAAG
NM_005590.3         CATAGAGAACAAAAGGAAAAAACAGGAGAAGAGATCAACTTTGGGAAACTTATCACAAAG
XM_005274007.1      CATAGAGAACAAAAGGAAAAAACAGGAGAAGAGATCAACTTTGGGAAACTTATCACAAAG
                     **. **:...*....*:.*:**.  :*:*....**.*  ::.  ::*. :.* .*..**

HsCD00399220        GAAAATGAAGTGGATTTTATTTTGTTAGGTGGTGATCTTTTTCATGAAAATAAGCCCTCA
XM_005274008.1      CCTTCAGAAGGAACAACTTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGCA
NM_005591.3         CCTTCAGAAGGAACAACTTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGCA
NM_005590.3         CCTTCAGAAGGAACAACTTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGCA
XM_005274007.1      CCTTCAGAAGGAACAACTTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGCA
                     .::.:**** ...:: *:*:: * ***.:*.* :* *::::**  *.::*.*..** **

HsCD00399220        AGGAAAACATTACATACCTGCCTCGAGTTATTAAGAAAATATTGTATGGGTGATCGGCCT
XM_005274008.1      GAGAAGAATGTGCAGCTCTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAA
NM_005591.3         GAGAAGAATGTGCAGCTCTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAA
NM_005590.3         GAGAAGAATGTGCAGCTCTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAA
XM_005274007.1      GAGAAGAATGTGCAGCTCTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAA
                    ..***.*.: *.** . ** .**  :.: * :****...::  **.:.* :*::*.. .:

HsCD00399220        GTCCAG---------------TTTGAAATTCTCAGTGATCAGTCAGTCAACTTTGGTTTT
XM_005274008.1      TTTGTGGACAAGGAGGAGAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAAA
NM_005591.3         TTTGTGGACAAGGAGGAGAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAAA
NM_005590.3         TTTGTGGACAAGGAGGAGAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAAA
XM_005274007.1      TTTGTGGACAAGGAGGAGAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAAA
                     *  :*                :**..*** : ..: :: :*:.* :*.* ** *.::::

HsCD00399220        AGTAAGTTTCCATGGGTGAACTATCAAGATGGCAACCTCAACATTTCAATTCCAGTGTTT
XM_005274008.1      ACACAGCGATTTCTTAAAGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGAG
NM_005591.3         ACACAGCGATTTCTTAAAGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGAG
NM_005590.3         ACACAGCGATTTCTTAAAGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGAG
XM_005274007.1      ACACAGCGATTTCTTAAAGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGAG
                    * :.**  :  :   .:..*. .***:.:**. ..****.*..: :.***  .:*:* : 

HsCD00399220        AGTATTCATGGCAATCATGACGATCCCACAGGGGCAGATGCACTTTGTGCCTTGGACATT
XM_005274008.1      GTACGTCGTTTCAGAGAAACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCGT
NM_005591.3         GTACGTCGTTTCAGAGAAACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCGT
NM_005590.3         GTACGTCGTTTCAGAGAAACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCGT
XM_005274007.1      GTACGTCGTTTCAGAGAAACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCGT
                    . :. **.*  **.: *:..*..:*..*.*.. .*:.***.* :: .**.  :.*:*. *

HsCD00399220        TTAAGTTGTGCTGGATTTGTAAATCACTTTGGACGTTCAATG-------------TCTGT
XM_005274008.1      GAGGCTATGACCAGGGCCAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTT
NM_005591.3         GAGGCTATGACCAGGGCCAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTT
NM_005590.3         GAGGCTATGACCAGGGCCAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTT
XM_005274007.1      GAGGCTATGACCAGGGCCAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTT
                     :.. *:  .* .*.   . *..:*:*: :  :*. ***.:*              ** *

HsCD00399220        GGAGAAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATA
XM_005274008.1      AGTGCTGATGACCTTATGAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGAT
NM_005591.3         AGTGCTGATGACCTTATGAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGAT
NM_005590.3         AGTGCTGATGACCTTATGAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGAT
XM_005274007.1      AGTGCTGATGACCTTATGAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGAT
                    .*:*.:***...*:*::*:  . : :*  : **.**..**:* . **:** *  *.*.::

HsCD00399220        TGGTTTAGG---------------------------------------------------
XM_005274008.1      AGCATCTCAGCAGCAACCAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGA
NM_005591.3         AGCATCTCAGCAGCAACCAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGA
NM_005590.3         AGCATCTCAGCAGCAACCAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGA
XM_005274007.1      AGCATCTCAGCAGCAACCAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGA
                    :* :* : .                                                   

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      GGGCAGAATTCAGCATCGAGAGGAGGGTCTCAAAGAGGAAGAGCAGACACTGGTCTGGAG
NM_005591.3         GGGCAGAATTCAGCATCGAGAGGAGGGTCTCAAAGAGGAAGAGCAGACACTGGTCTGGAG
NM_005590.3         GGGCAGAATTCAGCATCGAGAGGAGGGTCTCAAAGAG-----------------------
XM_005274007.1      GGGCAGAATTCAGCATCGAGAGGAGGGTCTCAAAGAGGAAGAGCAGACACTGGTCTGGAG
                                                                                

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      ACTTCTACCCGTAGCAGGAACTCAAAGACTGCTGTGTCAGCATCTAGAAATATGTCTATT
NM_005591.3         ACTTCTACCCGTAGCAGGAACTCAAAGACTGCTGTGTCAGCATCTAGAAATATGTCTATT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ACTTCTACCCGTAGCAGGAACTCAAAGACTGCTGTGTCAGCATCTAGAAATATGTCTATT
                                                                                

HsCD00399220        ----------------------------ATCCATTCCAGATGAAAGGCTCTATCGAATGT
XM_005274008.1      ATAGATGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAATGTCACTACTAAGAATTAT
NM_005591.3         ATAGATGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAATGTCACTACTAAGAATTAT
NM_005590.3         -GAAGAGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAATGTCACTACTAAGAATTAT
XM_005274007.1      ATAGATGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAATGTCACTACTAAGAATTAT
                                                * **:* **..*: .:..  :***: .*:*.*

HsCD00399220        TTGTCAATAAAAAAGTAACAATGTTGAGACCAAAGGAAGATTACCCAACTTTCTTGTACA
XM_005274008.1      TCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTCA
NM_005591.3         TCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTCA
NM_005590.3         TCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTCA
XM_005274007.1      TCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTCA
                    * . ...*.*::.** :* *: .:* ***  :.....*..: *   ::* *:* : *:**

HsCD00399220        AAGTTGGCATTATAAGAAAGCATTGCTTATCAA---------------------------
XM_005274008.1      AAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAATCATGTCCCAGAGTCAAGTA
NM_005591.3         AAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAATCATGTCCCAGAGTCAAGTA
NM_005590.3         AAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAATCATGTCCCAGAGTCAAGTA
XM_005274007.1      AAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAATCATGTCCCAGAGTCAAGTA
                    ***: .*.: :*:.. ..: **  .*:*.: ..                           

HsCD00399220        ------------------------------------------------------------
XM_005274008.1      TCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGATGATCCTTTTATGAACACT
NM_005591.3         TCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGATGATCCTTTTATGAACACT
NM_005590.3         TCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGATGATCCTTTTATGAACACT
XM_005274007.1      TCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGATGATCCTTTTATGAACACT
                                                                                

HsCD00399220        ---------------------------
XM_005274008.1      AGTTCTTTAAGAAGAAATAGAAGATAA
NM_005591.3         AGTTCTTTAAGAAGAAATAGAAGATAA
NM_005590.3         AGTTCTTTAAGAAGAAATAGAAGATAA
XM_005274007.1      AGTTCTTTAAGAAGAAATAGAAGATAA
                                               

Pathways

NCI : ATM pathway
NCI : BARD1 signaling events
NCI : Fanconi anemia pathway
NCI : Regulation of Telomerase
NCI : Validated transcriptional targets of deltaNp63 isoforms
Reactome : Assembly of the RAD50-MRE11-NBS1 complex at DNA double-strand breaks
Reactome : Cell Cycle
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : IRF3-mediated induction of type I IFN
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MRN complex relocalizes to nuclear foci
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : STING mediated induction of host immune responses
WikiPathway : DNA damage response
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Non-homologous end joining
WikiPathway : miRNA regulation of DNA Damage Response

Protein

HPRD : 02889

Clone

Cloning Information : 573318

Organism


TAX_ID : 9606
Species Specific ID: 4361

Genome

Chromosome : 11
Map Location : 11q21
Ensembl : ENSG00000020922

Reagents

Labome : Mre11-antibody