DNASU Plasmid Repository • 480.965.5697 | Email

IFNG (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  IFNG
Gene Name:  interferon, gamma
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH031198.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000004

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 501nts         Open reading frame : 1 to 501
Reference Sequence Alignment

ATGAAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGC
TGTTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCA
GGTCATTCAGATGTAGCGGATAATGGAACTCTTTTCTTAGGCATTTTGAAGAATTGGAAA
GAGGAGAGTGACAGAAAAATAATGCAGAGCCAAATTGTCTCCTTTTACTTCAAACTTTTT
AAAAACTTTAAAGATGACCAGAGCATCCAAAAGAGTGTGGAGACCATCAAGGAAGACATG
AATGTCAAGTTTTTCAATAGCAACAAAAAGAAACGAGATGACTTCGAAAAGCTGACTAAT
TATTCGGTAACTGACTTGAATGTCCAACGCAAAGCAATACATGAACTCATCCAAGTGATG
GCTGAACTGTCGCCAGCAGCTAAAACAGGGAAGCGAAAAAGGAGTCAGATGCTGTTTCAA
GGTCGAAGAGCATCCCAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 609
Start on reference sequence 109
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : IFNG
Symbol Nomenclature : IFNG
SYNONYM : IFG; IFI
Designation : IFN-gamma|immune interferon|interferon gamma
Full Nomenclature : interferon, gamma
GENEID : 3458
GI : 61364956
GenBank Accession : AY890689
HGNC : 5438
MIM : 147570
Vega : OTTHUMG00000169113
Target GenBank: NM_000619

 

Reference Sequence Alignment

  

HsCD00000004      ATGAAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGC
NM_000619.2       ATGAAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGC
                  ************************************************************

HsCD00000004      TGTTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCA
NM_000619.2       TGTTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCA
                  ************************************************************

HsCD00000004      GGTCATTCAGATGTAGCGGATAATGGAACTCTTTTCTTAGGCATTTTGAAGAATTGGAAA
NM_000619.2       GGTCATTCAGATGTAGCGGATAATGGAACTCTTTTCTTAGGCATTTTGAAGAATTGGAAA
                  ************************************************************

HsCD00000004      GAGGAGAGTGACAGAAAAATAATGCAGAGCCAAATTGTCTCCTTTTACTTCAAACTTTTT
NM_000619.2       GAGGAGAGTGACAGAAAAATAATGCAGAGCCAAATTGTCTCCTTTTACTTCAAACTTTTT
                  ************************************************************

HsCD00000004      AAAAACTTTAAAGATGACCAGAGCATCCAAAAGAGTGTGGAGACCATCAAGGAAGACATG
NM_000619.2       AAAAACTTTAAAGATGACCAGAGCATCCAAAAGAGTGTGGAGACCATCAAGGAAGACATG
                  ************************************************************

HsCD00000004      AATGTCAAGTTTTTCAATAGCAACAAAAAGAAACGAGATGACTTCGAAAAGCTGACTAAT
NM_000619.2       AATGTCAAGTTTTTCAATAGCAACAAAAAGAAACGAGATGACTTCGAAAAGCTGACTAAT
                  ************************************************************

HsCD00000004      TATTCGGTAACTGACTTGAATGTCCAACGCAAAGCAATACATGAACTCATCCAAGTGATG
NM_000619.2       TATTCGGTAACTGACTTGAATGTCCAACGCAAAGCAATACATGAACTCATCCAAGTGATG
                  ************************************************************

HsCD00000004      GCTGAACTGTCGCCAGCAGCTAAAACAGGGAAGCGAAAAAGGAGTCAGATGCTGTTTCAA
NM_000619.2       GCTGAACTGTCGCCAGCAGCTAAAACAGGGAAGCGAAAAAGGAGTCAGATGCTGTTTCGA
                  **********************************************************.*

HsCD00000004      GGTCGAAGAGCATCCCAGTTG
NM_000619.2       GGTCGAAGAGCATCCCAGTAA
                  *******************:.

Pathways

NCI : AP-1 transcription factor network
NCI : ATF-2 transcription factor network
NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Calcium signaling in the CD4+ TCR pathway
NCI : Downstream signaling in naïve CD8+ T cells
NCI : Glucocorticoid receptor regulatory network
NCI : IFN-gamma pathway
NCI : IL12 signaling mediated by STAT4
NCI : IL12-mediated signaling events
NCI : IL2-mediated signaling events
NCI : IL23-mediated signaling events
NCI : IL27-mediated signaling events
NCI : PDGFR-alpha signaling pathway
NCI : Regulation of Telomerase
NCI : SHP2 signaling
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Interferon-gamma signaling pathway
Reactome : Cytokine Signaling in Immune system
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon gamma signaling
Reactome : Regulation of IFNG signaling
WikiPathway : Cytokines and Inflammatory Response
WikiPathway : Folate Metabolism
WikiPathway : Hypertrophy Model
WikiPathway : Inflammatory Response Pathway
WikiPathway : Proteasome Degradation
WikiPathway : Selenium Pathway
WikiPathway : Senescence and Autophagy
WikiPathway : TGF Beta Signaling Pathway
WikiPathway : Type II interferon signaling (IFNG)
WikiPathway : Vitamin B12 Metabolism

Protein

UniProt : P01579
HPRD : 00957

Clone

Cloning Information : 31198
HIP Master Clone ID : 61574
Original Clone ID : FLH031198.01L

Organism


TAX_ID : 9606
Species Specific ID: 3458

Genome

Chromosome : 12
Map Location : 12q14
Ensembl : ENSG00000111537

Reagents

Labome : IFN-gamma-antibody