DNASU Plasmid Repository • 480.965.5697 | Email

HSPA8 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  HSPA8
Gene Name:  heat shock 70kDa protein 8
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH169716.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00040011

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1941nts         Open reading frame : 1 to 1941
Reference Sequence Alignment

ATGTCCAAGGGACCTGCAGTTGGTATTGATCTTGGCACCACCTACTCTTGTGTGGGTGTT
TTCCAGCACGGAAAAGTCGAGATAATTGCCAATGATCAGGGAAACCGAACCACTCCAAGC
TATGTCGCCTTTACGGACACTGAACGGTTGATCGGTGATGCCGCAAAGAATCAAGTTGCA
ATGAACCCCACCAACACAGTTTTTGATGCCAAACGTCTGATTGGACGCAGATTTGATGAT
GCTGTTGTCCAGTCTGATATGAAACATTGGCCCTTTATGGTGGTGAATGATGCTGGCAGG
CCCAAGGTCCAAGTAGAATACAAGGGAGAGACCAAAAGCTTCTATCCAGAGGAGGTGTCT
TCTATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCCTACCTTGGGAAGACTGTTACC
AATGCTGTGGTCACAGTGCCAGCTTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGAT
GCTGGAACTATTGCTGGTCTCAATGTACTTAGAATTATTAATGAGCCAACTGCTGCTGCT
ATTGCTTACGGCTTAGACAAAAAGGTTGGAGCAGAAAGAAACGTGCTCATCTTTGACCTG
GGAGGTGGCACTTTTGATGTGTCAATCCTCACTATTGAGGATGGAATCTTTGAGGTCAAG
TCTACAGCTGGAGACACCCACTTGGGTGGAGAAGATTTTGACAACCGAATGGTCAACCAT
TTTATTGCTGAGTTTAAGCGCAAGCATAAGAAGGACATCAGTGAGAACAAGAGAGCTGTA
AGACGCCTCCGTACTGCTTGTGAACGTGCTAAGCGTACCCTCTCTTCCAGCACCCAGGCC
AGTATTGAGATCGATTCTCTCTATGAAGGAATCGACTTCTATACCTCCATTACCCGTGCC
CGATTTGAAGAACTGAATGCTGACCTGTTCCGTGGCACCCTGGACCCAGTAGAGAAAGCC
CTTCGAGATGCCAAACTAGACAAGTCACAGATTCATGATATTGTCCTGGTTGGTGGTTCT
ACTCGTATCCCCAAGATTCAGAAGCTTCTCCAAGACTTCTTCAATGGAAAAGAACTGAAT
AAGAGCATCAACCCTGATGAAGCTGTTGCTTATGGTGCAGCTGTCCAGGCAGCCATCTTG
TCTGGAGACAAGTCTGAGAATGTTCAAGATTTGCTGCTCTTGGATGTCACTCCTCTTTCC
CTTGGTATTGAAACTGCTGGTGGAGTCATGACTGTCCTCATCAAGCGTAATACCACCATT
CCTACCAAGCAGACACAGACCTTCACTACCTATTCTGACAACCAGCCTGGTGTGCTTATT
CAGGTTTATGAAGGCGAGCGTGCCATGACAAAGGATAACAACCTGCTTGGCAAGTTTGAA
CTCACAGGCATACCTCCTGCACCCCGAGGTGTTCCTCAGATTGAAGTCACTTTTGACATT
GATGCCAATGGTATACTCAATGTCTCTGCTGTGGACAAGAGTACGGGAAAAGAGAACAAG
ATTACTATCACTAATGACAAGGGCCGTTTGAGCAAGGAAGACATTGAACGTATGGTCCAG
GAAGCTGAGAAGTACAAAGCTGAAGATGAGAAGCAGAGGGACAAGGTGTCATCCAAGAAT
TCACTTGAGTCCTATGCCTTCAACATGAAAGCAACTGTTGAAGATGAGAAACTTCAAGGC
AAGATTAACGATGAGGACAAACAGAAGATTCTGGACAAGTGTAATGAAATTATCAACTGG
CTTGATAAGAATCAGACTGCCGAGAAGGAAGAATTTGAACATCAACAGAAAGAGCTGGAG
AAAGTTTGCAACCCCATCATCACCAAGCTGTACCAGAGTGCAGGAGGCATGCCAGGAGGA
ATGCCTGGGGGATTTCCTGGTGGTGGAGCTCCTCCCTCTGGTGGTGCTTCCTCAGGGCCC
ACCATTGAAGAGGTTGATTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1999
Start on reference sequence 59
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : HSPA8
Symbol Nomenclature : HSPA8
SYNONYM : HEL-33; HEL-S-72p; HSC54; HSC70; HSC71; HSP71; HSP73; HSPA10; LAP1; NIP71
Designation : LPS-associated protein 1|N-myristoyltransferase inhibitor protein 71|constitutive heat shock protein 70|epididymis luminal protein 33|epididymis secretory sperm binding protein Li 72p|heat shock 70kd protein 10|heat shock cognate 71 kDa protein|heat shock cognate protein 54|lipopolysaccharide-associated protein 1
Full Nomenclature : heat shock 70kDa protein 8
GENEID : 3312
HGNC : 5241
MIM : 600816
Vega : OTTHUMG00000166030
Target GenBank: BC016179

 

Reference Sequence Alignment

  

HsCD00040011      ATGTCCAAGGGACCTGCAGTTGGTATTGATCTTGGCACCACCTACTCTTGTGTGGGTGTT
NM_006597.5       ATGTCCAAGGGACCTGCAGTTGGTATTGATCTTGGCACCACCTACTCTTGTGTGGGTGTT
                  ************************************************************

HsCD00040011      TTCCAGCACGGAAAAGTCGAGATAATTGCCAATGATCAGGGAAACCGAACCACTCCAAGC
NM_006597.5       TTCCAGCACGGAAAAGTCGAGATAATTGCCAATGATCAGGGAAACCGAACCACTCCAAGC
                  ************************************************************

HsCD00040011      TATGTCGCCTTTACGGACACTGAACGGTTGATCGGTGATGCCGCAAAGAATCAAGTTGCA
NM_006597.5       TATGTCGCCTTTACGGACACTGAACGGTTGATCGGTGATGCCGCAAAGAATCAAGTTGCA
                  ************************************************************

HsCD00040011      ATGAACCCCACCAACACAGTTTTTGATGCCAAACGTCTGATTGGACGCAGATTTGATGAT
NM_006597.5       ATGAACCCCACCAACACAGTTTTTGATGCCAAACGTCTGATTGGACGCAGATTTGATGAT
                  ************************************************************

HsCD00040011      GCTGTTGTCCAGTCTGATATGAAACATTGGCCCTTTATGGTGGTGAATGATGCTGGCAGG
NM_006597.5       GCTGTTGTCCAGTCTGATATGAAACATTGGCCCTTTATGGTGGTGAATGATGCTGGCAGG
                  ************************************************************

HsCD00040011      CCCAAGGTCCAAGTAGAATACAAGGGAGAGACCAAAAGCTTCTATCCAGAGGAGGTGTCT
NM_006597.5       CCCAAGGTCCAAGTAGAATACAAGGGAGAGACCAAAAGCTTCTATCCAGAGGAGGTGTCT
                  ************************************************************

HsCD00040011      TCTATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCCTACCTTGGGAAGACTGTTACC
NM_006597.5       TCTATGGTTCTGACAAAGATGAAGGAAATTGCAGAAGCCTACCTTGGGAAGACTGTTACC
                  ************************************************************

HsCD00040011      AATGCTGTGGTCACAGTGCCAGCTTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGAT
NM_006597.5       AATGCTGTGGTCACAGTGCCAGCTTACTTTAATGACTCTCAGCGTCAGGCTACCAAAGAT
                  ************************************************************

HsCD00040011      GCTGGAACTATTGCTGGTCTCAATGTACTTAGAATTATTAATGAGCCAACTGCTGCTGCT
NM_006597.5       GCTGGAACTATTGCTGGTCTCAATGTACTTAGAATTATTAATGAGCCAACTGCTGCTGCT
                  ************************************************************

HsCD00040011      ATTGCTTACGGCTTAGACAAAAAGGTTGGAGCAGAAAGAAACGTGCTCATCTTTGACCTG
NM_006597.5       ATTGCTTACGGCTTAGACAAAAAGGTTGGAGCAGAAAGAAACGTGCTCATCTTTGACCTG
                  ************************************************************

HsCD00040011      GGAGGTGGCACTTTTGATGTGTCAATCCTCACTATTGAGGATGGAATCTTTGAGGTCAAG
NM_006597.5       GGAGGTGGCACTTTTGATGTGTCAATCCTCACTATTGAGGATGGAATCTTTGAGGTCAAG
                  ************************************************************

HsCD00040011      TCTACAGCTGGAGACACCCACTTGGGTGGAGAAGATTTTGACAACCGAATGGTCAACCAT
NM_006597.5       TCTACAGCTGGAGACACCCACTTGGGTGGAGAAGATTTTGACAACCGAATGGTCAACCAT
                  ************************************************************

HsCD00040011      TTTATTGCTGAGTTTAAGCGCAAGCATAAGAAGGACATCAGTGAGAACAAGAGAGCTGTA
NM_006597.5       TTTATTGCTGAGTTTAAGCGCAAGCATAAGAAGGACATCAGTGAGAACAAGAGAGCTGTA
                  ************************************************************

HsCD00040011      AGACGCCTCCGTACTGCTTGTGAACGTGCTAAGCGTACCCTCTCTTCCAGCACCCAGGCC
NM_006597.5       AGACGCCTCCGTACTGCTTGTGAACGTGCTAAGCGTACCCTCTCTTCCAGCACCCAGGCC
                  ************************************************************

HsCD00040011      AGTATTGAGATCGATTCTCTCTATGAAGGAATCGACTTCTATACCTCCATTACCCGTGCC
NM_006597.5       AGTATTGAGATCGATTCTCTCTATGAAGGAATCGACTTCTATACCTCCATTACCCGTGCC
                  ************************************************************

HsCD00040011      CGATTTGAAGAACTGAATGCTGACCTGTTCCGTGGCACCCTGGACCCAGTAGAGAAAGCC
NM_006597.5       CGATTTGAAGAACTGAATGCTGACCTGTTCCGTGGCACCCTGGACCCAGTAGAGAAAGCC
                  ************************************************************

HsCD00040011      CTTCGAGATGCCAAACTAGACAAGTCACAGATTCATGATATTGTCCTGGTTGGTGGTTCT
NM_006597.5       CTTCGAGATGCCAAACTAGACAAGTCACAGATTCATGATATTGTCCTGGTTGGTGGTTCT
                  ************************************************************

HsCD00040011      ACTCGTATCCCCAAGATTCAGAAGCTTCTCCAAGACTTCTTCAATGGAAAAGAACTGAAT
NM_006597.5       ACTCGTATCCCCAAGATTCAGAAGCTTCTCCAAGACTTCTTCAATGGAAAAGAACTGAAT
                  ************************************************************

HsCD00040011      AAGAGCATCAACCCTGATGAAGCTGTTGCTTATGGTGCAGCTGTCCAGGCAGCCATCTTG
NM_006597.5       AAGAGCATCAACCCTGATGAAGCTGTTGCTTATGGTGCAGCTGTCCAGGCAGCCATCTTG
                  ************************************************************

HsCD00040011      TCTGGAGACAAGTCTGAGAATGTTCAAGATTTGCTGCTCTTGGATGTCACTCCTCTTTCC
NM_006597.5       TCTGGAGACAAGTCTGAGAATGTTCAAGATTTGCTGCTCTTGGATGTCACTCCTCTTTCC
                  ************************************************************

HsCD00040011      CTTGGTATTGAAACTGCTGGTGGAGTCATGACTGTCCTCATCAAGCGTAATACCACCATT
NM_006597.5       CTTGGTATTGAAACTGCTGGTGGAGTCATGACTGTCCTCATCAAGCGTAATACCACCATT
                  ************************************************************

HsCD00040011      CCTACCAAGCAGACACAGACCTTCACTACCTATTCTGACAACCAGCCTGGTGTGCTTATT
NM_006597.5       CCTACCAAGCAGACACAGACCTTCACTACCTATTCTGACAACCAGCCTGGTGTGCTTATT
                  ************************************************************

HsCD00040011      CAGGTTTATGAAGGCGAGCGTGCCATGACAAAGGATAACAACCTGCTTGGCAAGTTTGAA
NM_006597.5       CAGGTTTATGAAGGCGAGCGTGCCATGACAAAGGATAACAACCTGCTTGGCAAGTTTGAA
                  ************************************************************

HsCD00040011      CTCACAGGCATACCTCCTGCACCCCGAGGTGTTCCTCAGATTGAAGTCACTTTTGACATT
NM_006597.5       CTCACAGGCATACCTCCTGCACCCCGAGGTGTTCCTCAGATTGAAGTCACTTTTGACATT
                  ************************************************************

HsCD00040011      GATGCCAATGGTATACTCAATGTCTCTGCTGTGGACAAGAGTACGGGAAAAGAGAACAAG
NM_006597.5       GATGCCAATGGTATACTCAATGTCTCTGCTGTGGACAAGAGTACGGGAAAAGAGAACAAG
                  ************************************************************

HsCD00040011      ATTACTATCACTAATGACAAGGGCCGTTTGAGCAAGGAAGACATTGAACGTATGGTCCAG
NM_006597.5       ATTACTATCACTAATGACAAGGGCCGTTTGAGCAAGGAAGACATTGAACGTATGGTCCAG
                  ************************************************************

HsCD00040011      GAAGCTGAGAAGTACAAAGCTGAAGATGAGAAGCAGAGGGACAAGGTGTCATCCAAGAAT
NM_006597.5       GAAGCTGAGAAGTACAAAGCTGAAGATGAGAAGCAGAGGGACAAGGTGTCATCCAAGAAT
                  ************************************************************

HsCD00040011      TCACTTGAGTCCTATGCCTTCAACATGAAAGCAACTGTTGAAGATGAGAAACTTCAAGGC
NM_006597.5       TCACTTGAGTCCTATGCCTTCAACATGAAAGCAACTGTTGAAGATGAGAAACTTCAAGGC
                  ************************************************************

HsCD00040011      AAGATTAACGATGAGGACAAACAGAAGATTCTGGACAAGTGTAATGAAATTATCAACTGG
NM_006597.5       AAGATTAACGATGAGGACAAACAGAAGATTCTGGACAAGTGTAATGAAATTATCAACTGG
                  ************************************************************

HsCD00040011      CTTGATAAGAATCAGACTGCCGAGAAGGAAGAATTTGAACATCAACAGAAAGAGCTGGAG
NM_006597.5       CTTGATAAGAATCAGACTGCTGAGAAGGAAGAATTTGAACATCAACAGAAAGAGCTGGAG
                  ******************** ***************************************

HsCD00040011      AAAGTTTGCAACCCCATCATCACCAAGCTGTACCAGAGTGCAGGAGGCATGCCAGGAGGA
NM_006597.5       AAAGTTTGCAACCCCATCATCACCAAGCTGTACCAGAGTGCAGGAGGCATGCCAGGAGGA
                  ************************************************************

HsCD00040011      ATGCCTGGGGGATTTCCTGGTGGTGGAGCTCCTCCCTCTGGTGGTGCTTCCTCAGGGCCC
NM_006597.5       ATGCCTGGGGGATTTCCTGGTGGTGGAGCTCCTCCCTCTGGTGGTGCTTCCTCAGGGCCC
                  ************************************************************

HsCD00040011      ACCATTGAAGAGGTTGATTTG
NM_006597.5       ACCATTGAAGAGGTTGATTAA
                  *******************:.

Pathways

NCI : C-MYB transcription factor network
NCI : Regulation of nuclear SMAD2/3 signaling
Panther : Apoptosis signaling pathway
Panther : Parkinson disease
Reactome : AUF1 (hnRNP D0) destabilizes mRNA
Reactome : Attenuation phase
Reactome : Axon guidance
Reactome : CHL1 interactions
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Clathrin derived vesicle budding
Reactome : Developmental Biology
Reactome : GABA synthesis, release, reuptake and degradation
Reactome : Gene Expression
Reactome : Golgi Associated Vesicle Biogenesis
Reactome : HSF1-dependent transactivation
Reactome : L1CAM interactions
Reactome : Lysosome Vesicle Biogenesis
Reactome : Membrane Trafficking
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Neuronal System
Reactome : Neurotransmitter Release Cycle
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of mRNA stability by proteins that bind AU-rich elements
Reactome : Transmission across Chemical Synapses
Reactome : trans-Golgi Network Vesicle Budding
WikiPathway : Diurnally regulated genes with circadian orthologs
WikiPathway : MAPK signaling pathway

Protein

UniProt : P11142
UniProt : B3KTV0
HPRD : 07205

Clone

Cloning Information : 169716
HIP Master Clone ID : 143182
Original Clone ID : FLH169716.01L

Organism


TAX_ID : 9606
Species Specific ID: 3312

Genome

Chromosome : 11
Map Location : 11q24.1
Ensembl : ENSG00000109971

Reagents

Labome : Hsc70-antibody