DNASU Plasmid Repository • 480.965.5697 | Email

ADRBK1 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ADRBK1
Gene Name:  adrenergic, beta, receptor kinase 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH169746.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00040014

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2070nts         Open reading frame : 1 to 2070
Reference Sequence Alignment

ATGGCGGACCTGGAGGCGGTGCTGGCCGACGTGAGCTACCTGATGGCCATGGAGAAGAGC
AAGGCCACGCCGGCCGCGCGCGCCAGCAAGAAGATACTGCTGCCCGAGCCCAGCATCCGC
AGTGTCATGCAGAAGTACCTGGAGGACCGGGGCGAGGTGACCTTTGAGAAGATCTTTTCC
CAGAAGCTGGGGTACCTGCTCTTCCGAGACTTCTGCCTGAACCACCTGGAGGAGGCCAGG
CCCTTGGTGGAATTCTATGAGGAGATCAAGAAGTACGAGAAGCTGGAGACGGAGGAGGAG
CGTGTGGCCCGCAGCCGGGAGATCTTCGACTCATACATCATGAAGGAGCTGCTGGCCTGC
TCGCATCCCTTCTCGAAGAGTGCCACTGAGCATGTCCAAGGCCACCTGGGGAAGAAGCAG
GTGCCTCCGGATCTCTTCCAGCCATACATCGAAGAGATTTGTCAAAACCTCCGAGGGGAC
GTGTTCCAGAAATTCATTGAGAGCGATAAGTTCACACGGTTTTGCCAGTGGAAGAATGTG
GAGCTCAACATCCACCTGACCATGAATGACTTCAGCGTGCATCGCATCATTGGGCGCGGG
GGCTTTGGCGAGGTCTATGGGTGCCGGAAGGCTGACACAGGCAAGATGTACGCCATGAAG
TGCCTGGACAAAAAGCGCATCAAGATGAAGCAGGGGGAGACCCTGGCCCTGAACGAGCGC
ATCATGCTCTCGCTCGTCAGCACTGGGGACTGCCCATTCATTGTCTGCATGTCATACGCG
TTCCACACGCCAGACAAGCTCAGCTTCATCCTGGACCTCATGAACGGTGGGGACCTGCAC
TACCACCTCTCCCAGCACGGGGTCTTCTCAGAGGCTGACATGCGCTTCTATGCGGCCGAG
ATCATCCTGGGCCTGGAGCACATGCACAACCGCTTCGTGGTCTACCGGGACCTGAAGCCA
GCCAACATCCTTCTGGACGAGCATGGCCACGTGCGGATCTCGGACCTGGGCCTGGCCTGT
GACTTCTCCAAGAAGAAGCCCCATGCCAGCGTGGGCACCCACGGGTACATGGCTCCGGAG
GTCCTGCAGAAGGGCGTGGCCTACGACAGCAGTGCCGACTGGTTCTCTCTGGGGTGCATG
CTCTTCAAGTTGCTGCGGGGGCACAGCCCCTTCCGGCAGCACAAGACCAAAGACAAGCAT
GAGATCGACCGCATGACGCTGACGATGGCCGTGGAGCTGCCCGACTCCTTCTCCCCTGAA
CTACGCTCCCTGCTGGAGGGGTTGCTGCAGAGGGATGTCAACCGGAGATTGGGCTGCCTG
GGCCGAGGGGCTCAGGAGGTGAAAGAGAGCCCCTTTTTCCGCTCCCTGGACTGGCAGATG
GTCTTCTTGCAGAAGTACCCTCCCCCGCTGATCCCCCCACGAGGGGAGGTGAACGCGGCC
GACGCCTTCGACATTGGCTCCTTCGATGAGGAGGACACAAAAGGAATCAAGTTACTGGAC
AGTGATCAGGAGCTCTACCGCAACTTCCCCCTCACCATCTCGGAGCGGTGGCAGCAGGAG
GTGGCAGAGACTGTCTTCGACACCATCAACGCTGAGACAGACCGGCTGGAGGCTCGCAAG
AAAGCCAAGAACAAGCAGCTGGGCCATGAGGAAGACTACGCCCTGGGCAAGGACTGCATC
ATGCATGGCTACATGTCCAAGATGGGCAACCCCTTCCTGACCCAGTGGCAGCGGCGGTAC
TTCTACCTGTTCCCCAACCGCCTCGAGTGGCGGGGCGAGGGCGAGGCCCCGCAGAGCCTG
CTGACCATGGAGGAGATCCAGTCGGTGGAGGAGACGCAGATCAAGGAGCGCAAGTGCCTG
CTCCTCAAGATCCGCGGTGGGAAACAGTTCATTTTGCAGTGCGATAGCGACCCTGAGCTG
GTGCAGTGGAAGAAGGAGCTGCGCGACGCCTACCGCGAGGCCCAGCAGCTGGTGCAGCGG
GTGCCCAAGATGAAGAACAAGCCGCGCTCGCCCGTGGTGGAGCTGAGCAAGGTGCCGCTG
GTCCAGCGCGGCAGTGCCAACGGCCTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2315
Start on reference sequence 246
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ADRBK1
Symbol Nomenclature : ADRBK1
SYNONYM : BARK1; BETA-ARK1; GRK2
Designation : G-protein coupled receptor kinase 2|beta-ARK-1|beta-adrenergic receptor kinase 1
Full Nomenclature : adrenergic, beta, receptor kinase 1
GENEID : 156
HGNC : 289
MIM : 109635
Vega : OTTHUMG00000167104
Target GenBank: BC037963

 

Reference Sequence Alignment

  

HsCD00040014      ATGGCGGACCTGGAGGCGGTGCTGGCCGACGTGAGCTACCTGATGGCCATGGAGAAGAGC
NM_001619.3       ATGGCGGACCTGGAGGCGGTGCTGGCCGACGTGAGCTACCTGATGGCCATGGAGAAGAGC
                  ************************************************************

HsCD00040014      AAGGCCACGCCGGCCGCGCGCGCCAGCAAGAAGATACTGCTGCCCGAGCCCAGCATCCGC
NM_001619.3       AAGGCCACGCCGGCCGCGCGCGCCAGCAAGAAGATCCTGCTGCCCGAGCCCAGCATCCGC
                  ***********************************.************************

HsCD00040014      AGTGTCATGCAGAAGTACCTGGAGGACCGGGGCGAGGTGACCTTTGAGAAGATCTTTTCC
NM_001619.3       AGTGTCATGCAGAAGTACCTGGAGGACCGGGGCGAGGTGACCTTTGAGAAGATCTTTTCC
                  ************************************************************

HsCD00040014      CAGAAGCTGGGGTACCTGCTCTTCCGAGACTTCTGCCTGAACCACCTGGAGGAGGCCAGG
NM_001619.3       CAGAAGCTGGGGTACCTGCTCTTCCGAGACTTCTGCCTGAACCACCTGGAGGAGGCCAGG
                  ************************************************************

HsCD00040014      CCCTTGGTGGAATTCTATGAGGAGATCAAGAAGTACGAGAAGCTGGAGACGGAGGAGGAG
NM_001619.3       CCCTTGGTGGAATTCTATGAGGAGATCAAGAAGTACGAGAAGCTGGAGACGGAGGAGGAG
                  ************************************************************

HsCD00040014      CGTGTGGCCCGCAGCCGGGAGATCTTCGACTCATACATCATGAAGGAGCTGCTGGCCTGC
NM_001619.3       CGTGTGGCCCGCAGCCGGGAGATCTTCGACTCATACATCATGAAGGAGCTGCTGGCCTGC
                  ************************************************************

HsCD00040014      TCGCATCCCTTCTCGAAGAGTGCCACTGAGCATGTCCAAGGCCACCTGGGGAAGAAGCAG
NM_001619.3       TCGCATCCCTTCTCGAAGAGTGCCACTGAGCATGTCCAAGGCCACCTGGGGAAGAAGCAG
                  ************************************************************

HsCD00040014      GTGCCTCCGGATCTCTTCCAGCCATACATCGAAGAGATTTGTCAAAACCTCCGAGGGGAC
NM_001619.3       GTGCCTCCGGATCTCTTCCAGCCATACATCGAAGAGATTTGTCAAAACCTCCGAGGGGAC
                  ************************************************************

HsCD00040014      GTGTTCCAGAAATTCATTGAGAGCGATAAGTTCACACGGTTTTGCCAGTGGAAGAATGTG
NM_001619.3       GTGTTCCAGAAATTCATTGAGAGCGATAAGTTCACACGGTTTTGCCAGTGGAAGAATGTG
                  ************************************************************

HsCD00040014      GAGCTCAACATCCACCTGACCATGAATGACTTCAGCGTGCATCGCATCATTGGGCGCGGG
NM_001619.3       GAGCTCAACATCCACCTGACCATGAATGACTTCAGCGTGCATCGCATCATTGGGCGCGGG
                  ************************************************************

HsCD00040014      GGCTTTGGCGAGGTCTATGGGTGCCGGAAGGCTGACACAGGCAAGATGTACGCCATGAAG
NM_001619.3       GGCTTTGGCGAGGTCTATGGGTGCCGGAAGGCTGACACAGGCAAGATGTACGCCATGAAG
                  ************************************************************

HsCD00040014      TGCCTGGACAAAAAGCGCATCAAGATGAAGCAGGGGGAGACCCTGGCCCTGAACGAGCGC
NM_001619.3       TGCCTGGACAAAAAGCGCATCAAGATGAAGCAGGGGGAGACCCTGGCCCTGAACGAGCGC
                  ************************************************************

HsCD00040014      ATCATGCTCTCGCTCGTCAGCACTGGGGACTGCCCATTCATTGTCTGCATGTCATACGCG
NM_001619.3       ATCATGCTCTCGCTCGTCAGCACTGGGGACTGCCCATTCATTGTCTGCATGTCATACGCG
                  ************************************************************

HsCD00040014      TTCCACACGCCAGACAAGCTCAGCTTCATCCTGGACCTCATGAACGGTGGGGACCTGCAC
NM_001619.3       TTCCACACGCCAGACAAGCTCAGCTTCATCCTGGACCTCATGAACGGTGGGGACCTGCAC
                  ************************************************************

HsCD00040014      TACCACCTCTCCCAGCACGGGGTCTTCTCAGAGGCTGACATGCGCTTCTATGCGGCCGAG
NM_001619.3       TACCACCTCTCCCAGCACGGGGTCTTCTCAGAGGCTGACATGCGCTTCTATGCGGCCGAG
                  ************************************************************

HsCD00040014      ATCATCCTGGGCCTGGAGCACATGCACAACCGCTTCGTGGTCTACCGGGACCTGAAGCCA
NM_001619.3       ATCATCCTGGGCCTGGAGCACATGCACAACCGCTTCGTGGTCTACCGGGACCTGAAGCCA
                  ************************************************************

HsCD00040014      GCCAACATCCTTCTGGACGAGCATGGCCACGTGCGGATCTCGGACCTGGGCCTGGCCTGT
NM_001619.3       GCCAACATCCTTCTGGACGAGCATGGCCACGTGCGGATCTCGGACCTGGGCCTGGCCTGT
                  ************************************************************

HsCD00040014      GACTTCTCCAAGAAGAAGCCCCATGCCAGCGTGGGCACCCACGGGTACATGGCTCCGGAG
NM_001619.3       GACTTCTCCAAGAAGAAGCCCCATGCCAGCGTGGGCACCCACGGGTACATGGCTCCGGAG
                  ************************************************************

HsCD00040014      GTCCTGCAGAAGGGCGTGGCCTACGACAGCAGTGCCGACTGGTTCTCTCTGGGGTGCATG
NM_001619.3       GTCCTGCAGAAGGGCGTGGCCTACGACAGCAGTGCCGACTGGTTCTCTCTGGGGTGCATG
                  ************************************************************

HsCD00040014      CTCTTCAAGTTGCTGCGGGGGCACAGCCCCTTCCGGCAGCACAAGACCAAAGACAAGCAT
NM_001619.3       CTCTTCAAGTTGCTGCGGGGGCACAGCCCCTTCCGGCAGCACAAGACCAAAGACAAGCAT
                  ************************************************************

HsCD00040014      GAGATCGACCGCATGACGCTGACGATGGCCGTGGAGCTGCCCGACTCCTTCTCCCCTGAA
NM_001619.3       GAGATCGACCGCATGACGCTGACGATGGCCGTGGAGCTGCCCGACTCCTTCTCCCCTGAA
                  ************************************************************

HsCD00040014      CTACGCTCCCTGCTGGAGGGGTTGCTGCAGAGGGATGTCAACCGGAGATTGGGCTGCCTG
NM_001619.3       CTACGCTCCCTGCTGGAGGGGTTGCTGCAGAGGGATGTCAACCGGAGATTGGGCTGCCTG
                  ************************************************************

HsCD00040014      GGCCGAGGGGCTCAGGAGGTGAAAGAGAGCCCCTTTTTCCGCTCCCTGGACTGGCAGATG
NM_001619.3       GGCCGAGGGGCTCAGGAGGTGAAAGAGAGCCCCTTTTTCCGCTCCCTGGACTGGCAGATG
                  ************************************************************

HsCD00040014      GTCTTCTTGCAGAAGTACCCTCCCCCGCTGATCCCCCCACGAGGGGAGGTGAACGCGGCC
NM_001619.3       GTCTTCTTGCAGAAGTACCCTCCCCCGCTGATCCCCCCACGAGGGGAGGTGAACGCGGCC
                  ************************************************************

HsCD00040014      GACGCCTTCGACATTGGCTCCTTCGATGAGGAGGACACAAAAGGAATCAAGTTACTGGAC
NM_001619.3       GACGCCTTCGACATTGGCTCCTTCGATGAGGAGGACACAAAAGGAATCAAGTTACTGGAC
                  ************************************************************

HsCD00040014      AGTGATCAGGAGCTCTACCGCAACTTCCCCCTCACCATCTCGGAGCGGTGGCAGCAGGAG
NM_001619.3       AGTGATCAGGAGCTCTACCGCAACTTCCCCCTCACCATCTCGGAGCGGTGGCAGCAGGAG
                  ************************************************************

HsCD00040014      GTGGCAGAGACTGTCTTCGACACCATCAACGCTGAGACAGACCGGCTGGAGGCTCGCAAG
NM_001619.3       GTGGCAGAGACTGTCTTCGACACCATCAACGCTGAGACAGACCGGCTGGAGGCTCGCAAG
                  ************************************************************

HsCD00040014      AAAGCCAAGAACAAGCAGCTGGGCCATGAGGAAGACTACGCCCTGGGCAAGGACTGCATC
NM_001619.3       AAAGCCAAGAACAAGCAGCTGGGCCATGAGGAAGACTACGCCCTGGGCAAGGACTGCATC
                  ************************************************************

HsCD00040014      ATGCATGGCTACATGTCCAAGATGGGCAACCCCTTCCTGACCCAGTGGCAGCGGCGGTAC
NM_001619.3       ATGCATGGCTACATGTCCAAGATGGGCAACCCCTTCCTGACCCAGTGGCAGCGGCGGTAC
                  ************************************************************

HsCD00040014      TTCTACCTGTTCCCCAACCGCCTCGAGTGGCGGGGCGAGGGCGAGGCCCCGCAGAGCCTG
NM_001619.3       TTCTACCTGTTCCCCAACCGCCTCGAGTGGCGGGGCGAGGGCGAGGCCCCGCAGAGCCTG
                  ************************************************************

HsCD00040014      CTGACCATGGAGGAGATCCAGTCGGTGGAGGAGACGCAGATCAAGGAGCGCAAGTGCCTG
NM_001619.3       CTGACCATGGAGGAGATCCAGTCGGTGGAGGAGACGCAGATCAAGGAGCGCAAGTGCCTG
                  ************************************************************

HsCD00040014      CTCCTCAAGATCCGCGGTGGGAAACAGTTCATTTTGCAGTGCGATAGCGACCCTGAGCTG
NM_001619.3       CTCCTCAAGATCCGCGGTGGGAAACAGTTCATTTTGCAGTGCGATAGCGACCCTGAGCTG
                  ************************************************************

HsCD00040014      GTGCAGTGGAAGAAGGAGCTGCGCGACGCCTACCGCGAGGCCCAGCAGCTGGTGCAGCGG
NM_001619.3       GTGCAGTGGAAGAAGGAGCTGCGCGACGCCTACCGCGAGGCCCAGCAGCTGGTGCAGCGG
                  ************************************************************

HsCD00040014      GTGCCCAAGATGAAGAACAAGCCGCGCTCGCCCGTGGTGGAGCTGAGCAAGGTGCCGCTG
NM_001619.3       GTGCCCAAGATGAAGAACAAGCCGCGCTCGCCCGTGGTGGAGCTGAGCAAGGTGCCGCTG
                  ************************************************************

HsCD00040014      GTCCAGCGCGGCAGTGCCAACGGCCTCTTG
NM_001619.3       GTCCAGCGCGGCAGTGCCAACGGCCTCTGA
                  **************************** .

Pathways

NCI : CXCR4-mediated signaling events
NCI : IL8- and CXCR1-mediated signaling events
NCI : Signaling events mediated by HDAC Class II
NCI : Signaling events mediated by the Hedgehog family
NCI : Thromboxane A2 receptor signaling
Panther : Angiotensin II-stimulated signaling through G proteins and beta-arrestin
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Panther : Parkinson disease
Reactome : Ca-dependent events
Reactome : CaM pathway
Reactome : Calmodulin induced events
Reactome : DAG and IP3 signaling
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR interacts with phospholipase C-gamma
Reactome : G alpha (q) signalling events
Reactome : G-protein mediated events
Reactome : GPCR downstream signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Immune System
Reactome : Innate Immune System
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Opioid Signalling
Reactome : PLC beta mediated events
Reactome : PLC-gamma1 signalling
Reactome : PLCG1 events in ERBB2 signaling
Reactome : Phospholipase C-mediated cascade
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by PDGF
Reactome : Signalling by NGF
WikiPathway : Hedgehog Signaling Pathway

Clone

Cloning Information : 169746
HIP Master Clone ID : 143212
Original Clone ID : FLH169746.01L

Organism


TAX_ID : 9606
Species Specific ID: 156

Genome

Chromosome : 11
Map Location : 11q13.1
Ensembl : ENSG00000173020

Reagents

Labome : GRK2-antibody