DNASU Plasmid Repository • 480.965.5697 | Email

STK6 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  AURKA
Gene Name:  aurora kinase A
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH014557.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00004003

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1212nts         Open reading frame : 1 to 1212
Reference Sequence Alignment

ATGGACCGATCTAAAGAAAACTGCATTTCAGGACCTGTTAAGGCTACAGCTCCAGTTGGA
GGTCCAAAACGTGTTCTCGTGACTCAGCAATTTCCTTGTCAGAATCCATTACCTGTAAAT
AGTGGCCAGGCTCAGCGGGTCTTGTGTCCTTCAAATTCTTCCCAGCGCGTTCCTTTGCAA
GCACAAAAGCTTGTCTCCAGTCACAAGCCGGTTCAGAATCAGAAGCAGAAGCAATTGCAG
GCAACCAGTGTACCTCATCCTGTCTCCAGGCCACTGAATAACACCCAAAAGAGCAAGCAG
CCCCTGCCATCGGCACCTGAAAATAATCCTGAGGAGGAACTGGCATCAAAACAGAAAAAT
GAAGAATCAAAAAAGAGGCAGTGGGCTTTGGAAGACTTTGAAATTGGTCGCCCTCTGGGT
AAAGGAAAGTTTGGTAATGTTTATTTGGCAAGAGAAAAGCAAAGCAAGTTTATTCTGGCT
CTTAAAGTGTTATTTAAAGCTCAGCTGGAGAAAGCCGGAGTGGAGCATCAGCTCAGAAGA
GAAGTAGAAATACAGTCCCACCTTCGGCATCCTAATATTCTTAGACTGTATGGTTATTTC
CATGATGCTACCAGAGTCTACCTAATTCTGGAATATGCACCACTTGGAACAGTTTATAGA
GAACTTCAGAAACTTTCAAAGTTTGATGAGCAGAGAACTGCTACTTATATAACAGAATTG
GCAAATGCCCTGTCTTACTGTCATTCGAAGAGAGTTATTCATAGAGACATTAAGCCAGAG
AACTTACTTCTTGGATCAGCTGGAGAGCTTAAAATTGCAGATTTTGGGTGGTCAGTACAT
GCTCCATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAAATG
ATTGAAGGTCGGATGCATGATGAGAAGGTGGATCTCTGGAGCCTTGGAGTTCTTTGCTAT
GAATTTTTAGTTGGGAAGCCTCCTTTTGAGGCAAACACATACCAAGAGACCTACAAAAGA
ATATCACGGGTTGAATTCACATTCCCTGACTTTGTAACAGAGGGAGCCAGGGACCTCATT
TCAAGACTGTTGAAGCATAATCCCAGCCAGAGGCCAATGCTCAGAGAAGTACTTGAACAC
CCCTGGATCACAGCAAATTCATCAAAACCATCAAATTGCCAAAACAAAGAATCAGCTAGC
AAACAGTCTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1237
Start on reference sequence 26
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : AURKA
Symbol Nomenclature : AURKA
SYNONYM : AIK; ARK1; AURA; AURORA2; BTAK; PPP1R47; STK15; STK6; STK7
Designation : ARK-1|Aurora-A kinase|IPL1-related kinase|aurora 2|aurora-related kinase 1|aurora/IPL1-like kinase|aurora/IPL1-related kinase 1|breast tumor-amplified kinase|breast-tumor-amplified kinase|hARK1|protein phosphatase 1, regulatory subunit 47|serine/threonine kinase 6|serine/threonine protein kinase 15|serine/threonine-protein kinase 15|serine/threonine-protein kinase 6|serine/threonine-protein kinase aurora-A
Full Nomenclature : aurora kinase A
GENEID : 6790
Locus Tag : RP5-1167H4.6
GI : 60653264
GenBank Accession : AY892410
HGNC : 11393
MIM : 603072
Vega : OTTHUMG00000032796
Target GenBank: BC006423

 

Reference Sequence Alignment

  

HsCD00004003        ATGGACCGATCTAAAGAAAACTGCATTTCAGGACCTGTTAAGGCTACAGCTCCAGTTGGA
NM_198436.1         ATGGACCGATCTAAAGAAAACTGCATTTCAGGACCTGTTAAGGCTACAGCTCCAGTTGGA
XM_005260534.1      ATGGACCGATCTAAAGAAAACTGCATTTCAGGACCTGTTAAGGCTACAGCTCCAGTTGGA
NM_198437.1         ATGGACCGATCTAAAGAAAACTGCATTTCAGGACCTGTTAAGGCTACAGCTCCAGTTGGA
NM_003600.2         ATGGACCGATCTAAAGAAAACTGCATTTCAGGACCTGTTAAGGCTACAGCTCCAGTTGGA
NM_198434.1         ATGGACCGATCTAAAGAAAACTGCATTTCAGGACCTGTTAAGGCTACAGCTCCAGTTGGA
NM_198433.1         ATGGACCGATCTAAAGAAAACTGCATTTCAGGACCTGTTAAGGCTACAGCTCCAGTTGGA
NM_198435.1         ATGGACCGATCTAAAGAAAACTGCATTTCAGGACCTGTTAAGGCTACAGCTCCAGTTGGA
                    ************************************************************

HsCD00004003        GGTCCAAAACGTGTTCTCGTGACTCAGCAATTTCCTTGTCAGAATCCATTACCTGTAAAT
NM_198436.1         GGTCCAAAACGTGTTCTCGTGACTCAGCAATTTCCTTGTCAGAATCCATTACCTGTAAAT
XM_005260534.1      GGTCCAAAACGTGTTCTCGTGACTCAGCAATTTCCTTGTCAGAATCCATTACCTGTAAAT
NM_198437.1         GGTCCAAAACGTGTTCTCGTGACTCAGCAATTTCCTTGTCAGAATCCATTACCTGTAAAT
NM_003600.2         GGTCCAAAACGTGTTCTCGTGACTCAGCAATTTCCTTGTCAGAATCCATTACCTGTAAAT
NM_198434.1         GGTCCAAAACGTGTTCTCGTGACTCAGCAATTTCCTTGTCAGAATCCATTACCTGTAAAT
NM_198433.1         GGTCCAAAACGTGTTCTCGTGACTCAGCAATTTCCTTGTCAGAATCCATTACCTGTAAAT
NM_198435.1         GGTCCAAAACGTGTTCTCGTGACTCAGCAATTTCCTTGTCAGAATCCATTACCTGTAAAT
                    ************************************************************

HsCD00004003        AGTGGCCAGGCTCAGCGGGTCTTGTGTCCTTCAAATTCTTCCCAGCGCGTTCCTTTGCAA
NM_198436.1         AGTGGCCAGGCTCAGCGGGTCTTGTGTCCTTCAAATTCTTCCCAGCGCATTCCTTTGCAA
XM_005260534.1      AGTGGCCAGGCTCAGCGGGTCTTGTGTCCTTCAAATTCTTCCCAGCGCATTCCTTTGCAA
NM_198437.1         AGTGGCCAGGCTCAGCGGGTCTTGTGTCCTTCAAATTCTTCCCAGCGCATTCCTTTGCAA
NM_003600.2         AGTGGCCAGGCTCAGCGGGTCTTGTGTCCTTCAAATTCTTCCCAGCGCATTCCTTTGCAA
NM_198434.1         AGTGGCCAGGCTCAGCGGGTCTTGTGTCCTTCAAATTCTTCCCAGCGCATTCCTTTGCAA
NM_198433.1         AGTGGCCAGGCTCAGCGGGTCTTGTGTCCTTCAAATTCTTCCCAGCGCATTCCTTTGCAA
NM_198435.1         AGTGGCCAGGCTCAGCGGGTCTTGTGTCCTTCAAATTCTTCCCAGCGCATTCCTTTGCAA
                    ************************************************.***********

HsCD00004003        GCACAAAAGCTTGTCTCCAGTCACAAGCCGGTTCAGAATCAGAAGCAGAAGCAATTGCAG
NM_198436.1         GCACAAAAGCTTGTCTCCAGTCACAAGCCGGTTCAGAATCAGAAGCAGAAGCAATTGCAG
XM_005260534.1      GCACAAAAGCTTGTCTCCAGTCACAAGCCGGTTCAGAATCAGAAGCAGAAGCAATTGCAG
NM_198437.1         GCACAAAAGCTTGTCTCCAGTCACAAGCCGGTTCAGAATCAGAAGCAGAAGCAATTGCAG
NM_003600.2         GCACAAAAGCTTGTCTCCAGTCACAAGCCGGTTCAGAATCAGAAGCAGAAGCAATTGCAG
NM_198434.1         GCACAAAAGCTTGTCTCCAGTCACAAGCCGGTTCAGAATCAGAAGCAGAAGCAATTGCAG
NM_198433.1         GCACAAAAGCTTGTCTCCAGTCACAAGCCGGTTCAGAATCAGAAGCAGAAGCAATTGCAG
NM_198435.1         GCACAAAAGCTTGTCTCCAGTCACAAGCCGGTTCAGAATCAGAAGCAGAAGCAATTGCAG
                    ************************************************************

HsCD00004003        GCAACCAGTGTACCTCATCCTGTCTCCAGGCCACTGAATAACACCCAAAAGAGCAAGCAG
NM_198436.1         GCAACCAGTGTACCTCATCCTGTCTCCAGGCCACTGAATAACACCCAAAAGAGCAAGCAG
XM_005260534.1      GCAACCAGTGTACCTCATCCTGTCTCCAGGCCACTGAATAACACCCAAAAGAGCAAGCAG
NM_198437.1         GCAACCAGTGTACCTCATCCTGTCTCCAGGCCACTGAATAACACCCAAAAGAGCAAGCAG
NM_003600.2         GCAACCAGTGTACCTCATCCTGTCTCCAGGCCACTGAATAACACCCAAAAGAGCAAGCAG
NM_198434.1         GCAACCAGTGTACCTCATCCTGTCTCCAGGCCACTGAATAACACCCAAAAGAGCAAGCAG
NM_198433.1         GCAACCAGTGTACCTCATCCTGTCTCCAGGCCACTGAATAACACCCAAAAGAGCAAGCAG
NM_198435.1         GCAACCAGTGTACCTCATCCTGTCTCCAGGCCACTGAATAACACCCAAAAGAGCAAGCAG
                    ************************************************************

HsCD00004003        CCCCTGCCATCGGCACCTGAAAATAATCCTGAGGAGGAACTGGCATCAAAACAGAAAAAT
NM_198436.1         CCCCTGCCATCGGCACCTGAAAATAATCCTGAGGAGGAACTGGCATCAAAACAGAAAAAT
XM_005260534.1      CCCCTGCCATCGGCACCTGAAAATAATCCTGAGGAGGAACTGGCATCAAAACAGAAAAAT
NM_198437.1         CCCCTGCCATCGGCACCTGAAAATAATCCTGAGGAGGAACTGGCATCAAAACAGAAAAAT
NM_003600.2         CCCCTGCCATCGGCACCTGAAAATAATCCTGAGGAGGAACTGGCATCAAAACAGAAAAAT
NM_198434.1         CCCCTGCCATCGGCACCTGAAAATAATCCTGAGGAGGAACTGGCATCAAAACAGAAAAAT
NM_198433.1         CCCCTGCCATCGGCACCTGAAAATAATCCTGAGGAGGAACTGGCATCAAAACAGAAAAAT
NM_198435.1         CCCCTGCCATCGGCACCTGAAAATAATCCTGAGGAGGAACTGGCATCAAAACAGAAAAAT
                    ************************************************************

HsCD00004003        GAAGAATCAAAAAAGAGGCAGTGGGCTTTGGAAGACTTTGAAATTGGTCGCCCTCTGGGT
NM_198436.1         GAAGAATCAAAAAAGAGGCAGTGGGCTTTGGAAGACTTTGAAATTGGTCGCCCTCTGGGT
XM_005260534.1      GAAGAATCAAAAAAGAGGCAGTGGGCTTTGGAAGACTTTGAAATTGGTCGCCCTCTGGGT
NM_198437.1         GAAGAATCAAAAAAGAGGCAGTGGGCTTTGGAAGACTTTGAAATTGGTCGCCCTCTGGGT
NM_003600.2         GAAGAATCAAAAAAGAGGCAGTGGGCTTTGGAAGACTTTGAAATTGGTCGCCCTCTGGGT
NM_198434.1         GAAGAATCAAAAAAGAGGCAGTGGGCTTTGGAAGACTTTGAAATTGGTCGCCCTCTGGGT
NM_198433.1         GAAGAATCAAAAAAGAGGCAGTGGGCTTTGGAAGACTTTGAAATTGGTCGCCCTCTGGGT
NM_198435.1         GAAGAATCAAAAAAGAGGCAGTGGGCTTTGGAAGACTTTGAAATTGGTCGCCCTCTGGGT
                    ************************************************************

HsCD00004003        AAAGGAAAGTTTGGTAATGTTTATTTGGCAAGAGAAAAGCAAAGCAAGTTTATTCTGGCT
NM_198436.1         AAAGGAAAGTTTGGTAATGTTTATTTGGCAAGAGAAAAGCAAAGCAAGTTTATTCTGGCT
XM_005260534.1      AAAGGAAAGTTTGGTAATGTTTATTTGGCAAGAGAAAAGCAAAGCAAGTTTATTCTGGCT
NM_198437.1         AAAGGAAAGTTTGGTAATGTTTATTTGGCAAGAGAAAAGCAAAGCAAGTTTATTCTGGCT
NM_003600.2         AAAGGAAAGTTTGGTAATGTTTATTTGGCAAGAGAAAAGCAAAGCAAGTTTATTCTGGCT
NM_198434.1         AAAGGAAAGTTTGGTAATGTTTATTTGGCAAGAGAAAAGCAAAGCAAGTTTATTCTGGCT
NM_198433.1         AAAGGAAAGTTTGGTAATGTTTATTTGGCAAGAGAAAAGCAAAGCAAGTTTATTCTGGCT
NM_198435.1         AAAGGAAAGTTTGGTAATGTTTATTTGGCAAGAGAAAAGCAAAGCAAGTTTATTCTGGCT
                    ************************************************************

HsCD00004003        CTTAAAGTGTTATTTAAAGCTCAGCTGGAGAAAGCCGGAGTGGAGCATCAGCTCAGAAGA
NM_198436.1         CTTAAAGTGTTATTTAAAGCTCAGCTGGAGAAAGCCGGAGTGGAGCATCAGCTCAGAAGA
XM_005260534.1      CTTAAAGTGTTATTTAAAGCTCAGCTGGAGAAAGCCGGAGTGGAGCATCAGCTCAGAAGA
NM_198437.1         CTTAAAGTGTTATTTAAAGCTCAGCTGGAGAAAGCCGGAGTGGAGCATCAGCTCAGAAGA
NM_003600.2         CTTAAAGTGTTATTTAAAGCTCAGCTGGAGAAAGCCGGAGTGGAGCATCAGCTCAGAAGA
NM_198434.1         CTTAAAGTGTTATTTAAAGCTCAGCTGGAGAAAGCCGGAGTGGAGCATCAGCTCAGAAGA
NM_198433.1         CTTAAAGTGTTATTTAAAGCTCAGCTGGAGAAAGCCGGAGTGGAGCATCAGCTCAGAAGA
NM_198435.1         CTTAAAGTGTTATTTAAAGCTCAGCTGGAGAAAGCCGGAGTGGAGCATCAGCTCAGAAGA
                    ************************************************************

HsCD00004003        GAAGTAGAAATACAGTCCCACCTTCGGCATCCTAATATTCTTAGACTGTATGGTTATTTC
NM_198436.1         GAAGTAGAAATACAGTCCCACCTTCGGCATCCTAATATTCTTAGACTGTATGGTTATTTC
XM_005260534.1      GAAGTAGAAATACAGTCCCACCTTCGGCATCCTAATATTCTTAGACTGTATGGTTATTTC
NM_198437.1         GAAGTAGAAATACAGTCCCACCTTCGGCATCCTAATATTCTTAGACTGTATGGTTATTTC
NM_003600.2         GAAGTAGAAATACAGTCCCACCTTCGGCATCCTAATATTCTTAGACTGTATGGTTATTTC
NM_198434.1         GAAGTAGAAATACAGTCCCACCTTCGGCATCCTAATATTCTTAGACTGTATGGTTATTTC
NM_198433.1         GAAGTAGAAATACAGTCCCACCTTCGGCATCCTAATATTCTTAGACTGTATGGTTATTTC
NM_198435.1         GAAGTAGAAATACAGTCCCACCTTCGGCATCCTAATATTCTTAGACTGTATGGTTATTTC
                    ************************************************************

HsCD00004003        CATGATGCTACCAGAGTCTACCTAATTCTGGAATATGCACCACTTGGAACAGTTTATAGA
NM_198436.1         CATGATGCTACCAGAGTCTACCTAATTCTGGAATATGCACCACTTGGAACAGTTTATAGA
XM_005260534.1      CATGATGCTACCAGAGTCTACCTAATTCTGGAATATGCACCACTTGGAACAGTTTATAGA
NM_198437.1         CATGATGCTACCAGAGTCTACCTAATTCTGGAATATGCACCACTTGGAACAGTTTATAGA
NM_003600.2         CATGATGCTACCAGAGTCTACCTAATTCTGGAATATGCACCACTTGGAACAGTTTATAGA
NM_198434.1         CATGATGCTACCAGAGTCTACCTAATTCTGGAATATGCACCACTTGGAACAGTTTATAGA
NM_198433.1         CATGATGCTACCAGAGTCTACCTAATTCTGGAATATGCACCACTTGGAACAGTTTATAGA
NM_198435.1         CATGATGCTACCAGAGTCTACCTAATTCTGGAATATGCACCACTTGGAACAGTTTATAGA
                    ************************************************************

HsCD00004003        GAACTTCAGAAACTTTCAAAGTTTGATGAGCAGAGAACTGCTACTTATATAACAGAATTG
NM_198436.1         GAACTTCAGAAACTTTCAAAGTTTGATGAGCAGAGAACTGCTACTTATATAACAGAATTG
XM_005260534.1      GAACTTCAGAAACTTTCAAAGTTTGATGAGCAGAGAACTGCTACTTATATAACAGAATTG
NM_198437.1         GAACTTCAGAAACTTTCAAAGTTTGATGAGCAGAGAACTGCTACTTATATAACAGAATTG
NM_003600.2         GAACTTCAGAAACTTTCAAAGTTTGATGAGCAGAGAACTGCTACTTATATAACAGAATTG
NM_198434.1         GAACTTCAGAAACTTTCAAAGTTTGATGAGCAGAGAACTGCTACTTATATAACAGAATTG
NM_198433.1         GAACTTCAGAAACTTTCAAAGTTTGATGAGCAGAGAACTGCTACTTATATAACAGAATTG
NM_198435.1         GAACTTCAGAAACTTTCAAAGTTTGATGAGCAGAGAACTGCTACTTATATAACAGAATTG
                    ************************************************************

HsCD00004003        GCAAATGCCCTGTCTTACTGTCATTCGAAGAGAGTTATTCATAGAGACATTAAGCCAGAG
NM_198436.1         GCAAATGCCCTGTCTTACTGTCATTCGAAGAGAGTTATTCATAGAGACATTAAGCCAGAG
XM_005260534.1      GCAAATGCCCTGTCTTACTGTCATTCGAAGAGAGTTATTCATAGAGACATTAAGCCAGAG
NM_198437.1         GCAAATGCCCTGTCTTACTGTCATTCGAAGAGAGTTATTCATAGAGACATTAAGCCAGAG
NM_003600.2         GCAAATGCCCTGTCTTACTGTCATTCGAAGAGAGTTATTCATAGAGACATTAAGCCAGAG
NM_198434.1         GCAAATGCCCTGTCTTACTGTCATTCGAAGAGAGTTATTCATAGAGACATTAAGCCAGAG
NM_198433.1         GCAAATGCCCTGTCTTACTGTCATTCGAAGAGAGTTATTCATAGAGACATTAAGCCAGAG
NM_198435.1         GCAAATGCCCTGTCTTACTGTCATTCGAAGAGAGTTATTCATAGAGACATTAAGCCAGAG
                    ************************************************************

HsCD00004003        AACTTACTTCTTGGATCAGCTGGAGAGCTTAAAATTGCAGATTTTGGGTGGTCAGTACAT
NM_198436.1         AACTTACTTCTTGGATCAGCTGGAGAGCTTAAAATTGCAGATTTTGGGTGGTCAGTACAT
XM_005260534.1      AACTTACTTCTTGGATCAGCTGGAGAGCTTAAAATTGCAGATTTTGGGTGGTCAGTACAT
NM_198437.1         AACTTACTTCTTGGATCAGCTGGAGAGCTTAAAATTGCAGATTTTGGGTGGTCAGTACAT
NM_003600.2         AACTTACTTCTTGGATCAGCTGGAGAGCTTAAAATTGCAGATTTTGGGTGGTCAGTACAT
NM_198434.1         AACTTACTTCTTGGATCAGCTGGAGAGCTTAAAATTGCAGATTTTGGGTGGTCAGTACAT
NM_198433.1         AACTTACTTCTTGGATCAGCTGGAGAGCTTAAAATTGCAGATTTTGGGTGGTCAGTACAT
NM_198435.1         AACTTACTTCTTGGATCAGCTGGAGAGCTTAAAATTGCAGATTTTGGGTGGTCAGTACAT
                    ************************************************************

HsCD00004003        GCTCCATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAAATG
NM_198436.1         GCTCCATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAAATG
XM_005260534.1      GCTCCATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAAATG
NM_198437.1         GCTCCATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAAATG
NM_003600.2         GCTCCATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAAATG
NM_198434.1         GCTCCATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAAATG
NM_198433.1         GCTCCATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAAATG
NM_198435.1         GCTCCATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAAATG
                    ************************************************************

HsCD00004003        ATTGAAGGTCGGATGCATGATGAGAAGGTGGATCTCTGGAGCCTTGGAGTTCTTTGCTAT
NM_198436.1         ATTGAAGGTCGGATGCATGATGAGAAGGTGGATCTCTGGAGCCTTGGAGTTCTTTGCTAT
XM_005260534.1      ATTGAAGGTCGGATGCATGATGAGAAGGTGGATCTCTGGAGCCTTGGAGTTCTTTGCTAT
NM_198437.1         ATTGAAGGTCGGATGCATGATGAGAAGGTGGATCTCTGGAGCCTTGGAGTTCTTTGCTAT
NM_003600.2         ATTGAAGGTCGGATGCATGATGAGAAGGTGGATCTCTGGAGCCTTGGAGTTCTTTGCTAT
NM_198434.1         ATTGAAGGTCGGATGCATGATGAGAAGGTGGATCTCTGGAGCCTTGGAGTTCTTTGCTAT
NM_198433.1         ATTGAAGGTCGGATGCATGATGAGAAGGTGGATCTCTGGAGCCTTGGAGTTCTTTGCTAT
NM_198435.1         ATTGAAGGTCGGATGCATGATGAGAAGGTGGATCTCTGGAGCCTTGGAGTTCTTTGCTAT
                    ************************************************************

HsCD00004003        GAATTTTTAGTTGGGAAGCCTCCTTTTGAGGCAAACACATACCAAGAGACCTACAAAAGA
NM_198436.1         GAATTTTTAGTTGGGAAGCCTCCTTTTGAGGCAAACACATACCAAGAGACCTACAAAAGA
XM_005260534.1      GAATTTTTAGTTGGGAAGCCTCCTTTTGAGGCAAACACATACCAAGAGACCTACAAAAGA
NM_198437.1         GAATTTTTAGTTGGGAAGCCTCCTTTTGAGGCAAACACATACCAAGAGACCTACAAAAGA
NM_003600.2         GAATTTTTAGTTGGGAAGCCTCCTTTTGAGGCAAACACATACCAAGAGACCTACAAAAGA
NM_198434.1         GAATTTTTAGTTGGGAAGCCTCCTTTTGAGGCAAACACATACCAAGAGACCTACAAAAGA
NM_198433.1         GAATTTTTAGTTGGGAAGCCTCCTTTTGAGGCAAACACATACCAAGAGACCTACAAAAGA
NM_198435.1         GAATTTTTAGTTGGGAAGCCTCCTTTTGAGGCAAACACATACCAAGAGACCTACAAAAGA
                    ************************************************************

HsCD00004003        ATATCACGGGTTGAATTCACATTCCCTGACTTTGTAACAGAGGGAGCCAGGGACCTCATT
NM_198436.1         ATATCACGGGTTGAATTCACATTCCCTGACTTTGTAACAGAGGGAGCCAGGGACCTCATT
XM_005260534.1      ATATCACGGGTTGAATTCACATTCCCTGACTTTGTAACAGAGGGAGCCAGGGACCTCATT
NM_198437.1         ATATCACGGGTTGAATTCACATTCCCTGACTTTGTAACAGAGGGAGCCAGGGACCTCATT
NM_003600.2         ATATCACGGGTTGAATTCACATTCCCTGACTTTGTAACAGAGGGAGCCAGGGACCTCATT
NM_198434.1         ATATCACGGGTTGAATTCACATTCCCTGACTTTGTAACAGAGGGAGCCAGGGACCTCATT
NM_198433.1         ATATCACGGGTTGAATTCACATTCCCTGACTTTGTAACAGAGGGAGCCAGGGACCTCATT
NM_198435.1         ATATCACGGGTTGAATTCACATTCCCTGACTTTGTAACAGAGGGAGCCAGGGACCTCATT
                    ************************************************************

HsCD00004003        TCAAGACTGTTGAAGCATAATCCCAGCCAGAGGCCAATGCTCAGAGAAGTACTTGAACAC
NM_198436.1         TCAAGACTGTTGAAGCATAATCCCAGCCAGAGGCCAATGCTCAGAGAAGTACTTGAACAC
XM_005260534.1      TCAAGACTGTTGAAGCATAATCCCAGCCAGAGGCCAATGCTCAGAGAAGTACTTGAACAC
NM_198437.1         TCAAGACTGTTGAAGCATAATCCCAGCCAGAGGCCAATGCTCAGAGAAGTACTTGAACAC
NM_003600.2         TCAAGACTGTTGAAGCATAATCCCAGCCAGAGGCCAATGCTCAGAGAAGTACTTGAACAC
NM_198434.1         TCAAGACTGTTGAAGCATAATCCCAGCCAGAGGCCAATGCTCAGAGAAGTACTTGAACAC
NM_198433.1         TCAAGACTGTTGAAGCATAATCCCAGCCAGAGGCCAATGCTCAGAGAAGTACTTGAACAC
NM_198435.1         TCAAGACTGTTGAAGCATAATCCCAGCCAGAGGCCAATGCTCAGAGAAGTACTTGAACAC
                    ************************************************************

HsCD00004003        CCCTGGATCACAGCAAATTCATCAAAACCATCAAATTGCCAAAACAAAGAATCAGCTAGC
NM_198436.1         CCCTGGATCACAGCAAATTCATCAAAACCATCAAATTGCCAAAACAAAGAATCAGCTAGC
XM_005260534.1      CCCTGGATCACAGCAAATTCATCAAAACCATCAAATTGCCAAAACAAAGAATCAGCTAGC
NM_198437.1         CCCTGGATCACAGCAAATTCATCAAAACCATCAAATTGCCAAAACAAAGAATCAGCTAGC
NM_003600.2         CCCTGGATCACAGCAAATTCATCAAAACCATCAAATTGCCAAAACAAAGAATCAGCTAGC
NM_198434.1         CCCTGGATCACAGCAAATTCATCAAAACCATCAAATTGCCAAAACAAAGAATCAGCTAGC
NM_198433.1         CCCTGGATCACAGCAAATTCATCAAAACCATCAAATTGCCAAAACAAAGAATCAGCTAGC
NM_198435.1         CCCTGGATCACAGCAAATTCATCAAAACCATCAAATTGCCAAAACAAAGAATCAGCTAGC
                    ************************************************************

HsCD00004003        AAACAGTCTTTG
NM_198436.1         AAACAGTCTTAG
XM_005260534.1      AAACAGTCTTAG
NM_198437.1         AAACAGTCTTAG
NM_003600.2         AAACAGTCTTAG
NM_198434.1         AAACAGTCTTAG
NM_198433.1         AAACAGTCTTAG
NM_198435.1         AAACAGTCTTAG
                    **********:*

Pathways

NCI : Aurora A signaling
NCI : Aurora B signaling
NCI : Integrin-linked kinase signaling
NCI : PLK1 signaling events
NCI : Signaling by Aurora kinases
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdh1 mediated degradation of Cdc20 and other APC/C:Cdh1 targeted proteins in late mitosis/early G1
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : G2/M Transition
Reactome : Mitotic G2-G2/M phases
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Regulation of mitotic cell cycle
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Integrated Breast Cancer Pathway

Clone

Cloning Information : 14557
HIP Master Clone ID : 28756
Original Clone ID : FLH014557.01L

Organism


TAX_ID : 9606
Species Specific ID: 6790

Genome

Chromosome : 20
Map Location : 20q13
Ensembl : ENSG00000087586

Reagents

Labome : AURKA-antibody