DNASU Plasmid Repository • 480.965.5697 | Email

CDK9 (Homo sapiens) in pDONR221 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CDK9
Gene Name:  cyclin-dependent kinase 9
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH263695.01L
Keyword: STOP codon removed based on OC annotation
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00040051

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1116nts        
Open reading frame : 1 to 1116
Reference Sequence Alignment

ATGGCAAAGCAGTACGACTCGGTGGAGTGCCCTTTTTGTGATGAAGTTTCCAAATACGAG
AAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAG
ACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCC
ATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAAC
TTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATAC
CTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAG
TTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATC
CACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGAT
GGGGTCCTGAAGCTGGCAGACTTTGGGCTGGCCCGGGCCTTCAGCCTGGCCAAGAACAGC
CAGCCCAACCGCTACACCAACCGTGTGGTGACACTCTGGTACCGGCCCCCGGAGCTGTTG
CTCGGGGAGCGGGACTACGGCCCCCCCATTGACCTGTGGGGTGCTGGGTGCATCATGGCA
GAGATGTGGACCCGCAGCCCCATCATGCAGGGCAACACGGAGCAGCACCAACTCGCCCTC
ATCAGTCAGCTCTGCGGCTCCATCACCCCTGAGGTGTGGCCAAACGTGGACAACTATGAG
CTGTACGAAAAGCTGGAGCTGGTCAAGGGCCAGAAGCGGAAGGTGAAGGACAGGCTGAAG
GCCTATGTGCGTGACCCATACGCACTGGACCTCATCGACAAGCTGCTGGTGCTGGACCCT
GCCCAGCGCATCGACAGCGATGACGCCCTCAACCACGACTTCTTCTGGTCCGACCCCATG
CCCTCCGACCTCAAGGGCATGCTCTCCACCCACCTGACGTCCATGTTCGAGTACTTGGCA
CCACCGCGCCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGTCGCAATCCC
GCCACCACCAACCAGACGGAGTTTGAGCGCGTCTTC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1217
Start on reference sequence 99
Mutations:
None
Discrepancy:
a6g
                                

5' Linker Sequence:
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR221

pDONR221 in advanced viewed

Synonyms: ''
Sequencing Primer: Forward:  U19
Reverse:  AttP2
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site U19 primer 517 535
primer site Att P2 Primer 3026 3043
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CDK9
Symbol Nomenclature : CDK9
SYNONYM : C-2k; CDC2L4; CTK1; PITALRE; TAK
Designation : CDC2-related kinase|cell division cycle 2-like protein kinase 4|cell division protein kinase 9|serine/threonine protein kinase PITALRE|serine/threonine-protein kinase PITALRE|tat-associated kinase complex catalytic subunit
Full Nomenclature : cyclin-dependent kinase 9
GENEID : 1025
Locus Tag : RP11-228B15.5
HGNC : 1780
MIM : 603251
Vega : OTTHUMG00000020715
Target GenBank: NM_001261

 

Reference Sequence Alignment

  

HsCD00040051      ATGGCGAAGCAGTACGACTCGGTGGAGTGCCCTTTTTGTGATGAAGTTTCCAAATACGAG
NM_001261.3       ATGGCAAAGCAGTACGACTCGGTGGAGTGCCCTTTTTGTGATGAAGTTTCCAAATACGAG
                  *****.******************************************************

HsCD00040051      AAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAG
NM_001261.3       AAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAG
                  ************************************************************

HsCD00040051      ACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCC
NM_001261.3       ACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCC
                  ************************************************************

HsCD00040051      ATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAAC
NM_001261.3       ATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAAC
                  ************************************************************

HsCD00040051      TTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATAC
NM_001261.3       TTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATAC
                  ************************************************************

HsCD00040051      CTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAG
NM_001261.3       CTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAG
                  ************************************************************

HsCD00040051      TTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATC
NM_001261.3       TTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATC
                  ************************************************************

HsCD00040051      CACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGAT
NM_001261.3       CACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGAT
                  ************************************************************

HsCD00040051      GGGGTCCTGAAGCTGGCAGACTTTGGGCTGGCCCGGGCCTTCAGCCTGGCCAAGAACAGC
NM_001261.3       GGGGTCCTGAAGCTGGCAGACTTTGGGCTGGCCCGGGCCTTCAGCCTGGCCAAGAACAGC
                  ************************************************************

HsCD00040051      CAGCCCAACCGCTACACCAACCGTGTGGTGACACTCTGGTACCGGCCCCCGGAGCTGTTG
NM_001261.3       CAGCCCAACCGCTACACCAACCGTGTGGTGACACTCTGGTACCGGCCCCCGGAGCTGTTG
                  ************************************************************

HsCD00040051      CTCGGGGAGCGGGACTACGGCCCCCCCATTGACCTGTGGGGTGCTGGGTGCATCATGGCA
NM_001261.3       CTCGGGGAGCGGGACTACGGCCCCCCCATTGACCTGTGGGGTGCTGGGTGCATCATGGCA
                  ************************************************************

HsCD00040051      GAGATGTGGACCCGCAGCCCCATCATGCAGGGCAACACGGAGCAGCACCAACTCGCCCTC
NM_001261.3       GAGATGTGGACCCGCAGCCCCATCATGCAGGGCAACACGGAGCAGCACCAACTCGCCCTC
                  ************************************************************

HsCD00040051      ATCAGTCAGCTCTGCGGCTCCATCACCCCTGAGGTGTGGCCAAACGTGGACAACTATGAG
NM_001261.3       ATCAGTCAGCTCTGCGGCTCCATCACCCCTGAGGTGTGGCCAAACGTGGACAACTATGAG
                  ************************************************************

HsCD00040051      CTGTACGAAAAGCTGGAGCTGGTCAAGGGCCAGAAGCGGAAGGTGAAGGACAGGCTGAAG
NM_001261.3       CTGTACGAAAAGCTGGAGCTGGTCAAGGGCCAGAAGCGGAAGGTGAAGGACAGGCTGAAG
                  ************************************************************

HsCD00040051      GCCTATGTGCGTGACCCATACGCACTGGACCTCATCGACAAGCTGCTGGTGCTGGACCCT
NM_001261.3       GCCTATGTGCGTGACCCATACGCACTGGACCTCATCGACAAGCTGCTGGTGCTGGACCCT
                  ************************************************************

HsCD00040051      GCCCAGCGCATCGACAGCGATGACGCCCTCAACCACGACTTCTTCTGGTCCGACCCCATG
NM_001261.3       GCCCAGCGCATCGACAGCGATGACGCCCTCAACCACGACTTCTTCTGGTCCGACCCCATG
                  ************************************************************

HsCD00040051      CCCTCCGACCTCAAGGGCATGCTCTCCACCCACCTGACGTCCATGTTCGAGTACTTGGCA
NM_001261.3       CCCTCCGACCTCAAGGGCATGCTCTCCACCCACCTGACGTCCATGTTCGAGTACTTGGCA
                  ************************************************************

HsCD00040051      CCACCGCGCCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGTCGCAATCCC
NM_001261.3       CCACCGCGCCGGAAGGGCAGCCAGATCACCCAGCAGTCCACCAACCAGAGTCGCAATCCC
                  ************************************************************

HsCD00040051      GCCACCACCAACCAGACGGAGTTTGAGCGCGTCTTCTTG
NM_001261.3       GCCACCACCAACCAGACGGAGTTTGAGCGCGTCTTCTGA
                  ************************************* .

Pathways

Reactome : Disease
Reactome : Elongation arrest and recovery
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Gene Expression
Reactome : Generic Transcription Pathway
Reactome : HIV elongation arrest and recovery
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : Host Interactions of HIV factors
Reactome : Interactions of Tat with host cellular proteins
Reactome : Late Phase of HIV Life Cycle
Reactome : Loss of Function of SMAD2/3 in Cancer
Reactome : Loss of Function of SMAD4 in Cancer
Reactome : Loss of Function of TGFBR1 in Cancer
Reactome : Loss of Function of TGFBR2 in Cancer
Reactome : Pausing and recovery of HIV elongation
Reactome : Pausing and recovery of Tat-mediated HIV elongation
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : Signal Transduction
Reactome : Signaling by TGF-beta Receptor Complex
Reactome : Signaling by TGF-beta Receptor Complex in Cancer
Reactome : SMAD2/3 MH2 Domain Mutants in Cancer
Reactome : SMAD2/3 Phosphorylation Motif Mutants in Cancer
Reactome : SMAD2/SMAD3:SMAD4 heterotrimer regulates transcription
Reactome : SMAD4 MH2 Domain Mutants in Cancer
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Tat-mediated HIV elongation arrest and recovery
Reactome : TGFBR1 KD Mutants in Cancer
Reactome : TGFBR1 LBD Mutants in Cancer
Reactome : TGFBR2 Kinase Domain Mutants in Cancer
Reactome : TGFBR2 MSI Frameshift Mutants in Cancer
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transcriptional activity of SMAD2/SMAD3:SMAD4 heterotrimer
WikiPathway : IL-9 signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy

Clone

Cloning Information : 263695
HIP Master Clone ID : 196483
Original Clone ID : FLH263695.01L

Organism


TAX_ID : 9606
Species Specific ID: 1025

Genome

Chromosome : 9
Map Location : 9q34.1
Ensembl : ENSG00000136807

Reagents

Labome : cdk9-antibody