DNASU Plasmid Repository • 480.965.5697 | Email

SOS2 (Homo sapiens) in pANT7_cGST (GST-tagged in vitro expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SOS2
Gene Name:  son of sevenless homolog 2 (Drosophila)
Sequence              Map: pANT7_cGST.doc
Original Clone ID: None
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pANT7_cGST               Format:  FUSION
Source: Center for Personalized Diagnostics
Description: None
Comments: generated from ORFeome entry clone (IMAGE:100072971)
Mutation/
Discrepancy :
No / No
Publications: None
Authors: Center for Personalized Diagnostics
HsCD00403583

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3996nts         Open reading frame : 1 to 3996
Reference Sequence Alignment

ATGCAGCAGGCGCCGCAGCCTTACGAGTTCTTCAGCGAGGAGAACAGTCCGAAATGGCGG
GGACTGTTGGTCTCGGCCCTGCGGAAGGTTCAGGAACAAGTGCATCCCACTCTCTCAGCT
AATGAAGAGTCTCTCTATTATATTGAAGAGCTGATTTTTCAGCTGCTTAATAAATTATGC
ATGGCCCAGCCAAGGACTGTTCAAGATGTAGAGGAGCGAGTTCAGAAGACCTTTCCTCAC
CCAATTGATAAATGGGCCATTGCTGATGCACAATCTGCTATAGAAAAACGAAAACGAAGA
AATCCTCTTTTACTGCCTGTGGACAAAATCCATCCTTCGTTGAAGGAAGTATTAGGGTAC
AAAGTGGACTACCATGTATCCCTATATATTGTGGCTGTACTAGAGTATATCTCAGCTGAT
ATTTTAAAATTGGCTGGTAATTATGTTTTTAATATCCGGCATTATGAAATATCTCAGCAG
GACATTAAAGTGTCAATGTGTGCGGATAAGGTTTTGATGGACATGTTTGATCAGGATGAC
ATAGGTTTGGTTTCTCTCTGTGAAGATGAACCTAGTTCTTCTGGTGAATTAAACTACTAT
GATCTTGTCAGAACTGAAATCGCAGAAGAAAGACAGTATCTACGGGAATTAAATATGATC
ATAAAAGTGTTTCGAGAAGCCTTTCTTTCTGATAGAAAGCTGTTTAAACCTTCTGATATC
GAAAAGATTTTTAGTAACATTTCAGATATACATGAATTGACTGTGAAACTTTTAGGTTTG
ATTGAAGACACAGTTGAAATGACTGATGAAAGCAGTCCTCATCCCTTAGCTGGCAGCTGT
TTTGAAGATTTGGCAGAAGAGCAAGCATTTGATCCTTATGAAACATTATCACAGGACATT
CTTTCACCAGAGTTTCATGAACATTTCAATAAATTGATGGCCAGACCTGCAGTTGCTCTA
CACTTTCAGTCCATTGCTGATGGTTTTAAAGAGGCAGTTCGTTATGTCCTTCCACGTCTT
ATGCTGGTGCCAGTGTATCACTGTTGGCACTACTTTGAGTTACTAAAGCAATTGAAAGCA
TGTAGTGAAGAACAAGAAGACAGAGAATGTTTGAACCAAGCTATTACTGCTCTCATGAAT
CTCCAAGGTAGCATGGACCGAATTTACAAGCAGTATTCACCTAGACGTCGACCTGGAGAT
CCTGTTTGCCCTTTTTATAGTCACCAATTAAGAAGCAAACACCTGGCTATCAAAAAAATG
AATGAAATTCAGAAAAATATCGATGGATGGGAAGGCAAAGATATTGGACAGTGTTGTAAT
GAATTCATTATGGAGGGACCATTGACAAGAATCGGTGCCAAACATGAACGGCATATTTTT
CTGTTTGATGGCTTAATGATCAGTTGTAAACCTAATCATGGCCAGACTCGGCTTCCAGGT
TACAGTAGTGCAGAATACAGGTTAAAAGAAAAATTTGTCATGAGGAAAATACAAATTTGT
GATAAAGAAGATACTTGTGAGCACAAGCATGCATTTGAATTAGTATCCAAAGATGAGAAC
AGCATAATATTTGCTGCTAAGTCTGCTGAAGAAAAAAACAACTGGATGGCAGCCCTTATT
TCTCTTCATTATCGTAGTACTCTAGATCGAATGTTAGATTCAGTATTATTGAAAGAAGAA
AATGAGCAACCACTGAGATTACCAAGTCCTGAAGTATATCGTTTTGTAGTAAAAGACTCT
GAGGAAAACATTGTTTTTGAAGACAACTTGCAAAGTAGAAGTGGCATCCCCATTATTAAA
GGAGGAACTGTAGTGAAATTAATTGAAAGGTTAACATATCATATGTATGCAGATCCCAAT
TTTGTTCGTACTTTTCTTACCACATATCGTTCATTTTGTAAACCACAGGAATTGCTGAGC
TTACTGATTGAACGGTTTGAAATTCCAGAGCCAGAACCTACTGACGCAGACAAATTGGCA
ATAGAGAAAGGCGAGCAGCCAATCAGTGCAGACCTTAAAAGATTTCGCAAGGAATATGTC
CAACCAGTACAACTTAGGATCTTAAATGTATTTCGGCATTGGGTTGAACATCATTTTTAT
GACTTTGAAAGAGACTTGGAATTGCTTGAAAGACTAGAATCCTTCATTTCAAGTGTAAGA
GGGAAAGCTATGAAAAAATGGGTAGAGTCAATTGCTAAGATCATCAGGAGGAAGAAGCAA
GCTCAGGCAAACGGAGTAAGCCATAATATTACCTTTGAAAGTCCACCTCCACCAATTGAA
TGGCATATCAGCAAACCAGGACAGTTTGAAACATTTGATCTCATGACACTTCATCCAATA
GAAATTGCACGTCAGCTGACACTTTTGGAGTCTGATCTTTACAGGAAAGTTCAACCGTCT
GAACTTGTAGGGAGTGTGTGGACCAAAGAAGATAAAGAAATAAATTCTCCAAATTTATTA
AAAATGATTCGCCATACCACAAATCTCACCCTCTGGTTTGAAAAATGCATTGTGGAAGCA
GAAAATTTTGAAGAACGGGTGGCAGTACTAAGTAGAATTATAGAAATTCTGCAAGTTTTT
CAAGATTTGAATAATTTCAATGGCGTATTGGAGATAGTCAGTGCAGTAAATTCAGTGTCA
GTATACAGACTAGACCATACCTTTGAGGCACTGCAGGAAAGGAAAAGGAAAATTTTGGAC
GAAGCTGTGGAATTAAGTCAAGATCACTTTAAAAAATACCTAGTAAAACTTAAGTCAATC
AATCCACCTTGTGTGCCTTTTTTTGGAATATATTTAACAAATATTCTGAAGACCGAAGAA
GGGAATAATGATTTTTTAAAAAAGAAAGGGAAAGATTTAATCAATTTCAGTAAGAGGAGG
AAAGTAGCTGAAATTACTGGAGAAATTCAGCAGTATCAGAATCAGCCTTACTGTTTACGG
ATAGAACCAGATATGAGGAGATTCTTTGAAAACCTTAACCCCATGGGAAGTGCATCTGAA
AAAGAGTTTACAGATTATTTGTTCAACAAGTCACTAGAAATTGAACCTCGAAACTGCAAA
CAGCCACCTCGATTTCCTAGGAAATCAACTTTTTCCTTAAAATCTCCTGGAATAAGGCCT
AACACAGGCCGACATGGCTCTACCTCAGGTACTTTACGAGGTCACCCAACACCATTAGAA
AGAGAACCATGTAAAATAAGCTTTAGTCGGATTGCTGAAACTGAGCTGGAATCAACAGTG
TCAGCACCAACCTCTCCAAATACACCATCTACTCCACCAGTATCTGCTTCTTCAGACCTT
AGTGTATTTTTAGATGTGGATCTCAACAGCTCCTGTGGCAGCAATAGCATCTTTGCTCCA
GTGCTTTTGCCACATTCAAAGTCTTTCTTTAGTTCATGTGGTAGTTTACATAAACTAAGT
GAAGAGCCCCTGATTCCTCCTCCTCTTCCTCCTCGAAAAAAGTTTGATCATGATGCTTCA
AATTCCAAGGGAAATATGAAATCTGATGATGATCCTCCTGCTATTCCACCGAGACAGCCT
CCTCCTCCAAAGGTAAAACCCAGAGTTCCTGTTCCTACTGGTGCATTTGATGGGCCTCTG
CATAGTCCACCTCCGCCACCACCAAGAGATCCTCTTCCTGATACCCCTCCACCAGTTCCC
CTTCGGCCTCCAGAACACTTTATAAACTGTCCATTTAATCTTCAGCCACCTCCACTGGGG
CATCTTCACAGAGATTCAGACTGGCTCAGAGACATTAGTACGTGTCCAAATTCGCCAAGC
ACTCCTCCTAGCACACCCTCTCCAAGGGTACCGCGTCGATGCTATGTGCTCAGTTCTAGT
CAGAATAATCTTGCTCATCCTCCAGCTCCCCCTGTTCCACCAAGGCAGAATTCAAGCCCT
CATCTGCCAAAACTGCCACCAAAGACTTACAAACGGGAGCTTTCGCACCCCCCATTGTAC
AGACTGCCTTTGCTAGAAAATGCAGAAACTCCCCAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None
Discrepancy:
None
5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pANT7_cGST

pANT7_cGST in advanced viewed

Synonyms: pANT7-cGST
Sequencing Primer: Forward:  NAP150
Reverse:  NAP138R
Description: with tag/fusion/marker assay, Gateway and reg, acceptor (destination), recombinational cloning clone, in vitro transcription expression with attR1 and NAP150 and ccdB and attR2 and GST and CmR and T7 and NAP138 and ColE and AmpR ampicillin resistance in bacterial
Comments: One in a series of pANT7 vectors made by A. Lau and N. Ramachandran for use with NAPPA arrays. Can be used for cell free expression of the gene insert using human IVTT from Thermo Fisher or rabbit reticulocyte systems
Size (bp): 5964
Parent Vector: None
Empty Vector: EvNO00023103
Properties: Gateway, acceptor (destination), in vitro transcription, recombinational cloning, with tag/fusion/marker
Author Name: Al Lau
Niroshan Ramachandran
Joshua LaBaer
Publications: PMID: 15232106
Title: Self-assembling protein microarrays

Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 bacterial origin of replication 3931 3249
death cassette ccdB ccdB death cassette present in 'empty vector' form only (replace with gene of interest) 1876 2085
primer NAP138 NAP138 reverse sequencing primer 5? TGTTTCGCCATTTATCACCTTC 3? 2405 2384
primer NAP150 Forward sequencing primer NAP150 5?-CCC ATT GTA TGG GAT CTG ATC-3? 388 408
promoter T7 T7 transcriptional start sequence 5940 5964
recombination site attR2 AttR2 site for recombination in empty vector 2236 2251
recombination site attR1 AttR1 site for recombination in empty vector 549 565
selectable marker CmR chloramphenicol resistance 782 1438
selectable marker AmpR ampicillin resistance gene 4688 4029
tag GST Glutathione transferase (GST) tag 2282 2950

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SOS2
Symbol Nomenclature : SOS2
Designation : SOS-2|guanine nucleotide exchange factor|guanine nucleotide releasing factor|son of sevenless homolog 2
Full Nomenclature : son of sevenless homolog 2 (Drosophila)
GENEID : 6655
GenBank Accession : HQ258542
HGNC : 11188
MIM : 601247
Vega : OTTHUMG00000140292
Target GenBank: HQ258542

 

Reference Sequence Alignment

  

HsCD00403583        ATGCAGCAGGCGCCGCAGCCTTACGAGTTCTTCAGCGAGGAGAACAGTCCGAAATGGCGG
XM_005268021.1      ------------------------------------------------------------
NM_006939.2         ATGCAGCAGGCGCCGCAGCCTTACGAGTTCTTCAGCGAGGAGAACAGTCCGAAATGGCGG
                                                                                

HsCD00403583        GGACTGTTGGTCTCGGCCCTGCGGAAGGTTCAGGAACAAGTGCATCCCACTCTCTCAGCT
XM_005268021.1      ------------------------------------------------------------
NM_006939.2         GGACTGTTGGTCTCGGCCCTGCGGAAGGTTCAGGAACAAGTGCATCCCACTCTCTCAGCT
                                                                                

HsCD00403583        AATGAAGAGTCTCTCTATTATATTGAAGAGCTGATTTTTCAGCTGCTTAATAAATTATGC
XM_005268021.1      ------------------------------------------------------------
NM_006939.2         AATGAAGAGTCTCTCTATTATATTGAAGAGCTGATTTTTCAGCTGCTTAATAAATTATGC
                                                                                

HsCD00403583        ATGGCCCAGCCAAGGACTGTTCAAGATGTAGAGGAGCGAGTTCAGAAGACCTTTCCTCAC
XM_005268021.1      ATGGCCCAGCCAAGGACTGTTCAAGATGTAGAGGAGCGAGTTCAGAAGACCTTTCCTCAC
NM_006939.2         ATGGCCCAGCCAAGGACTGTTCAAGATGTAGAGGAGCGAGTTCAGAAGACCTTTCCTCAC
                    ************************************************************

HsCD00403583        CCAATTGATAAATGGGCCATTGCTGATGCACAATCTGCTATAGAAAAACGAAAACGAAGA
XM_005268021.1      CCAATTGATAAATGGGCCATTGCTGATGCACAATCTGCTATAGAAAAACGAAAACGAAGA
NM_006939.2         CCAATTGATAAATGGGCCATTGCTGATGCACAATCTGCTATAGAAAAACGAAAACGAAGA
                    ************************************************************

HsCD00403583        AATCCTCTTTTACTGCCTGTGGACAAAATCCATCCTTCGTTGAAGGAAGTATTAGGGTAC
XM_005268021.1      AATCCTCTTTTACTGCCTGTGGACAAAATCCATCCTTCGTTGAAGGAAGTATTAGGGTAC
NM_006939.2         AATCCTCTTTTACTGCCTGTGGACAAAATCCATCCTTCGTTGAAGGAAGTATTAGGGTAC
                    ************************************************************

HsCD00403583        AAAGTGGACTACCATGTATCCCTATATATTGTGGCTGTACTAGAGTATATCTCAGCTGAT
XM_005268021.1      AAAGTGGACTACCATGTATCCCTATATATTGTGGCTGTACTAGAGTATATCTCAGCTGAT
NM_006939.2         AAAGTGGACTACCATGTATCCCTATATATTGTGGCTGTACTAGAGTATATCTCAGCTGAT
                    ************************************************************

HsCD00403583        ATTTTAAAATTGGCTGGTAATTATGTTTTTAATATCCGGCATTATGAAATATCTCAGCAG
XM_005268021.1      ATTTTAAAATTGGCTGGTAATTATGTTTTTAATATCCGGCATTATGAAATATCTCAGCAG
NM_006939.2         ATTTTAAAATTGGCTGGTAATTATGTTTTTAATATCCGGCATTATGAAATATCTCAGCAG
                    ************************************************************

HsCD00403583        GACATTAAAGTGTCAATGTGTGCGGATAAGGTTTTGATGGACATGTTTGATCAGGATGAC
XM_005268021.1      GACATTAAAGTGTCAATGTGTGCGGATAAGGTTTTGATGGACATGTTTGATCAGGATGAC
NM_006939.2         GACATTAAAGTGTCAATGTGTGCGGATAAGGTTTTGATGGACATGTTTGATCAGGATGAC
                    ************************************************************

HsCD00403583        ATAGGTTTGGTTTCTCTCTGTGAAGATGAACCTAGTTCTTCTGGTGAATTAAACTACTAT
XM_005268021.1      ATAGGTTTGGTTTCTCTCTGTGAAGATGAACCTAGTTCTTCTGGTGAATTAAACTACTAT
NM_006939.2         ATAGGTTTGGTTTCTCTCTGTGAAGATGAACCTAGTTCTTCTGGTGAATTAAACTACTAT
                    ************************************************************

HsCD00403583        GATCTTGTCAGAACTGAAATCGCAGAAGAAAGACAGTATCTACGGGAATTAAATATGATC
XM_005268021.1      GATCTTGTCAGAACTGAAATCGCAGAAGAAAGACAGTATCTACGGGAATTAAATATGATC
NM_006939.2         GATCTTGTCAGAACTGAAATCGCAGAAGAAAGACAGTATCTACGGGAATTAAATATGATC
                    ************************************************************

HsCD00403583        ATAAAAGTGTTTCGAGAAGCCTTTCTTTCTGATAGAAAGCTGTTTAAACCTTCTGATATC
XM_005268021.1      ATAAAAGTGTTTCGAGAAGCCTTTCTTTCTGATAGAAAGCTGTTTAAACCTTCTGATATC
NM_006939.2         ATAAAAGTGTTTCGAGAAGCCTTTCTTTCTGATAGAAAGCTGTTTAAACCTTCTGATATC
                    ************************************************************

HsCD00403583        GAAAAGATTTTTAGTAACATTTCAGATATACATGAATTGACTGTGAAACTTTTAGGTTTG
XM_005268021.1      GAAAAGATTTTTAGTAACATTTCAGATATACATGAATTGACTGTGAAACTTTTAGGTTTG
NM_006939.2         GAAAAGATTTTTAGTAACATTTCAGATATACATGAATTGACTGTGAAACTTTTAGGTTTG
                    ************************************************************

HsCD00403583        ATTGAAGACACAGTTGAAATGACTGATGAAAGCAGTCCTCATCCCTTAGCTGGCAGCTGT
XM_005268021.1      ATTGAAGACACAGTTGAAATGACTGATGAAAGCAGTCCTCATCCCTTAGCTGGCAGCTGT
NM_006939.2         ATTGAAGACACAGTTGAAATGACTGATGAAAGCAGTCCTCATCCCTTAGCTGGCAGCTGT
                    ************************************************************

HsCD00403583        TTTGAAGATTTGGCAGAAGAGCAAGCATTTGATCCTTATGAAACATTATCACAGGACATT
XM_005268021.1      TTTGAAGATTTGGCAGAAGAGCAAGCATTTGATCCTTATGAAACATTATCACAGGACATT
NM_006939.2         TTTGAAGATTTGGCAGAAGAGCAAGCATTTGATCCTTATGAAACATTATCACAGGACATT
                    ************************************************************

HsCD00403583        CTTTCACCAGAGTTTCATGAACATTTCAATAAATTGATGGCCAGACCTGCAGTTGCTCTA
XM_005268021.1      CTTTCACCAGAGTTTCATGAACATTTCAATAAATTGATGGCCAGACCTGCAGTTGCTCTA
NM_006939.2         CTTTCACCAGAGTTTCATGAACATTTCAATAAATTGATGGCCAGACCTGCAGTTGCTCTA
                    ************************************************************

HsCD00403583        CACTTTCAGTCCATTGCTGATGGTTTTAAAGAGGCAGTTCGTTATGTCCTTCCACGTCTT
XM_005268021.1      CACTTTCAGTCCATTGCTGATGGTTTTAAAGAGGCAGTTCGTTATGTCCTTCCACGTCTT
NM_006939.2         CACTTTCAGTCCATTGCTGATGGTTTTAAAGAGGCAGTTCGTTATGTCCTTCCACGTCTT
                    ************************************************************

HsCD00403583        ATGCTGGTGCCAGTGTATCACTGTTGGCACTACTTTGAGTTACTAAAGCAATTGAAAGCA
XM_005268021.1      ATGCTGGTGCCAGTGTATCACTGTTGGCACTACTTTGAGTTACTAAAGCAATTGAAAGCA
NM_006939.2         ATGCTGGTGCCAGTGTATCACTGTTGGCACTACTTTGAGTTACTAAAGCAATTGAAAGCA
                    ************************************************************

HsCD00403583        TGTAGTGAAGAACAAGAAGACAGAGAATGTTTGAACCAAGCTATTACTGCTCTCATGAAT
XM_005268021.1      TGTAGTGAAGAACAAGAAGACAGAGAATGTTTGAACCAAGCTATTACTGCTCTCATGAAT
NM_006939.2         TGTAGTGAAGAACAAGAAGACAGAGAATGTTTGAACCAAGCTATTACTGCTCTCATGAAT
                    ************************************************************

HsCD00403583        CTCCAAGGTAGCATGGACCGAATTTACAAGCAGTATTCACCTAGACGTCGACCTGGAGAT
XM_005268021.1      CTCCAAGGTAGCATGGACCGAATTTACAAGCAGTATTCACCTAGACGTCGACCTGGAGAT
NM_006939.2         CTCCAAGGTAGCATGGACCGAATTTACAAGCAGTATTCACCTAGACGTCGACCTGGAGAT
                    ************************************************************

HsCD00403583        CCTGTTTGCCCTTTTTATAGTCACCAATTAAGAAGCAAACACCTGGCTATCAAAAAAATG
XM_005268021.1      CCTGTTTGCCCTTTTTATAGTCACCAATTAAGAAGCAAACACCTGGCTATCAAAAAAATG
NM_006939.2         CCTGTTTGCCCTTTTTATAGTCACCAATTAAGAAGCAAACACCTGGCTATCAAAAAAATG
                    ************************************************************

HsCD00403583        AATGAAATTCAGAAAAATATCGATGGATGGGAAGGCAAAGATATTGGACAGTGTTGTAAT
XM_005268021.1      AATGAAATTCAGAAAAATATCGATGGATGGGAAGGCAAAGATATTGGACAGTGTTGTAAT
NM_006939.2         AATGAAATTCAGAAAAATATCGATGGATGGGAAGGCAAAGATATTGGACAGTGTTGTAAT
                    ************************************************************

HsCD00403583        GAATTCATTATGGAGGGACCATTGACAAGAATCGGTGCCAAACATGAACGGCATATTTTT
XM_005268021.1      GAATTCATTATGGAGGGACCATTGACAAGAATCGGTGCCAAACATGAACGGCATATTTTT
NM_006939.2         GAATTCATTATGGAGGGACCATTGACAAGAATCGGTGCCAAACATGAACGGCATATTTTT
                    ************************************************************

HsCD00403583        CTGTTTGATGGCTTAATGATCAGTTGTAAACCTAATCATGGCCAGACTCGGCTTCCAGGT
XM_005268021.1      CTGTTTGATGGCTTAATGATCAGTTGTAAACCTAATCATGGCCAGACTCGGCTTCCAGGT
NM_006939.2         CTGTTTGATGGCTTAATGATCAGTTGTAAACCTAATCATGGCCAGACTCGGCTTCCAGGT
                    ************************************************************

HsCD00403583        TACAGTAGTGCAGAATACAGGTTAAAAGAAAAATTTGTCATGAGGAAAATACAAATTTGT
XM_005268021.1      TACAGTAGTGCAGAATACAGGTTAAAAGAAAAATTTGTCATGAGGAAAATACAAATTTGT
NM_006939.2         TACAGTAGTGCAGAATACAGGTTAAAAGAAAAATTTGTCATGAGGAAAATACAAATTTGT
                    ************************************************************

HsCD00403583        GATAAAGAAGATACTTGTGAGCACAAGCATGCATTTGAATTAGTATCCAAAGATGAGAAC
XM_005268021.1      GATAAAGAAGATACTTGTGAGCACAAGCATGCATTTGAATTAGTATCCAAAGATGAGAAC
NM_006939.2         GATAAAGAAGATACTTGTGAGCACAAGCATGCATTTGAATTAGTATCCAAAGATGAGAAC
                    ************************************************************

HsCD00403583        AGCATAATATTTGCTGCTAAGTCTGCTGAAGAAAAAAACAACTGGATGGCAGCCCTTATT
XM_005268021.1      AGCATAATATTTGCTGCTAAGTCTGCTGAAGAAAAAAACAACTGGATGGCAGCCCTTATT
NM_006939.2         AGCATAATATTTGCTGCTAAGTCTGCTGAAGAAAAAAACAACTGGATGGCAGCCCTTATT
                    ************************************************************

HsCD00403583        TCTCTTCATTATCGTAGTACTCTAGATCGAATGTTAGATTCAGTATTATTGAAAGAAGAA
XM_005268021.1      TCTCTTCATTATCGTAGTACTCTAGATCGAATGTTAGATTCAGTATTATTGAAAGAAGAA
NM_006939.2         TCTCTTCATTATCGTAGTACTCTAGATCGAATGTTAGATTCAGTATTATTGAAAGAAGAA
                    ************************************************************

HsCD00403583        AATGAGCAACCACTGAGATTACCAAGTCCTGAAGTATATCGTTTTGTAGTAAAAGACTCT
XM_005268021.1      AATGAGCAACCACTGAGATTACCAAGTCCTGAAGTATATCGTTTTGTAGTAAAAGACTCT
NM_006939.2         AATGAGCAACCACTGAGATTACCAAGTCCTGAAGTATATCGTTTTGTAGTAAAAGACTCT
                    ************************************************************

HsCD00403583        GAGGAAAACATTGTTTTTGAAGACAACTTGCAAAGTAGAAGTGGCATCCCCATTATTAAA
XM_005268021.1      GAGGAAAACATTGTTTTTGAAGACAACTTGCAAAGTAGAAGTGGCATCCCCATTATTAAA
NM_006939.2         GAGGAAAACATTGTTTTTGAAGACAACTTGCAAAGTAGAAGTGGCATCCCCATTATTAAA
                    ************************************************************

HsCD00403583        GGAGGAACTGTAGTGAAATTAATTGAAAGGTTAACATATCATATGTATGCAGATCCCAAT
XM_005268021.1      GGAGGAACTGTAGTGAAATTAATTGAAAGGTTAACATATCATATGTATGCAGATCCCAAT
NM_006939.2         GGAGGAACTGTAGTGAAATTAATTGAAAGGTTAACATATCATATGTATGCAGATCCCAAT
                    ************************************************************

HsCD00403583        TTTGTTCGTACTTTTCTTACCACATATCGTTCATTTTGTAAACCACAGGAATTGCTGAGC
XM_005268021.1      TTTGTTCGTACTTTTCTTACCACATATCGTTCATTTTGTAAACCACAGGAATTGCTGAGC
NM_006939.2         TTTGTTCGTACTTTTCTTACCACATATCGTTCATTTTGTAAACCACAGGAATTGCTGAGC
                    ************************************************************

HsCD00403583        TTACTGATTGAACGGTTTGAAATTCCAGAGCCAGAACCTACTGACGCAGACAAATTGGCA
XM_005268021.1      TTACTGATTGAACGGTTTGAAATTCCAGAGCCAGAACCTACTGACGCAGACAAATTGGCA
NM_006939.2         TTACTGATTGAACGGTTTGAAATTCCAGAGCCAGAACCTACTGACGCAGACAAATTGGCA
                    ************************************************************

HsCD00403583        ATAGAGAAAGGCGAGCAGCCAATCAGTGCAGACCTTAAAAGATTTCGCAAGGAATATGTC
XM_005268021.1      ATAGAGAAAGGCGAGCAGCCAATCAGTGCAGACCTTAAAAGATTTCGCAAGGAATATGTC
NM_006939.2         ATAGAGAAAGGCGAGCAGCCAATCAGTGCAGACCTTAAAAGATTTCGCAAGGAATATGTC
                    ************************************************************

HsCD00403583        CAACCAGTACAACTTAGGATCTTAAATGTATTTCGGCATTGGGTTGAACATCATTTTTAT
XM_005268021.1      CAACCAGTACAACTTAGGATCTTAAATGTATTTCGGCATTGGGTTGAACATCATTTTTAT
NM_006939.2         CAACCAGTACAACTTAGGATCTTAAATGTATTTCGGCATTGGGTTGAACATCATTTTTAT
                    ************************************************************

HsCD00403583        GACTTTGAAAGAGACTTGGAATTGCTTGAAAGACTAGAATCCTTCATTTCAAGTGTAAGA
XM_005268021.1      GACTTTGAAAGAGACTTGGAATTGCTTGAAAGACTAGAATCCTTCATTTCAAGTGTAAGA
NM_006939.2         GACTTTGAAAGAGACTTGGAATTGCTTGAAAGACTAGAATCCTTCATTTCAAGTGTAAGA
                    ************************************************************

HsCD00403583        GGGAAAGCTATGAAAAAATGGGTAGAGTCAATTGCTAAGATCATCAGGAGGAAGAAGCAA
XM_005268021.1      GGGAAAGCTATGAAAAAATGGGTAGAGTCAATTGCTAAGATCATCAGGAGGAAGAAGCAA
NM_006939.2         GGGAAAGCTATGAAAAAATGGGTAGAGTCAATTGCTAAGATCATCAGGAGGAAGAAGCAA
                    ************************************************************

HsCD00403583        GCTCAGGCAAACGGAGTAAGCCATAATATTACCTTTGAAAGTCCACCTCCACCAATTGAA
XM_005268021.1      GCTCAGGCAAACGGAGTAAGCCATAATATTACCTTTGAAAGTCCACCTCCACCAATTGAA
NM_006939.2         GCTCAGGCAAACGGAGTAAGCCATAATATTACCTTTGAAAGTCCACCTCCACCAATTGAA
                    ************************************************************

HsCD00403583        TGGCATATCAGCAAACCAGGACAGTTTGAAACATTTGATCTCATGACACTTCATCCAATA
XM_005268021.1      TGGCATATCAGCAAACCAGGACAGTTTGAAACATTTGATCTCATGACACTTCATCCAATA
NM_006939.2         TGGCATATCAGCAAACCAGGACAGTTTGAAACATTTGATCTCATGACACTTCATCCAATA
                    ************************************************************

HsCD00403583        GAAATTGCACGTCAGCTGACACTTTTGGAGTCTGATCTTTACAGGAAAGTTCAACCGTCT
XM_005268021.1      GAAATTGCACGTCAGCTGACACTTTTGGAGTCTGATCTTTACAGGAAAGTTCAACCGTCT
NM_006939.2         GAAATTGCACGTCAGCTGACACTTTTGGAGTCTGATCTTTACAGGAAAGTTCAACCGTCT
                    ************************************************************

HsCD00403583        GAACTTGTAGGGAGTGTGTGGACCAAAGAAGATAAAGAAATAAATTCTCCAAATTTATTA
XM_005268021.1      GAACTTGTAGGGAGTGTGTGGACCAAAGAAGATAAAGAAATAAATTCTCCAAATTTATTA
NM_006939.2         GAACTTGTAGGGAGTGTGTGGACCAAAGAAGATAAAGAAATAAATTCTCCAAATTTATTA
                    ************************************************************

HsCD00403583        AAAATGATTCGCCATACCACAAATCTCACCCTCTGGTTTGAAAAATGCATTGTGGAAGCA
XM_005268021.1      AAAATGATTCGCCATACCACAAATCTCACCCTCTGGTTTGAAAAATGCATTGTGGAAGCA
NM_006939.2         AAAATGATTCGCCATACCACAAATCTCACCCTCTGGTTTGAAAAATGCATTGTGGAAGCA
                    ************************************************************

HsCD00403583        GAAAATTTTGAAGAACGGGTGGCAGTACTAAGTAGAATTATAGAAATTCTGCAAGTTTTT
XM_005268021.1      GAAAATTTTGAAGAACGGGTGGCAGTACTAAGTAGAATTATAGAAATTCTGCAAGTTTTT
NM_006939.2         GAAAATTTTGAAGAACGGGTGGCAGTACTAAGTAGAATTATAGAAATTCTGCAAGTTTTT
                    ************************************************************

HsCD00403583        CAAGATTTGAATAATTTCAATGGCGTATTGGAGATAGTCAGTGCAGTAAATTCAGTGTCA
XM_005268021.1      CAAGATTTGAATAATTTCAATGGCGTATTGGAGATAGTCAGTGCAGTAAATTCAGTGTCA
NM_006939.2         CAAGATTTGAATAATTTCAATGGCGTATTGGAGATAGTCAGTGCAGTAAATTCAGTGTCA
                    ************************************************************

HsCD00403583        GTATACAGACTAGACCATACCTTTGAGGCACTGCAGGAAAGGAAAAGGAAAATTTTGGAC
XM_005268021.1      GTATACAGACTAGACCATACCTTTGAGGCACTGCAGGAAAGGAAAAGGAAAATTTTGGAC
NM_006939.2         GTATACAGACTAGACCATACCTTTGAGGCACTGCAGGAAAGGAAAAGGAAAATTTTGGAC
                    ************************************************************

HsCD00403583        GAAGCTGTGGAATTAAGTCAAGATCACTTTAAAAAATACCTAGTAAAACTTAAGTCAATC
XM_005268021.1      GAAGCTGTGGAATTAAGTCAAGATCACTTTAAAAAATACCTAGTAAAACTTAAGTCAATC
NM_006939.2         GAAGCTGTGGAATTAAGTCAAGATCACTTTAAAAAATACCTAGTAAAACTTAAGTCAATC
                    ************************************************************

HsCD00403583        AATCCACCTTGTGTGCCTTTTTTTGGAATATATTTAACAAATATTCTGAAGACCGAAGAA
XM_005268021.1      AATCCACCTTGTGTGCCTTTTTTTGGAATATATTTAACAAATATTCTGAAGACCGAAGAA
NM_006939.2         AATCCACCTTGTGTGCCTTTTTTTGGAATATATTTAACAAATATTCTGAAGACCGAAGAA
                    ************************************************************

HsCD00403583        GGGAATAATGATTTTTTAAAAAAGAAAGGGAAAGATTTAATCAATTTCAGTAAGAGGAGG
XM_005268021.1      GGGAATAATGATTTTTTAAAAAAGAAAGGGAAAGATTTAATCAATTTCAGTAAGAGGAGG
NM_006939.2         GGGAATAATGATTTTTTAAAAAAGAAAGGGAAAGATTTAATCAATTTCAGTAAGAGGAGG
                    ************************************************************

HsCD00403583        AAAGTAGCTGAAATTACTGGAGAAATTCAGCAGTATCAGAATCAGCCTTACTGTTTACGG
XM_005268021.1      AAAGTAGCTGAAATTACTGGAGAAATTCAGCAGTATCAGAATCAGCCTTACTGTTTACGG
NM_006939.2         AAAGTAGCTGAAATTACTGGAGAAATTCAGCAGTATCAGAATCAGCCTTACTGTTTACGG
                    ************************************************************

HsCD00403583        ATAGAACCAGATATGAGGAGATTCTTTGAAAACCTTAACCCCATGGGAAGTGCATCTGAA
XM_005268021.1      ATAGAACCAGATATGAGGAGATTCTTTGAAAACCTTAACCCCATGGGAAGTGCATCTGAA
NM_006939.2         ATAGAACCAGATATGAGGAGATTCTTTGAAAACCTTAACCCCATGGGAAGTGCATCTGAA
                    ************************************************************

HsCD00403583        AAAGAGTTTACAGATTATTTGTTCAACAAGTCACTAGAAATTGAACCTCGAAACTGCAAA
XM_005268021.1      AAAGAGTTTACAGATTATTTGTTCAACAAGTCACTAGAAATTGAACCTCGAAACTGCAAA
NM_006939.2         AAAGAGTTTACAGATTATTTGTTCAACAAGTCACTAGAAATTGAACCTCGAAACTGCAAA
                    ************************************************************

HsCD00403583        CAGCCACCTCGATTTCCTAGGAAATCAACTTTTTCCTTAAAATCTCCTGGAATAAGGCCT
XM_005268021.1      CAGCCACCTCGATTTCCTAGGAAATCAACTTTTTCCTTAAAATCTCCTGGAATAAGGCCT
NM_006939.2         CAGCCACCTCGATTTCCTAGGAAATCAACTTTTTCCTTAAAATCTCCTGGAATAAGGCCT
                    ************************************************************

HsCD00403583        AACACAGGCCGACATGGCTCTACCTCAGGTACTTTACGAGGTCACCCAACACCATTAGAA
XM_005268021.1      AACACAGGCCGACATGGCTCTACCTCAGGTACTTTACGAGGTCACCCAACACCATTAGAA
NM_006939.2         AACACAGGCCGACATGGCTCTACCTCAGGTACTTTACGAGGTCACCCAACACCATTAGAA
                    ************************************************************

HsCD00403583        AGAGAACCATGTAAAATAAGCTTTAGTCGGATTGCTGAAACTGAGCTGGAATCAACAGTG
XM_005268021.1      AGAGAACCATGTAAAATAAGCTTTAGTCGGATTGCTGAAACTGAGCTGGAATCAACAGTG
NM_006939.2         AGAGAACCATGTAAAATAAGCTTTAGTCGGATTGCTGAAACTGAGCTGGAATCAACAGTG
                    ************************************************************

HsCD00403583        TCAGCACCAACCTCTCCAAATACACCATCTACTCCACCAGTATCTGCTTCTTCAGACCTT
XM_005268021.1      TCAGCACCAACCTCTCCAAATACACCATCTACTCCACCAGTATCTGCTTCTTCAGACCTT
NM_006939.2         TCAGCACCAACCTCTCCAAATACACCATCTACTCCACCAGTATCTGCTTCTTCAGACCTT
                    ************************************************************

HsCD00403583        AGTGTATTTTTAGATGTGGATCTCAACAGCTCCTGTGGCAGCAATAGCATCTTTGCTCCA
XM_005268021.1      AGTGTATTTTTAGATGTGGATCTCAACAGCTCCTGTGGCAGCAATAGCATCTTTGCTCCA
NM_006939.2         AGTGTATTTTTAGATGTGGATCTCAACAGCTCCTGTGGCAGCAATAGCATCTTTGCTCCA
                    ************************************************************

HsCD00403583        GTGCTTTTGCCACATTCAAAGTCTTTCTTTAGTTCATGTGGTAGTTTACATAAACTAAGT
XM_005268021.1      GTGCTTTTGCCACATTCAAAGTCTTTCTTTAGTTCATGTGGTAGTTTACATAAACTAAGT
NM_006939.2         GTGCTTTTGCCACATTCAAAGTCTTTCTTTAGTTCATGTGGTAGTTTACATAAACTAAGT
                    ************************************************************

HsCD00403583        GAAGAGCCCCTGATTCCTCCTCCTCTTCCTCCTCGAAAAAAGTTTGATCATGATGCTTCA
XM_005268021.1      GAAGAGCCCCTGATTCCTCCTCCTCTTCCTCCTCGAAAAAAGTTTGATCATGATGCTTCA
NM_006939.2         GAAGAGCCCCTGATTCCTCCTCCTCTTCCTCCTCGAAAAAAGTTTGATCATGATGCTTCA
                    ************************************************************

HsCD00403583        AATTCCAAGGGAAATATGAAATCTGATGATGATCCTCCTGCTATTCCACCGAGACAGCCT
XM_005268021.1      AATTCCAAGGGAAATATGAAATCTGATGATGATCCTCCTGCTATTCCACCGAGACAGCCT
NM_006939.2         AATTCCAAGGGAAATATGAAATCTGATGATGATCCTCCTGCTATTCCACCGAGACAGCCT
                    ************************************************************

HsCD00403583        CCTCCTCCAAAGGTAAAACCCAGAGTTCCTGTTCCTACTGGTGCATTTGATGGGCCTCTG
XM_005268021.1      CCTCCTCCAAAGGTAAAACCCAGAGTTCCTGTTCCTACTGGTGCATTTGATGGGCCTCTG
NM_006939.2         CCTCCTCCAAAGGTAAAACCCAGAGTTCCTGTTCCTACTGGTGCATTTGATGGGCCTCTG
                    ************************************************************

HsCD00403583        CATAGTCCACCTCCGCCACCACCAAGAGATCCTCTTCCTGATACCCCTCCACCAGTTCCC
XM_005268021.1      CATAGTCCACCTCCGCCACCACCAAGAGATCCTCTTCCTGATACCCCTCCACCAGTTCCC
NM_006939.2         CATAGTCCACCTCCGCCACCACCAAGAGATCCTCTTCCTGATACCCCTCCACCAGTTCCC
                    ************************************************************

HsCD00403583        CTTCGGCCTCCAGAACACTTTATAAACTGTCCATTTAATCTTCAGCCACCTCCACTGGGG
XM_005268021.1      CTTCGGCCTCCAGAACACTTTATAAACTGTCCATTTAATCTTCAGCCACCTCCACTGGGG
NM_006939.2         CTTCGGCCTCCAGAACACTTTATAAACTGTCCATTTAATCTTCAGCCACCTCCACTGGGG
                    ************************************************************

HsCD00403583        CATCTTCACAGAGATTCAGACTGGCTCAGAGACATTAGTACGTGTCCAAATTCGCCAAGC
XM_005268021.1      CATCTTCACAGAGATTCAGACTGGCTCAGAGACATTAGTACGTGTCCAAATTCGCCAAGC
NM_006939.2         CATCTTCACAGAGATTCAGACTGGCTCAGAGACATTAGTACGTGTCCAAATTCGCCAAGC
                    ************************************************************

HsCD00403583        ACTCCTCCTAGCACACCCTCTCCAAGGGTACCGCGTCGATGCTATGTGCTCAGTTCTAGT
XM_005268021.1      ACTCCTCCTAGCACACCCTCTCCAAGGGTACCGCGTCGATGCTATGTGCTCAGTTCTAGT
NM_006939.2         ACTCCTCCTAGCACACCCTCTCCAAGGGTACCGCGTCGATGCTATGTGCTCAGTTCTAGT
                    ************************************************************

HsCD00403583        CAGAATAATCTTGCTCATCCTCCAGCTCCCCCTGTTCCACCAAGGCAGAATTCAAGCCCT
XM_005268021.1      CAGAATAATCTTGCTCATCCTCCAGCTCCCCCTGTTCCACCAAGGCAGAATTCAAGCCCT
NM_006939.2         CAGAATAATCTTGCTCATCCTCCAGCTCCCCCTGTTCCACCAAGGCAGAATTCAAGCCCT
                    ************************************************************

HsCD00403583        CATCTGCCAAAACTGCCACCAAAGACTTACAAACGGGAGCTTTCGCACCCCCCATTGTAC
XM_005268021.1      CATCTGCCAAAACTGCCACCAAAGACTTACAAACGGGAGCTTTCGCACCCCCCATTGTAC
NM_006939.2         CATCTGCCAAAACTGCCACCAAAGACTTACAAACGGGAGCTTTCGCACCCCCCATTGTAC
                    ************************************************************

HsCD00403583        AGACTGCCTTTGCTAGAAAATGCAGAAACTCCCCAA---
XM_005268021.1      AGACTGCCTTTGCTAGAAAATGCAGAAACTCCCCAATGA
NM_006939.2         AGACTGCCTTTGCTAGAAAATGCAGAAACTCCCCAATGA
                    ************************************   

Pathways

NCI : Regulation of Ras family activation
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : FGF signaling pathway
Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Integrin signalling pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : PI3 kinase pathway
Panther : Ras Pathway
Panther : T cell activation
Reactome : Activation of Rac
Reactome : Axon guidance
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Developmental Biology
Reactome : G alpha (12/13) signalling events
Reactome : GPCR downstream signaling
Reactome : NRAGE signals death through JNK
Reactome : Rho GTPase cycle
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signaling by Rho GTPases
Reactome : Signaling by Robo receptor
Reactome : Signalling by NGF
Reactome : p75 NTR receptor-mediated signalling
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Insulin Signaling
WikiPathway : MAPK signaling pathway
WikiPathway : Regulation of Actin Cytoskeleton

Clone

Cloning Information : 574294

Organism


TAX_ID : 9606
Species Specific ID: 6655

Genome

Chromosome : 14
Map Location : 14q21
Ensembl : ENSG00000100485

Reagents

Labome : SOS2-antibody